Also see the Terms of Use and the complete list of papers published by PomBase.
To cite anything from PomBase, including
please use:
Harris MA, Rutherford KM, Hayles J, Lock A, Bähler J, Oliver S, Mata J, Wood V
Fission stories: Using PomBase to understand Schizosaccharomyces pombe biology
Genetics, 2021; iyab222
PMID:35100366 10.1093/genetics/iyab222
To cite the S. pombe genome sequence, use:
Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, Sgouros J, Peat N, Hayles J, Baker S, et al.
The genome sequence of Schizosaccharomyces pombe.
Nature. 2002 Feb 21;415(6874):871-80. Erratum in: Nature 2003 Jan 2;421(6918):94. Cerrutti L [corrected to Cerutti L].
PMID:11859360 - Full text at Nature
To cite the S. pombe Gene Ontology annotation data, use two papers from the 2018 NAR Database Issue:
The Gene Ontology Consortium.
The Gene Ontology Resource: 20 years and still GOing strong.
Nucleic Acids Res. 2018 (Database issue): gky1055 Epub 2018 Nov 5.
PMID:30395331 - DOI:10.1093/nar/gky1055
(Note that GO annotation for S. pombe has also been previously published, but we now recommend the 2018 NAR paper as it is more up-to-date. The older publication is Aslett M, Wood V. Gene Ontology annotation status of the fission yeast genome: preliminary coverage approaches 100%. Yeast 2006 Oct 15;23(13):913-9. Erratum in Yeast 2007 May;24(5):457. PMID:17072883)
To cite the Fission Yeast Phenotype Ontology (FYPO) and/or S. pombe FYPO annotation data, use:
Harris MA, Lock A, Bähler J, Oliver SG, Wood V.
FYPO: The Fission Yeast Phenotype Ontology.
Bioinformatics. 2013 Jul 1;29(13):1671-8. Epub 2013 May 8.
PMID:23658422 - DOI:10.1093/bioinformatics/btt266.
Full text at Bioinformatics: HTML or PDF
To cite the online curaton tool Canto, use:
Rutherford KM, Harris MA, Lock A, Oliver SG, Wood V.
Canto: An online tool for community literature curation.
Bioinformatics. 2014 Jun 15;30(12):1791-2. Epub 2014 Feb 25.
PMID:24574118 - DOI: 10.1093/bioinformatics/btu103
To cite the manually curated S. cerevisiae or human orthologs (displayed on gene pages or downloaded), use the NAR database paper as noted above. Note that the manually curated orthologs use several data sources including Compara, but are distinct from the Compara results themselves.
Wood V, Harris MA, McDowall MD, Rutherford K, Vaughan BW, Staines DM, Aslett M, Lock A, Bähler J, Kersey PJ, Oliver SG.
PomBase: a comprehensive online resource for fission yeast.
Nucleic Acids Res. 2012 Jan;40(Database issue):D695-9. Epub 2011 Oct 28.
PMID:22039153 - DOI: 10.1093/nar/gkr853 - Full text at NAR
Altmetric badges link to data provided by Altmetric.com, a research metrics company who track and collect the online conversations around millions of scholarly outputs. Read more about Altmetrics.
Monarch is a platform that connects phenotypes to environmental factors and genotypes, integrating phenotypes from multiple species to make them queryable in a single portal, and use the combined knowledge to better understand human disease. We are currently in the process of integrating our phenotype data into Monarch.
Mondo is a disease ontology developed as part of the Monarch initiative. It aims to merge multiple disease ontologies and develop guidelines for disease logical definitions, which are computer-readable. We actively contribute to the development of this ontology, and link fission yeast genes with Mondo terms.
uPheno is another component of the Monarch Initiative with the goal of integrating multiple phenotype ontologies into a unified cross-species phenotype ontology to make them interoperable. This interoperability is achieved by developing templates for phenotype logical definitions. We interact with uPheno developers to develop and implement standardised definition templates into FYPO .
Pfam and InterPro are protein family databases. We have been collaborating with the Pfam and InterPro teams at the EBI for almost two decades, submitting over 1000 protein families via Pfam and providing QC for InterPro to GO mapping assignments. Recently, to increase ortholog coverage, we collaborated with the Pfam team to identify distant orthologs using AlphaFold reciprocal best structure hits. See this preprint.
Intermine is a data warehouse that integrates heterogeneous data from different model organisms. Users can simultaneously query data from Schizosaccharomyces pombe and other organisms through a website, a web API or client libraries in several programming languages. We have actively collaborated with InterMine to integrate data from PomBase into a ‘PombeMine’ and to improve PombeMine to better support our users. Read more.
The Gene Ontology Consortium oversees the development of GO, to standardise the functional description of gene products. PomBase is a member of the GO consortium. PomBase Co-PI and project manager Valerie Wood is a member of the GO council, and funded to work on GO development as PI of a GO subcontract. Our curators actively contribute to GO development requesting changes and additions to the ontology. We also participate in other GO-related projects, for example:
PHI-base is a pathogen-host interaction database. PomBase supports PHI-base by adapting Canto (our community curation tool) for their curation and advising on phenotype ontology and literature curation.
FlyBase is a model organism for Drosophila. PomBase supports FlyBase by adapting Canto (our community curation tool) for their complex phenotype annotation.
RNAcentral is a non-coding RNA sequence database. As part of our data dissemination obligations, along with other model organism databases, we provide curated non-coding RNAs to RNA Central. We also collaborate to improve noncoding RNA classification.
BioGRID is a database for genetic and physical interactions. They curate interactions from publications that are integrated into PomBase, and vice-versa, to avoid duplication of curation effort. This is part of our data-dissemination obligations.
microPublication is a peer-reviewed journal that publishes one-figure papers with novel findings, negative or reproduced results, and results that may lack a broader scientific narrative. We are a partner database and provide curator input and promote articles on our website. This novel format incentivises reporting small and negative results, preventing research duplication and waste of research funding.
JaponicusDB is the model organism database for the fission yeast Schizosaccharomyces japonicus, an emerging model organism. JaponicusDB uses PomBase’s website code and its curation is entirely provided by the authors using Canto. This database was set up in a sprint of less than three months, and is a success story that shows that PomBase code and curation tools are reusable. Read more.
Valerie de Crecy-Lagard recently organised a workshop funded by NSF to devise a roadmap for the functional annotation of protein families. PomBase staff participated in the discussion (publication pending).
Genestorian is a project that aims to develop: (1) Open standards to document the generation of plasmids and strains in a machine-readable format, with an emphasis on interoperability, adhering to FAIR principles. (2) Easy to use web tools for experimental researchers to document strain and plasmid generation in their collections by leveraging those open standards.
We will not use cookies to collect personally identifiable information about you.
A cookie is a file that is stored on your computer when you visit a website. Most websites use them and they are generally harmless. When you revisit the website later or visit a different webpage a copy of the cookie file is sent to the website.
Cookies can be used to store information and have many uses. With the most common being tracking, remembering your details or settings, and to keep you logged in to an account.
You may refuse to accept cookies by activating the setting on your browser which allows you to refuse the setting of cookies. However, if you select this setting you may be unable to access certain parts of our site. Unless you have adjusted your browser setting so that it will refuse cookies, our system will issue cookies when you visit our site.
You can find out more information about cookies from the following websites:
Like most interactive websites our site uses cookies to enable us to retrieve user details for each visit. These pieces of information are used to improve services for you, for example, by:
measuring how many people are using our website, so they can be made easier to use and to ensure there is enough capacity
analysing anonymised data to help us understand how people interact with our website so we can make it better.
This website contains links to and from third-party sites. This policy only covers use of cookies on this site. You should consult privacy and cookie policies on third-party sites before you submit any personal data. PomBase is not responsible for any cookies that may be set by third-party websites that are linked to from pages on www.pombase.org.
Table of cookies we use on our site:
| Name | Description | More information |
|---|---|---|
| Canto_pombe__session | Cookie set by Canto | PomBase privacy policy |
| _ga _gali _gid _gat _gat_jbrowseTracker __utma __utmb __utmc __utmt __utmz |
Cookies used by Google Analytics, which we use to measure website usage | Google’s privacy policy and Google Analytics Cookie descriptions |
These cookies are essential to enable you to move around the website and use its features, such as accessing secure areas of the website. Without these cookies, our website won’t work properly.
These cookies collect information about how you use our website, for instance, which pages you visit most often and if you get any error messages from those pages. Google Analytics sets cookies to help us accurately estimate the number of visitors to the website and volumes of usage. This is to ensure that we provide a fast service that is available when you want it.
PomBase has accounts or pages with external resources including Twitter (@PomBase), Facebook (www.facebook.com/pombase), LinkedIn (www.linkedin.com/groups/5122686), and GitHub (github.com/pombase). All use cookie technology, and maintain their own privacy policies.
If you notice a cookie that slips past us or have a question about cookies then please contact us.
You may refuse to accept cookies by activating the setting on your browser which allows you to refuse the setting of cookies. However, if you select this setting you may be unable to access certain parts of our site. Unless you have adjusted your browser setting so that it will refuse cookies, our system will issue cookies when you visit our site. We recommend visiting your browser help section to find out more about managing cookies.
Do not track is a relatively new feature in web browsers which allows you to tell websites that you do not want to be tracked. While not all websites currently use this, you can find out more how to set it up on your browser from the following websites:
Also see the Terms of Use.
For images used on the home page, see the Research Spotlight archive and links therein.
These publications describe datasets displayed as genome browser tracks. Each PubMed ID links to the PomBase publication page for the paper, which in turn links to PubMed and EuropePMC. Full text and repository database links will be available via PubMed and EuropePMC where relevant.
GO:
FYPO:
PSI-MOD:
PomBase is the comprehensive model organism knowledgebase for the fission yeast Schizosaccharomyces pombe, which aims to standardise, integrate, display, and disseminate biological knowledge and datasets to the wider scientific community, making a wide range of data-types from large and small-scale publications FAIR.
You can use PomBase to:
PomBase is also a community hub for researchers providing news, events, documentation, mailing lists, genome statistics, and a community curation interface. New to the fission yeast community? Visit our getting started page.
Email: helpdesk@pombase.org
For more information, see the PomBase Staff page.
See the Submit data page
Source publications for external data used in PomBase pages and genome browser.
The Citing PomBase page lists papers to cite for PomBase, the S. pombe genome sequence, annotation data, and other resources.
Terms of Use for PomBase data and Canto.
Complete list of papers published by PomBase.
Scientific Advisory Board members
Current and past PomBase Staff
Versions of internal and external data loaded into current and past PomBase releases.
Subscribe to Pombelist to receive annotation and data updates
See the PomBase privacy policy and cookie policy.
PomBase is funded by the Wellcome Trust [218236/Z/19/Z].
The new PomBase web site was released on October 24, 2017.
The new site uses streamlined back-end data storage and retrieval procedures that support nightly data updates and a host of other improvements:
We thank the members of the fission yeast research community who have followed its progress via the preview site, and welcome feedback from all users.
The PomBase Scientific Advisory Board (SAB) provides strategic scientific advice to the PomBase resource covering current and future priorities related to curation, tools provided and outreach. They will advise how can we better align S. pombe knowledge to human genetics and health. The SAB is an independent body, made up of leading experts in both fission yeast biology and Model Organism Databases from around the world. The SAB meets annually, but are also the first point of contact for intermittent feedback on resource reallocation that may affect the wider community.
Li-Lin Du
National Institute of Biological Sciences, Beijing, China
Kathleen Gould
Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN, USA
Doug Howe
The Zebrafish Information Network, University of Oregon, Eugene, OR, USA
Sabina Leonelli
Exeter Centre for the Study of the Life Sciences & Department of Sociology, Philosophy and Anthropology, University of Exeter, Exeter, UK
Samuel Marguerat
UCL Cancer Institute, London, UK
Sophie Martin
Department of Fundamental Microbiology, University of Lausanne, Lausanne, Switzerland
Email: helpdesk@pombase.org
Post:
PomBase
Department of Biochemistry
University of Cambridge
80 Tennis Court Road
Cambridge
CB2 1GA
United Kingdom
PomBase (we or us) is committed to protecting and respecting your privacy.
This policy (together with our Cookie Policy, Terms of Use and any other documents referred to) sets out the basis on which any personal data we collect from you, or that you provide to us, will be processed by us. Please read the following carefully to understand our views and practices regarding your personal data and how we will treat it.
For the purpose of the General Data Protection Regulation (GDPR), PomBase is the data controller. To contact us, email helpdesk@pombase.org or see the About PomBase page for address details.
Through our website (www.pombase.org), we may collect and process the following data about you:
We may also access information from other sources when you interact with PomBase online:
We use information held about you in the following ways:
you are consenting to PomBase storing and using it for the purposes for which it was provided. We will not use your personal information to contact you unless you have specifically requested to receive information from us.
We will hold your personal data for no longer than necessary for the purposes explained in this document.
We rely on Article 6(1)(f) of the GDPR as the lawful basis on which we collect and use your personal data. That means that we can collect and use your personal data on the basis that it is necessary for the purposes of our legitimate interests, except where our interests are overridden by your privacy interests.
Our legitimate interests are maintaining our data resources, providing data and services to our users, and raising awareness of PomBase and fission yeast research online, in print, and in person.
We may disclose your personal information to the PomBase collaboration’s member institutions (University of Cambridge, University College London, the Babraham Institute) as necessary for the purposes of our legitimate interests as given above.
We may also disclose your personal information to third parties if we are under a duty to disclose or share your personal data in order to comply with any legal obligation, or in order to enforce or apply our Terms of use and other agreements; or to protect the rights, property, or safety of our member institutions or others.
Our site may, from time to time, contain links to and from the websites of other online biological databases and similar resources. If you follow a link to any of these websites, please note that these websites have their own privacy policies and that we do not accept any responsibility or liability for these policies. Please check these policies before you submit any personal data to these websites.
We will not share your personal information with any other third party.
Under the General Data Protection Regulation you have a number of important rights free of charge. In summary, those include rights to:
For further information on each of those rights, including the circumstances in which they apply, see the Guidance from the UK Information Commissioner’s Office (ICO) on individuals’ rights under the General Data Protection Regulation.
If you would like to exercise any of those rights, please contact us (see below).
We hope that we can resolve any query or concern you raise about our use of your information.
The General Data Protection Regulation gives you right to lodge a complaint with a supervisory authority, in particular in the European Union (or European Economic Area) state where you work, normally live or where any alleged infringement of data protection laws occurred. The supervisory authority in the UK is the Information Commissioner, who may be contacted at ico.org.uk/concerns.
This privacy notice was published on 20 September 2018.
We may change this privacy notice from time to time. You should check this policy occasionally to ensure you are aware of the most recent version.
For any further enquiries about the PomBase’s Privacy Policy, or if you have concerns about how your data is being processed or would like to report a possible data breach, please contact helpdesk@pombase.org.
In addition to adding value to data through the curation process, at PomBase we also contribute to the broader curation life cycle by working with other resources to develop, adopt and promote curation best practices. In this role, we contribute to the development of global standards, improve data dissemination, develop rigorous annotation quality control procedures, and share the tools and resources we have developed.
Database and website development: we develop the Open Source code for this website and the underlying database, constantly improving it so that researchers can quickly and intuitively interrogate our annotations. The code is modular, easily configurable and extendable to support other model organisms (see PMID:35380656). Visit our code repository and publications PMID:30321395, PMID:35100366.
High quality literature curation: we manually curate papers, request or create new ontology terms for new observations, and actively work to quality control and improve our existing annotations. We involve authors in this process to ensure curation quality. Curation is particularly important to “FAIRify” and maximise the impact of results coming from small-scale publications that address mechanistic details, as it integrates the new knowledge into a greater body of annotations that can be queried, reused and more easily discovered. We have more than 300.000 manually curated annotations. See our curation stats.
Ontology development: we contribute to the development of several ontologies, to extend and improve standards that represent the knowledge produced by researchers. We are the sole developers of FYPO, the Fission Yeast Phenotype Ontology, but we are also major contributors to the Gene Ontology and contribute substantially to the Monarch disease ontology (MONDO). We contribute to the sequence ontology, Protein Ontology (PR) and CHEBI ontology as required for our annotation and ontology development work.
Development of Canto: Canto is an Open Source web-based curation tool that provides an intuitive interface for ontology-based literature curation, and a literature management system where publications are triaged by broad content type and classified by their curation stage. Canto is generic and extendable, and is used by other model organism databases (including FlyBase, PHI-base, japonicusDB) . Canto is actively developed and adapted to the needs of different resources and researchers. See “Community curation” below, our code repository and PMID:24574118.
Community curation: PomBase involves authors in the curation of their papers, in a way that, without dedicated training, they can contribute detailed and structured annotations. Community curation is supported by our web-based curation tool, Canto, which allows for an iterative dialogue with authors that speeds up the curation process, improves annotation quality through expert approval, makes authors more familiar with the curation process and supported data-types and often leads to feedback from the authors about existing annotations. For more on community curation visit our curation stats and PMID:32353878.
Maintenance of the genome annotation: To allow accurate functional genomics and genomic interrogation in fission yeast we periodically incorporate new data to keep the genome annotation current. Updates can include revisions to existing protein coding gene structures, or more precise transcript boundaries, and new non-coding RNAs) sourced from user communications, gene specific publications or transcriptomics and proteomic datasets. Our updates are propagated to NCBI/ENA/Ensembl reference genomes, and UniPROT reference proteome.
Causal modelling of biological pathways: We have piloted a system to generate ‘causal’ networks (connecting genes and their activities into pathways using casual relationships) directly from Gene Ontology annotation data. To date almost 55% fission yeast proteins are included in at least one automated process network. We are currently using these networks to target literature curation gaps. During our current funding cycle, we will collaborate with GO to formalise these causal connections into GO-CAM syntax and then to provide automated biological pathway visualisation based on curated data.
Human and budding yeast ortholog curation: We provide a manually refined inventory of consensus ortholog datasets (3991 S. cerevisiae and 3597 human orthologs) and actively work to extend it by targeting missing components of complexes involved in conserved eukaryotic biology. Distant orthologs are still being found even in heavily researched model organisms. Some recent examples using AlphaFold and Reciprocal Best Structure Hits (RBSH) can be found here.
Priority unstudied genes: we have developed a method to generate inventories of proteins of unknown biological role based on GO process slims (PMID:30938578). In pombe, 133 genes that are conserved in vertebrates have unknown functions. We actively encourage PomBase researchers and the wider community users to investigate the unknown”ome”. See the list.
Disease gene annotation: identification of disease gene connections between yeast and humans increases the relevance of the study of yeast genes. We integrate with several databases of human disease genes (Malacards, Monarch, OMM) and use data from publications to connect disease ontology terms to fission yeast orthologs.
Fission yeast gene nomenclature: we approve requested gene names in consultation with the fission yeast Gene Naming committee, and name certain unstudied genes based on orthology.
Fission yeast allele nomenclature: we are currently consulting the fission yeast community to develop nomenclature guidelines to standardise allele naming. They will cover new constructs that are becoming more common, such as chimeras.
Annotation quality control: Often an overlooked component of curation work, refining existing annotations is crucial to ensure accurate queries and knowledge representation. We revisit our existing annotations through small projects where we review a biological process, develop methods to automatically identify annotation errors (GO Term Matrix - PMID:32875947) and adapt to changes in annotation criteria, which generally become stricter.
Outreach and user support: we maintain documentation pages for all features of PomBase. We communicate website updates in our pombe mailing list. In the next months, we plan to release curation tutorials for authors that curate their papers using Canto.
Non-experimental GO annotation: we actively review literature from other model organisms and make inferred annotations to GO terms for genes that are not studied in fission yeast. This ensures breadth of curation, for GO enrichment analysis and for identification of truly unstudied genes. We host 14723 GO annotations that do not come from fission yeast literature, of which 11200 are manually assigned.
Please see the Citing PomBase page, which lists papers to cite for PomBase, the S. pombe genome sequence, Canto, FYPO, annotations and Compara.
Gene Ontology Consortium.
The Gene Ontology knowledgebase in 2023
Genetics, Volume 224, Issue 1, May 2023, iyad031
Vivian Monzon, Typhaine Paysan-Lafosse, Valerie Wood, Alex Bateman
Reciprocal Best Structure Hits: Using AlphaFold models to discover distant homologues
Bioinformatics Advances, October 2022, vbac072
Valérie de Crécy-lagard et al. (including Val Wood)
A roadmap for the functional annotation of protein families: a community perspective
DATABASE, Volume 2022, August 2022, baac062
PMID:35961013 10.1093/database/baac062
Valerie Wood, Paul W Sternberg, Howard D Lipshitz
Making biological knowledge useful for humans and machines
Genetics, Volume 220, Issue 4, April 2022, iyac001
PMID:35380659 10.1093/genetics/iyac001
Harris MA, Rutherford KM, Hayles J, Lock A, Bähler J, Oliver S, Mata J, Wood V
Fission stories: Using PomBase to understand Schizosaccharomyces pombe biology
Genetics, Volume 220, Issue 4, April 2022, iyab222
PMID:35100366 10.1093/genetics/iyab222
Rutherford KM, Harris MA, Oliferenko S, Wood V
JaponicusDB: rapid deployment of a model organism database for an emerging model species
Genetics, Volume 220, Issue 4, April 2022, iyab223
PMID:35380656 10.1093/genetics/iyab223
Urban M, Cuzick A, Seager J, Wood V, Rutherford K, Venkatesh SY, Sahu J, Vijaylakshmi Iyer S, Khamari L, De Silva N, Martinez MC, Pedro H, Yates AD, Hammond-Kosack KE
PHI-base in 2022: a multi-species phenotype database for Pathogen–Host Interactions
NAR, Volume 50, Issue D1, 7 January 2022, Pages D837–D847
PMID:34788826 10.1093/nar/gkab1037
Gene Ontology Consortium.
The Gene Ontology resource: enriching a GOld mine.
Nucleic Acids Res. 2021 Jan 8;49(D1):D325-D334.
PMID:33290552 DOI:10.1093/nar/gkaa1113
Wood V, Carbon S, Harris MA, Lock A, Engel SR, Hill DP, Van Auken K, Attrill H, Feuermann M, Gaudet P, Lovering RC, Poux S, Rutherford KM, Mungall CJ.
Term Matrix: a novel Gene Ontology annotation quality control system based on ontology term co-annotation patterns.
Open Biol 2020 Sep;10(9):200149
PMID:32875947 DOI:10.1098/rsob.200149
Shefchek KA et al. (including Harris MA).
The Monarch Initiative in 2019: an integrative data and analytic platform connecting phenotypes to genotypes across species.
Nucleic Acids Res. 2020 Jan 8;48(Database issue): D704-D715.
PMID:31701156 DOI:10.1093/nar/gkz997
Urban M, Cuzick A, Seager J, Wood V, Rutherford K, Venkatesh SY, De Silva N, Martinez MC, Pedro H, Yates AD, Hassani-Pak K, Hammond-Kosack KE.
PHI-base: the pathogen-host interactions database.
Nucleic Acids Res. 2020 Jan 8;48(Database issue): D613-D620.
PMID:31733065 DOI:10.1093/nar/gkz904
Lock A, Harris MA, Rutherford K, Hayles J, Wood V.
Community curation in PomBase: enabling fission yeast experts to provide detailed, standardized, sharable annotation from research publications.
Database (Oxford) 2020 Jan 1;2020. pii: baaa028.
PMID:32353878 DOI:10.1093/database/baaa028
Dikicioglu D, Nightingale DJH, Wood V, Lilley KS, Oliver SG.
Transcriptional regulation of the genes involved in protein metabolism and processing in Saccharomyces cerevisiae.
* FEMS Yeast Res.* 2019 Mar 1;19(2):foz014.
PMID:30753445 DOI:10.1093/femsyr/foz014
Wood V, Lock A, Harris MA, Rutherford K, Bähler J, Oliver SG.
Hidden in plain sight: What remains to be discovered in the eukaryotic proteome?
Open Biol 2019 Feb 28;9(2):180241.
PMID:30938578 DOI:10.1098/rsob.180241
The Gene Ontology Consortium.
The Gene Ontology Resource: 20 years and still GOing strong.
Nucleic Acids Res. 2019 Jan 8;47(Database issue):D330-D338.
PMID:30395331 DOI:10.1093/nar/gky1055
The RNAcentral Consortium.
RNAcentral: a hub of information for non-coding RNA sequences.
Nucleic Acids Res. 2019 Jan 8;47(Database issue):D221-D229. Epub 2018 Nov 5.
PMID:30395267 DOI:10.1093/nar/gky1034 (Correction in DOI:10.1093/nar/gky1206)
Lock A, Rutherford K, Harris MA, Hayles J, Oliver SG, Bähler J; Wood V.
PomBase 2018: user-driven reimplementation of the fission yeast database provides rapid and intuitive access to diverse, interconnected information.
Nucleic Acids Res. 2019 Jan 8;47(Database issue): D821-D827. Epub 2018 Oct 13.
PMID:30321395 DOI:10.1093/nar/gky961
Gene Ontology Consortium.
Annotation of gene product function from high-throughput studies using the Gene Ontology.
Database (Oxford). 2019 Jan 1;2019:baz007.
PMID:30715275 DOI:10.1093/database/baz007
Urban M, Cuzick A, Rutherford K, Irvine A, Pedro H, Pant R, Sadanadan V, Khamari L, Billal S, Mohanty S, Hammond-Kosack KE.
PHI-base: a new interface and further additions for the multi-species pathogen-host interactions database.
Nucleic Acids Res. 2017 Jan 4;45(D1):D604-D610. Epub 2016 Dec 3.
PMID:27915230 DOI:10.1093/nar/gkw1089
The Gene Ontology Consortium
Expansion of the Gene Ontology knowledgebase and resources.
Nucleic Acids Res. 2017 Jan 4;45(D1):D331-D338. Epub 2016 Nov 29.
PMID:27899567 DOI:10.1093/nar/gkw1108
The RNAcentral Consortium
RNAcentral: a comprehensive database of non-coding RNA sequences.
Nucleic Acids Res. 2017 Jan 4;45(D1):D128-D134. Epub 2016 Oct 28.
PMID:27794554 DOI:10.1093/nar/gkw1008
Huntley RP, Sitnikov D, Orlic-Milacic M, Balakrishnan R, D’Eustachio P, Gillespie ME, Howe D, Kalea AZ, Maegdefessel L, Osumi-Sutherland D, Petri V, Smith JR, Van Auken K, Wood V, Zampetaki A, Mayr M, Lovering RC.
Guidelines for the functional annotation of microRNAs using the Gene Ontology.
RNA. 2016 May;22(5):667-76. Epub 2016 Feb 25.
PMID:26917558 DOI:10.1261/rna.055301.115
Oliver SG, Lock A, Harris MA, Nurse P, Wood V.
Model organism databases: essential resources that need the support of both funders and users.
BMC Biol. 2016 14(1): 49.
PMID:27334346 DOI:10.1186/s12915-016-0276-z
Bitton DA, Schubert F, Dey S, Okoniewski M, Smith GC, Khadayate S, Pancaldi V, Wood V, Bähler J.
AnGeLi: A Tool for the Analysis of Gene Lists from Fission Yeast.
Front Genet. 2015 Nov 16;6:330. eCollection 2015.
PMID:26635866 DOI:10.3389/fgene.2015.00330
Hoffman CS, Wood V, Fantes PA.
An Ancient Yeast for Young Geneticists: A Primer on the Schizosaccharomyces pombe Model System.
Genetics. 2015 Oct;201(2):403-23.
PMID:26447128 DOI:10.1534/genetics.115.181503
(Erratum in PMID:26953269 DOI:10.1534/genetics.116.187088)
Gene Ontology Consortium
Gene Ontology Consortium: going forward.
Nucleic Acids Res. 2015 Jan;43(Database issue):D1049-56. Epub 2014 Nov 26.
PMID:25428369 DOI:10.1093/nar/gku1179
McDowall MD, Harris MA, Lock A, Rutherford K, Staines DM, Bähler J, Kersey PJ, Oliver SG, Wood V.
PomBase 2015: updates to the fission yeast database.
Nucleic Acids Res. 2015 Jan;43(Database issue):D665-61. Epub 2014 Oct 31.
PMID:25361970 DOI:10.1093/nar/gku1040
Dikicioglu D, Wood V, Rutherford KM, McDowall MD, Oliver SG.
Improving functional annotation for industrial microbes: a case study with Pichia pastoris.
Trends Biotechnol. 2014 Aug;32(8):396-9. Epub 2014 Jun 11.
PMID:24929579 DOI:10.1016/j.tibtech.2014.05.003
Alam-Faruque Y, Hill DP, Dimmer EC, Harris MA, Foulger RE, Tweedie S, Attrill H, Howe DG, Thomas SR, Davidson D, Woolf AS, Blake JA, Mungall CJ, O’Donovan C, Apweiler R, Huntley RP.
Representing kidney development using the gene ontology.
PLoS One. 2014 Jun 18;9(6):e99864. eCollection 2014.
PMID:24941002 DOI:10.1371/journal.pone.0099864
Huntley RP, Harris MA, Alam-Faruque Y, Blake JA, Carbon S, Dietze H, Dimmer EC, Foulger RE, Hill DP, Khodiyar VK, Lock A, Lomax J, Lovering RC, Mutowo-Meullenet P, Sawford T, Van Auken K, Wood V, Mungall CJ.
A method for increasing expressivity of Gene Ontology annotations using a compositional approach.
BMC Bioinformatics. 2014 May 21;15:155.
PMID:24885854 DOI:10.1186/1471-2105-15-155.
Rutherford KM, Harris MA, Lock A, Oliver SG, Wood V.
Canto: An online tool for community literature curation.
Bioinformatics. 2014 Jun 15;30(12):1791-2. Epub 2014 Feb 25.
PMID:24574118 DOI:10.1093/bioinformatics/btu103
Hill DP, Adams N, Bada M, Batchelor C, Berardini TZ, Dietze H, Drabkin HJ, Ennis M, Foulger RE, Harris MA, Hastings J, Kale NS, de Matos P, Mungall CJ, Owen G, Roncaglia P, Steinbeck C, Turner S, Lomax J.
Dovetailing biology and chemistry: integrating the Gene Ontology with the ChEBI chemical ontology.
BMC Genomics. 2013 Jul 29;14:513.
PMID:23895341 DOI:10.1186/1471-2164-14-513
Balakrishnan R1, Harris MA, Huntley R, Van Auken K, Cherry JM.
A guide to best practices for Gene Ontology (GO) manual annotation.
Database (Oxford). 2013 Jul 9;2013:bat054. Print 2013.
PMID:23842463 DOI:10.1093/database/bat054.
Hayles J, Wood V, Jeffery L, Hoe KL, Kim DU, Park HO, Salas-Pino S, Heichinger C, Nurse P.
A genome-wide resource of cell cycle and cell shape genes of fission yeast.
Open Biol. 2013 May 22;3(5):130053.
PMID:23697806 DOI:10.1098/rsob.130053
Gene Ontology Consortium
Gene Ontology annotations and resources.
Nucleic Acids Res. 2013 Jan;41(Database issue):D530-5. Epub 2012 Nov 17.
PMID:23161678 DOI:10.1093/nar/gks1050
Harris MA, Lock A, Bähler J, Oliver SG, Wood V.
FYPO: The Fission Yeast Phenotype Ontology.
Bioinformatics. 2013 Jul 1;29(13):1671-8. Epub 2013 May 8.
PMID:23658422 DOI:10.1093/bioinformatics/btt266.
Smith RN1, Aleksic J, Butano D, Carr A, Contrino S, Hu F, Lyne M, Lyne R, Kalderimis A, Rutherford K, Stepan R, Sullivan J, Wakeling M, Watkins X, Micklem G.
InterMine: a flexible data warehouse system for the integration and analysis of heterogeneous biological data.
Bioinformatics. 2012 Dec 1;28(23):3163-5. Epub 2012 Sep 27.
PMID:23023984 DOI:10.1093/bioinformatics/bts577
Hoehndorf R, Harris MA, Herre H, Rustici G, Gkoutos GV.
Semantic integration of physiology phenotypes with an application to the Cellular Phenotype Ontology.
Bioinformatics. 2012 Jul 1;28(13):1783-9. Epub 2012 Apr 26.
PMID:22539675 DOI:10.1093/bioinformatics/bts250
Thomas PD, Wood V, Mungall CJ, Lewis SE, Blake JA; Gene Ontology Consortium.- On the Use of Gene Ontology Annotations to Assess Functional Similarity among Orthologs and Paralogs: A Short Report.
PLoS Comput Biol. 2012;8(2):e1002386. Epub 2012 Feb 16.
PMID:22359495 DOI:10.1371/journal.pcbi.1002386
Contrino S, Smith RN, Butano D, Carr A, Hu F, Lyne R, Rutherford K, Kalderimis A, Sullivan J, Carbon S, Kephart ET, Lloyd P, Stinson EO, Washington NL, Perry MD, Ruzanov P, Zha Z, Lewis SE, Stein LD, Micklem G.
modMine: flexible access to modENCODE data.
Nucleic Acids Res. 2012 Jan;40(Database issue):D1082-8. Epub 2011 Nov 12.
PMID:22080565 DOI:10.1093/nar/gkr921
Wood V, Harris MA, McDowall MD, Rutherford K, Vaughan BW, Staines DM, Aslett M, Lock A, Bähler J, Kersey PJ, Oliver SG.
PomBase: a comprehensive online resource for fission yeast.
Nucleic Acids Res. 2012 Jan;40(Database issue):D695-9. Epub 2011 Oct 28.
PMID:22039153 DOI:10.1093/nar/gkr853
Wood V, Harris MA, McDowall MD, Rutherford K, Vaughan BW, Staines DM, Aslett M, Lock A, Bähler J, Kersey PJ, Oliver SG.
PomBase: a comprehensive online resource for fission yeast.
Nucleic Acids Res. 2012 Jan;40(Database issue):D695-9. Epub 2011 Oct 28.
PMID:22039153 DOI:10.1093/nar/gkr853
Leonelli S, Diehl AD, Christie KR, Harris MA, Lomax J.
How the gene ontology evolves.
BMC Bioinformatics. 2011 Aug 5;12:325.
PMID:21819553 DOI:10.1186/1471-2105-12-325
Bitton DA, Wood V, Scutt PJ, Grallert A, Yates T, Smith DL, Hagan IM, Miller CJ.
Augmented annotation of the Schizosaccharomyces pombe genome reveals additional genes required for growth and viability.
Genetics. 2011 Apr;187(4):1207-17. Epub 2011 Jan 26.
PMID:21270388 DOI:10.1534/genetics.110.123497
Gene Ontology Consortium
The Gene Ontology:enhancements for 2011.
Nucleic Acids Res. 2011 Jan;40(Database issue):D559-64. Epub 2012 Nov 17.
PMID:22102568 DOI:10.1093/nar/gkr1028
Kim DU, Hayles J, Kim D, Wood V, Park HO, Won M, Yoo HS, Duhig T, Nam M, Palmer G, Han S, Jeffery L, Baek ST, Lee H, Shim YS, Lee M, Kim L, Heo KS, Noh EJ, Lee AR, Jang YJ, Chung KS, Choi SJ, Park JY, Park Y, Kim HM, Park SK, Park HJ, Kang EJ, Kim HB, Kang HS, Park HM, Kim K, Song K, Song KB, Nurse P, Hoe KL.
Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe.
Nat Biotechnol. 2010 Jun;28(6):617-623. Epub 2010 May 16.
PMID:20473289 DOI:10.1038/nbt.1628
Gene Ontology Consortium
The Gene Ontology in 2010: extensions and refinements.
Nucleic Acids Res. 2010 Jan;38(Database issue):D331-5. Epub 2009 Nov 17.
PMID:19920128 DOI:10.1093/nar/gkp1018
Harris MA, Rutherford KM, Hayles J, Lock A, Bähler J, Oliver SG, Mata J, Wood V.
Fission stories: Using PomBase to understand Schizosaccharomyces pombe biology.
Pre-publication manuscript available at bioRxiv.
Published — see above.
Wood V, Carbon S, Harris MA, Lock A, Engel SR, Hill DP, Van Auken K, Attrill H, Feuermann M, Gaudet P, Lovering RC, Poux S, Rutherford KM, Mungall CJ.
Term Matrix: A novel Gene Ontology annotation quality control system based on ontology term co-annotation patterns.
Pre-publication manuscript available at bioRxiv.
Published — see above.
Wood V, Lock A, Harris MA, Rutherford K, Bähler J, Oliver SG.
Hidden in plain sight: What remains to be discovered in the eukaryotic proteome?
Pre-publication manuscript available at bioRxiv.
Published — see above.
Lock A, Rutherford K, Harris MA, Wood V. 2018.
PomBase: The Scientific Resource for Fission Yeast.
In Kollar M (ed) Eukaryotic Genomic Databases. Methods in Molecular Biology, vol 1757. Humana Press, New York, NY
DOI:10.1007/978-1-4939-7737-6_4
Wood, V., Harris, M., Lock, A., & Rutherford, K.
New PomBase Website 2017, Group Leader Survey Summary.
PomBase 2017-12-01
2017 PomBase infographic (PDF; file at FTP site)
Posters and slides from conferences and workshops are available on the Documents page.
Altmetric badges link to data provided by Altmetric.com, a research metrics company who track and collect the online conversations around millions of scholarly outputs. Read more about Altmetrics.
The Curation Statistics page (currently part of PomBase Canto) provides a set of metrics reflecting the current state of literature curation in PomBase.
Statistics forthcoming
All data curated by PomBase, including data from Canto community curation, are licensed under the Creative Commons Attribution 4.0 International license (CC-BY; see the Creative Commons site for a summary and the full license).
Datasets hosted in the genome browser and front-page Research Spotlight images are used with permission of the generating researchers. Specific copyright and licensing terms may apply; consult the relevant publications (listed on the Data Sources page) for details.
Canto is is licensed under the GNU General Public License v3.0; see the Canto License page for more information.
Also see the Citing PomBase page.
This table records versions of software, annotations, etc. used in the numbered releases of PomBase made between September 2012 and January 2017. See the Chado database dumps page for a link to the data represented by the “Annotation Version” column.
| Release Date | INSDC | Gene Build | Ensembl Software Release | Annotation Version | GO GAF | InterPro | Manually Curated Ortholog table |
| 2017-01-30 | ASM294v2 | 2.1 | e!84, EG30 | 62 | 2017-03-17 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2016-10-21 | ASM294v2 | 2.1 | e!84, EG30 | 61 | 2016-10-21 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2016-06-01 | ASM294v2 | 2.1 | e!84, EG30 | 60 | 2016-06-01 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2016-05-10 | ASM294v2 | 2.1 | e!84, EG30 | 59 | 2016-05-11 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2016-04-12 | ASM294v2 | 2.1 | e!84, EG30 | 58 | 2016-04-12 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2016-02-11 | ASM294v2 | 2.1 | e!83, EG30 | 57 | 2016-02-11 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2015-12-02 | ASM294v2 | 2.1 | e!82, EG29 | 56 | 2015-12-02 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2015-09-29 | ASM294v2 | 2.1 | e!81, EG28 | 55 | 2015-09-29 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2015-09-07 | ASM294v2 | 2.1 | e!81, EG28 | 54 | 2015-09-01 | InterProScan5 (5.14-53.0 23 July 2015) | pombe/cerevisiae: 2.21 (2014-08-31); pombe/human 2015-08-13 |
| 2015-06-17 | ASM294v2 | 2.1 | e!79, EG26 | 53 | 2015-06-17 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2015-05-27 |
| 2015-05-28 | ASM294v2 | 2.1 | e!79, EG26 | 52 | 2015-05-29 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2015-05-27 |
| 2015-04-21 | ASM294v2 | 2.1 | e!79, EG26 | 51 | 2015-04-21 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2015-03-10 |
| 2015-03-25 | ASM294v2 | 2.1 | e!78, EG25 | 50 | 2015-03-25 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2015-03-10 |
| 2015-02-19 | ASM294v2 | 2.1 | e!78, EG25 | 49 | 2015-02-17 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2014-09-01 |
| 2015-01-27 | ASM294v2 | 2.1 | e!78, EG25 | 48 | 2015-01-20 | InterProScan5 (5.8-49.0 20-November-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2014-09-01 |
| 2014-11-13 | ASM294v2 | 2.1 | e!76, EG23 | 47 | 2014-11-13 | InterProScan5 (5.7-48.0 August-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2014-09-01 |
| 2014-09-16 | ASM294v2 | 2.1 | e!76, EG23 | 46 | 2014-09-15 | InterProScan5 (5.7-48.0 August-2014) | pombe/cerevisiae: 2.20 (2014-08-31); pombe/human 2014-09-01 |
| 2014-08-18 | ASM294v2 | 2.1 | e!76, EG23 | 45 | 2014-08-18 | InterProScan5 (5.7-48.0 August-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2014-07-18 | ASM294v2 | 2.1 | e!75, EG22 | 44 | 2014-07-18 | InterProScan5 (5.4-47.0 June-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2014-07-08 | ASM294v2 | 2.1 | e!75, EG22 | 43 | 2014-07-08 | InterProScan5 (5.4-47.0 June-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2014-05-15 | ASM294v2 | 2.1 | e!75, EG22 | 42 | 2014-05-13 | InterProScan5 (5.3-46.0 January-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2014-03-20 | ASM294v2 | 2.1 | e!74, EG21 | 41 | 2014-03-20 | InterProScan5 (5.3-46.0 January-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2014-02-20 | ASM294v2 | 2.1 | e!74, EG21 | 40 | 2014-02-20 | InterProScan5 (5.3-46.0 January-2014) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2013-12-10 | ASM294v2 | 2.1 | e!73, EG20 | 39 | 2013-12-04 | InterProScan5 (2013-04-24) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2013-10-22 | ASM294v2 | 2.1 | e!73, EG20 | 38 | 2013-11-11 | InterProScan5 (2013-04-24) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2013-09-16 | ASM294v2 | 2.1 | e!71, EG18 | 37 | 2013-09-18 | InterProScan5 (2013-04-24) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2013-06-21 | ASM294v2 | 2.1 | e!71, EG18 | 36 | 2013-07-02 | InterProScan5 (2013-04-24) | pombe/cerevisiae: 2.18 (2012-11-07) |
| 2013-05-21 | ASM294v2 | 2.1 | e!71, EG18 | 35 | 2013-06-06 | pombe/cerevisiae: 2.18 (2012-11-07) | |
| 2013-05-07 | ASM294v2 | 2.1 | e!71, EG18 | 34 | 2013-04-18 | pombe/cerevisiae: 2.18 (2012-11-07) | |
| 2013-04-02 | ASM294v2 | 2.1 | e!70, EG17 | 33 | 2013-03-07 | pombe/cerevisiae: 2.18 (2012-11-07) | |
| 2013-02-26 | ASM294v2 | 2.1 | e!70, EG17 | 31 | 2013-01-16 | pombe/cerevisiae: 2.18 (2012-11-07) | |
| 2012-11-19 | ASM294v2 | 2.1 | e!69, EG16 | 30 | 2012-11-27 | pombe/cerevisiae: 2.18 (2012-11-07) | |
| 2012-10 | ASM294v2 | 2.1 | e!69, EG16 | 29 | |||
| 2012-09 | ASM294v2 | 2.1 | e!68, EG15 | 28 |
| Item | Description |
|---|---|
| INSDC | Accession of the current S. pombe sequence in the International Nucleotide Sequence Data Collaboration (ENA, GenBank, DDBJ) databases |
| Gene Build | Version of gene feature annotation |
| Ensembl Software Release | Versions of ensembl (e!) and Ensembl Genomes (EG) data and software used to build PomBase |
| Annotation Version | Version of curated PomBase annotations (sequence features, ontology annotations, etc.) |
| GO GAF | Date on which GO annotation data were retrieved from the GO repository |
| InterPro | Date and version of InterProScan used to find matches to InterPro entries |
| Manually Curated Ortholog table | Date and version of the manually curated sets of pombe/cerevisiae (and, where included, pombe/human) orthologs |
A “slim” is a high-level subset of terms from an ontology, used to analyze sets of annotated genes. The table below shows a slim set of grouping terms that we have selected from the Mondo Disease Ontology (Mondo) and the number of annotations to each term. Mondo IDs link to PomBase ontology term pages. The annotation totals link to pages with information about the term and a list of annotated genes. A gene may be included in the annotation sets for more than one slim term.
You can download a list of current PomBase Mondo slim IDs and term names from the PomBase FTP site.
If you would like to have any terms added to the PomBase Mondo slim set, please contact the helpdesk.
Also see PomBase JBrowse with binding site track enabled.
| Site Name | Consensus Sequence | bound by | Sequence Ontology ID | Reference |
|---|---|---|---|---|
| AACCCT box | ATCA(C/A)AACCCTAACCCT | Ams2, Teb1 | SO:0001901 | PMID:17452352, PMID:4092687 |
| Ace2 UAS | CCAGCC | Ace2 | SO:0001857 | PMID:16678171 |
| AP 1 binding site | TGACTCA | Pap1 | SO:0001842 | PMID:1899230, PMID:3034432, PMID:3125983 |
| calcineurin-dependent response element (CDRE motif) | GNGGCKCA | Prz1 | SO:0001865 | PMID:16928959 |
| CCAAT motif | CCAAT | Php2, Php3, Php4, Php5 | SO:0001856 | PMID:16963626 |
| copper-response element (CuRE) | HTHNNGCTGD | Cuf1 | SO:0001844 | PMID:10593913, PMID:9188496, PMID:9211922 |
| CSL response element | GTGRGAA | Cbf11 | SO:0001839 | PMID:19101542 |
| cyclic AMP response element (CRE) | TGACGTCA | Atf1, Pap1, Pcr1 | SO:0001843 | PMID:11483355, PMID:11483993 |
| DNA damage response element (DRE) | CGWGGWNGMM | Deb1 | SO:0001845 | PMID:11073995, PMID:8668127 |
| FLEX element | GTAAACAAACAAAM | Fkh2, Mei4 | SO:0001846 | PMID:10747048, PMID:14871934 |
| forkhead motif | TTTRTTTACA | Sep1 | SO:0001847 | PMID:15195092 |
| GATA box | WGATAR | Gaf1 | SO:0001840 | PMID:8321208 |
| heat shock element (HSE) | NGAAN (at least 3 copies) | Hsf1, Prr1 | SO:0001850 | PMID:17347150, PMID:8689565 |
| homol D box | CAGTCACA (or inverted form TGTGACTG) | Fhl1, Rrn7 | SO:0001848 | PMID:21673110, PMID:7501449, PMID:8458332 |
| homol E box | ACCCTACCCT (or inverted form AGGGTAGGGT) | Fhl1 | SO:0001849 | PMID:7501449 |
| Inr consensus initiator sequence | PyPyPuN(A/C)(C/A) | SO:0000014 | PMID:25747261 | |
| Inr immediate downstream motif | CC(T/A)(T/C)(T/C/A)(A/G)CCA(A/T/C) | |||
| iron repressed GATA element | WGATAA | Atf1, Fep1 | SO:0001851 | PMID:11956219, PMID:17211681 |
| LOZ1 response element | CGNMGATCNTY | Loz1 | SO:0002225 | PMID:31515876 |
| mating type M-box | ACAAT | Mat1-Mc | SO:0001852 | PMID:9233811 |
| MluI cell cycle box (MCB) | ACGCGT | Cdc10, Res1, Res2, Yox1 | SO:0001855 | PMID:16285853 |
| Pho7 binding site | [5’-TCG(G/C)(A/T)xxTTxAA] | Pho7 | SO:0002216 | PMID:28811350 |
| pombe cell cycle box (PCB) | GNAACR | Sep1, Fkh2, Mbx1 | SO:0001871 | PMID:12411492 |
| Sap1 recognition motif | TARGCAGNTNYAACGMG | Sap1 | SO:0001864 | PMID:16166653, PMID:7651412 |
| sterol regulatory element | ATCACCCCAC (and variants) | Sre1 | SO:0001861 | PMID:11111080, PMID:16537923 |
| STREP motif | CCCCTC | Rst2 | SO:0001859 | PMID:11739717 |
| TATA box | TATA(A|T)A(A|T) | Brf1, Tbp1 | SO:0000174 | PMID:16858867 |
| TR box | TTCTTTGTTY | Ste11, Mat1-Mc | SO:0001858 | PMID:1657709 |
| Zas1 recognition motif | (Y)CCCCAY | Zas1 | SO:0002215 | PMID:29735745 |
| zinc repressed element | GNMGATC | Loz1 | SO:0002006 | PMID:24003116 |
| Site Name | Consensus Sequence | bound by | Sequence Ontology ID | Reference |
|---|---|---|---|---|
| ARS consensus sequence | WTTTAYRTTTW | Cbp1 | SO:0002004 | |
| GT dinucleotide repeat | (GT)n | Tsn1 | SO:0001862 | |
| GTT trinucleotide repeat | (GTT)n | Tsn1 | SO:0001863 | PMID: |
| rDNA intergenic spacer element | AGGTAAGGGTAATGCAC | Reb1 | SO:0001860 | PMID:9016645 |
| telomeric repeat | TTAC(0-1)A(0-1)G(1-8) | Taz1 | SO:0001496 | PMID:8720065 |
SO IDs link to MISO, the Sequence Ontology browser. Consensus sequences use the IUBMB Nomenclature for Incompletely Specified Bases in Nucleic Acid Sequences; briefly:
This table lists drugs that affect S. pombe, and summarizes what is known about their targets or mechanisms of action.
| Drug | Target gene(s) | Cellular target | Process target | Other/notes | Reference |
|---|---|---|---|---|---|
| 1,3-dicyclohexylcarbodiimide (N,N’-dicyclohexylcarbodiimide ; DCCD) | inhibits proton pumps | PMID:33400299 | |||
| 1,10-phenanthroline | RNA polymerases II and III | PMID:27518095 | |||
| 2‐thenoyltrifluoroacetone (TTFA) | inhibits mitochondrial complex II | respiratory electron transport | PMID:33400299 | ||
| CT2108A | fatty acid synthase | ||||
| CT2108B | fatty acid synthase | ||||
| α-amanitin | rpb1 | RNA polymerase II | transcription initiation and elongation | interferes with a protein conformational change underlying the transcription mechanism | PMID:11805306 (PubMed link) |
| alverine citrate | proteasome/lipid synthesis? | ||||
| amiloride | bsu1 | plasma membrane importer | glucose metabolism | PMID:15701794, PMID:8431459 | |
| amphotericin B | ergosterol binding | sterol biosynthesis | forms membrane pores | ||
| anidulafungin | bgs4, bgs1 and/or bgs3 | 1,6 branched 1,3-beta-glucan synthase | cell wall synthesis | cytokinesis is blocked; see also echinocandin | PMID:34959732 |
| anisomycin | translation | ||||
| antifungal azoles | sterol biosynthesis | ||||
| antimycin A | inhibits mitochondrial complex III | respiratory electron transport | PMID:33400299 | ||
| arborcandin C | 1,3-beta-glucan synthase | ||||
| benomyl | nda3 | microtubule cytoskeleton | microtubule destabilizer | ||
| blebbistatin | myo2, myp2 | inhibits myosin II ATPase | PMID:23770677 | ||
| bleomycins | fungal cell wall | septation, cytokinesis | gamma irradiation mimetic | Forsburg lab | |
| bortezomib | proteasome | PMID:25908789 | |||
| brefeldin A | gea1 | intracellular vesicle-mediated transport | inhibits the GEFs for class II ARFs; blocks coat assembly and vesicle budding | PMID:27191590, PMID:1448152 (PubMed link) | |
| Calcofluor White | cell wall synthesis | ||||
| camptothecin | Top1 | topoisomerase 1 | |||
| canavanine | toxic arginine analog | ||||
| cerulenin | β-keto-acyl ACP synthase, HMG-CoA synthase | PMID:30003614 | |||
| chloramphenicol | mitochondrial translation | PMID:20876130 | |||
| chlorpropham (isopropyl N-3-chlorophenyl carbamate) | spindle | spindle poison | |||
| Cutin-1 | fas1 | fatty acid synthase | nuclear envelope expansion during mitosis | PMID:26869222 | |
| cycloheximideg | 60S ribosomal subunit | translation | prevents release of deacetylated tRNA from the E site | ||
| cyclosporin A | calcineurin and cyclophilins | several cyclophilins described in S. pombe | PMID:16134115 | ||
| dehydroxestoquinone | myo2, myp2 | myosin II | inhibits skeletal muscle myosin II | PMID:23770677 | |
| dihydromotuporamine C | proteasome? | lipid synthesis? | |||
| diuron | inhibits mitochondrial complex III | respiratory electron transport | PMID:33400299 | ||
| enfumafungin | bgs4 | 1,6 branched 1,3-beta-glucan synthase | cell wall synthesis | Bgs1 and Bgs3 are unaffected | PMID:21115488 |
| fenpropimorph | proteasome? | lipid synthesis? | |||
| hydroxyurea | suc22 | ribonucleotide reductase small subunit | slows DNA synthesis | causes replication fork stalling | PMID:27869662 (PubMed link) |
| hygromycin B | 40S ribosomal subunit | translation | interferes with translocation of tRNA from the A site to the P site of the ribosome | ||
| itraconazole | spindle | spindle poison | |||
| latrunculin A or latrunculin B | actin polymerization | ||||
| leptomycin B | crm1 | nuclear export | |||
| lovastatin | hmg1 | HMG CoA-reductase (competitive inhibitor) | ergosterol biosynthesis | ||
| metformin | inhibits mitochondrial complex I | respiratory electron transport | PMID:33400299 | ||
| methyl 5-hydroxy-2-benzimidazole carbamate | microtubules | reversible MT inhibitor | |||
| mevastatin (compactin) | hmg1 | HMG CoA-reductase (competitive inhibitor) | ergosterol biosynthesis | ||
| micafungin | bgs4 | 1,6 branched 1,3-beta-glucan synthase | cell wall synthesis | Bgs1 and Bgs3 are unaffected | PMID:34959732 |
| microcystin | PP2A | PMID:29079657 | |||
| monensin | Golgi transmembrane Na+/H+ antiporter | ion transport | |||
| mycophenolic acid | gua1 | IMP dehydrogenase | limits cellular GTP pools | PMID:11535588 (PubMed link) | |
| natamycin | ergosterol binding | blocks fungal growth without permeabilizing the membrane | |||
| NSC624206 | uba1 | Inhibits thioester bond formation between Ub and Uba1 without affecting adenylation activity | PMID:22274912 (PubMed link) | ||
| PYR-41 | uba1 | Inhibits thioester bond formation between Ub and Uba1 without affecting adenylation activity | PMID:22274912 | ||
| nystatin | ergosta-5,7,22,24,(28)-tetraenol binding | ergosterol biosynthesis | antifungal | ||
| oligomycin | inhibits ATP synthase | PMID:33400299 | |||
| orthovanadate (vanadate, sodium vanadate) | H(+)-ATPase, kinesin ATPase, dynein ATPase (not myosin ATPase) | PMID:8431459 (H(+)-ATPase, PMID:23770677 (motor ATPases) | |||
| oxazolidinones | translation | ||||
| papulacandin B | bgs4 | 1,6 branched 1,3-beta-glucan synthase | cell wall synthesis | Bgs1 and Bgs3 are unaffected | PMID:21115488 |
| phleomycin | nucleic acids | antibiotic; damages nucleic acids in the presence of iron when cells are grown aerobically | PMID:17724773 | ||
| pravastatin | hmg1 | HMG-CoA reductase | ergosterol biosynthesis | ||
| rapamycin (sirolimus) | fkh1 | TOR kinase (inhibitor) | cell cycle progression | PMID:11335722 | |
| ricin | ribosome | translation | |||
| rotenone | inhibits mitochondrial complex I | respiratory electron transport | PMID:33400299 | ||
| sanglifehrin A | cyclophilin binding | ||||
| sodium azide (NaN3) | inhibits mitochondrial complex III | respiratory electron transport | PMID:33400299 | ||
| spliceostatin A | binds SF3b components | splicing | PMID:17961508 | ||
| staurosporine | protein kinase | ||||
| tacrolimus (FK506) | fkh1 | TOR kinase (inhibitor) | cell cycle progression | PMID:11335722 | |
| tagetitoxin (tagetin) | rpc53 | RNA polymerase III | RNA polymerases and associated factors (book) | ||
| tamoxifen | ccr1 | NADPH-cytochrome p450 reductase | affects cell wall integrity | PMID:32571823 | |
| terbinafine | erg1 | squalene monooxygenase | sterol biosynthesis | PMID:32320462 | |
| thialysine | naturally occurring, toxic lysine analog | ||||
| torin1 | tor1, tor2 | TOR signaling | PMID:24424027 | ||
| trichostatin A (TSA) | clr3, clr6, hos2 | histone deacetylase | PMID:19723888 | ||
| tunicamycin | N-glycosylation | ||||
| zaragozic acid | N-glycosylation |
A “GO slim” is a subset of the Gene Ontology terms selected for a specific purpose in interpreting large-scale data, such as functional annotation of a genome or high-throughput experimental results. PomBase uses a GO slim to provide a simple summary of S. pombe’s biological capabilities by grouping gene products using broad classifiers.
The table below shows terms in the current fission yeast biological process GO slim, and the number of annotations to each term. GO IDs link to PomBase ontology term pages. Icons beside each GO term link to esyN, which provides a graphical view of interactions for the genes from the PomBase High Confidence Physical Interaction Network (HCPIN) dataset. Only the subset of genes linked into the interaction network will be displayed in the esyN network view. The annotation totals link to pages with information about the term and a list of annotated genes.
Further information is available from the PomBase GO slim documentation and additional pages linked there. You can also download a list of current GO process slim IDs and term names from the PomBase FTP site.
A “GO slim” is a subset of the Gene Ontology terms selected for a specific purpose in interpreting large-scale data, such as functional annotation of a genome or high-throughput experimental results. PomBase uses GO slims to provide a simple summary of S. pombe’s biological capabilities by grouping gene products using broad classifiers.
The table below shows terms in the current fission yeast cellular component GO slim, and the number of annotations to each term. GO IDs link to PomBase ontology term pages. The annotation totals link to pages with information about the term and a list of annotated genes.
Further information is available from the PomBase GO slim documentation and additional pages linked there. You can also download a list of current GO component slim IDs and term names from the PomBase FTP site.
These points will help you understand GO slims, and highlight some features of the fission yeast slim terms and annotations.
A “GO slim” is a subset of the Gene Ontology terms selected for a specific purpose in interpreting large-scale data, such as functional annotation of a genome or high-throughput experimental results. PomBase uses GO slims to provide a simple summary of S. pombe’s biological capabilities by grouping gene products using broad classifiers.
The table below shows terms in the current fission yeast molecular function GO slim, and the number of annotations to each term. GO IDs link to PomBase ontology term pages. The annotation totals link to pages with information about the term and a list of annotated genes.
Further information is available from the PomBase GO slim documentation and additional pages linked there. You can also download a list of current GO function slim IDs and term names from the PomBase FTP site.
PomBase curators develop and use the Fission Yeast Phenotype Ontology (FYPO) to annotate phenotypes of mutant alleles and of over- or under-expressing wild type genes.
The contents and structure of FYPO are described on the FYPO wiki) at GitHub and in the publication:
Harris MA, Lock A, Bähler J, Oliver SG, Wood V. FYPO: The Fission Yeast Phenotype Ontology. Bioinformatics. 2013 July 1;29(13): 1671–1678. PubMed abstract (PMID:23658422) or Full text at Bioinformatics
At present, FYPO is included collections such as the National Center for Biomedical Ontology’s BioPortal and EBI’s Ontology Lookup Service (OLS), both of which allow searching and browsing.
We hope to deploy a browser at PomBase in the not-too-distant future that will include annotations as well as terms.
FYPO terms are displayed on PomBase gene pages, along with supporting evidence and allele and expression details, as described in the PomBase gene page documentation.
The PomBase advanced search can use either term names or IDs to search FYPO, and returns a list of genes that have alleles annotated to the specified term or any of its descendants. For example, see the FAQ on finding essential genes.
The PomBase online curation tool, Canto, uses FYPO terms for annotation of S. pombe phenotypes. Phenotype curation documentation is available via Canto.
If you have a large set of phenotype data to submit, you may want to do a bulk submission. See the documentation on the recommended file format, and use the Phenotype Data Submission Form.
A “slim” is a high-level subset of terms from an ontology, used to analyze sets of annotated genes. The table below shows a slim set of grouping terms that we have selected from the Fission Yeast Phenotype Ontology (FYPO) and the number of annotations to each term. FYPO IDs link to PomBase ontology term pages. The annotation totals link to pages with information about the term and a list of annotated genes. A gene may be included in the annotation sets for more than one slim term.
If you could add one feature to the database immediately, or improve one feature immediately, what would it be?
How have the data and curation helped your research? Please provide specific examples and publications if possible. These examples will be helpful to secure future funding.
Do you work experimentally on any other organisms in addition to fission yeast for your area of research, and if so which? (list all, including fission yeast, in order of relative importance to your work/degree of use)
Please provide any additional comments and information about the current resource which you feel were not covered by this survey
This table summarizes the results of the pilot project that preceded the Fission Yeast Community Curation Project. The first phase of the project began in January 2009, and the second in November 2009. We thank all of the researchers who participated for making the pilot project a success.
| PMID | Laboratory | Submitter if different | GO terms | Interactions | Phenotypes | Other curation | Total | Date |
|---|---|---|---|---|---|---|---|---|
| PHASE 1 | ||||||||
| 19101542 | Peter Folk | Martin Převorovský | 19 | 0 | 15 | 3 | 37 | 2009-01-04 |
| 19098712 | Juan Mata | 3 | 7 | 0 | 1 | 11 | 2009-01-04 | |
| 19076239 | Paul Russell | 5 | 0 | 2 | 2 | 9 | 2009-01-04 | |
| 18675827 | Per Sunnerhagen | 2 | 1 | 3 | 0 | 6 | 2009-01-06 | |
| 17353264 | Chris Norbury | 2 | 0 | 0 | 0 | 2 | 2009-01-06 | |
| 19057642 | Luis Rokeach | 2009-01-04 | ||||||
| 19056896 | Fred Winston | Dom Helmlinger | 2009-01-04 | |||||
| 19041767 | Peter Espenshade | John Burg | 4 | 2 | 2 | 1 | 9 | 2009-01-04 |
| 18556659 | Kevin Hardwick | 16 | 16 | 2 | 0 | 34 | 2009-01-06 | |
| 18430926 | Charlie Hoffman | 4 | 0 | 2 | 0 | 6 | 2009-01-06 | |
| 17304215 | Hiroshi Iwasaki | 2 | 5 | 9 | 19 | 35 | 2009-01-06 | |
| 18426916 | Hiro Yamano | Michelle Tricky | 2 | 1 | 2 | 1 | 6 | 2009-01-06 |
| 19037101 | Nick Rhind | Nicholas Willis | 7 | 6 | 7 | 0 | 20 | 2009-01-06 |
| 19001497 | Ken Sawin | Lynda Groocock | 9 | 6 | 2 | 1 | 18 | 2009-01-06 |
| 18368917 | Steve Aves | 2009-01-06 | ||||||
| 18799626 | Takashi Toda | 2 | 3 | 3 | 0 | 8 | 2009-01-06 | |
| 19109429 | Stephen Kearsey | 9 | 2 | 2 | 0 | 13 | 2009-01-06 | |
| 17688408 | Susan Forsburg | 2009-01-06 | ||||||
| 17409062 | Iain Hagan | 2009-01-06 | ||||||
| 19139281 | Tony Carr | Edgar Hartsuiker | 2009-01-15 | |||||
| 18065650 | Per Sunnerhagen | 5 | 2 | 4 | 0 | 11 | - | |
| 18406331 | Kaz Shiozaki | 4 | 4 | 1 | 1 | 10 | 2009-01-15 | |
| 19139265 | Kathy Gould | Rachel Roberts | 8 | 11 | 1 | 1 | 21 | 2009-01-17 |
| 19197239 | Benoit Arcangioli | 2 | 0 | 4 | 0 | 6 | 2009-02-10 | |
| 19328067 | Rob Fisher | 5 | 4 | 2 | 25 | 36 | 2009-04-20 | |
| 19330768 | Katya Grishchuk | 2009-04-20 | ||||||
| 19217404 | Robin Allshire | 2009-04-20 | ||||||
| 19217403 | Paul Russell | Jessica Williams | 5 | 7 | 3 | 0 | 15 | 2009-04-20 |
| 19362535 | Janet Partridge | 2009-04-20 | ||||||
| 19250904 | Songtao Jia | Bahrat Reddy | 4 | 2 | 2 | 2 | 10 | 2009-03-01 |
| 19373772 | Jeremy Hyams | Isabelle Jourdain | 5 | 1 | 6 | 0 | 12 | 2009-04-20 |
| 19299465 | Sara Mole | 2009-04-20 | ||||||
| 19299465 | Julie Cooper | 2009-04-20 | ||||||
| 19286980 | Stevan Marcus | 2009-04-20 | ||||||
| 19033386 | Iain Hagan | 2009-04-20 | ||||||
| 19351719 | Luis Rokeach | Pascale Beauregard | 2 | 1 | 1 | 0 | 4 | 2009-04-20 |
| 19160458 | Ken Sawin | 2009-04-20 | ||||||
| 19211838 | Nick Rhind | Mary Porter-Goff | 2 | 2 | 8 | 0 | 12 | 2009-04-20 |
| 19273851 | Ramsay Macfarlane | 1 | 0 | 1 | 0 | 2 | 2009-04-20 | |
| 19243310 | Takashi Toda | 2 | 4 | 1 | 0 | 7 | 2009-04-20 | |
| 19158663 | Peter Espenshade | 2 | 1 | 1 | 0 | 4 | 2009-04-23 | |
| 19237545 | Henar Valdivieso | 1 | 1 | 3 | 0 | 5 | 2009-04-23 | |
| 18562692 | Jonathan Miller | 2009-04-23 | ||||||
| 16143612 | Charlie Hoffman | 0 | 8 | 0 | 0 | 8 | 2009-04-23 | |
| 15448137 | Wayne Wahls | 15 | 0 | 0 | 5 | 20 | NONE | |
| 18375981 | Wayne Wahls | 1 | 0 | 0 | 0 | 1 | NONE | |
| 9391101 | Wayne Wahls | 2 | 0 | 0 | 0 | 2 | NONE | |
| 7518718 | Wayne Wahls | 2 | 0 | 0 | 0 | 2 | NONE | |
| 7958849 | Wayne Wahls | 7 | 6 | 0 | 0 | 13 | NONE | |
| 19542312 | John Armstrong | James Dodgeson | 18 | 0 | 16 | 0 | 34 | NONE |
| PHASE 2 | ||||||||
| 19620282 | Simon Whitehall | 2009-11-23 | ||||||
| 19643199 | Jeramy Hyams | Isabelle Jourdain | 2009-11-23 | |||||
| 19436749 | Wayne Wahls | 2009-11-23 | ||||||
| 19627505 | Henar Valdivieso | 1 | 4 | 5 | 2009-11-23 | |||
| 19664060 | Stuart Macneill | 2009-11-23 | ||||||
| 19686603 | Stuart Macneill | 2009-11-23 | ||||||
| 19666000 | Murakami | 2009-11-23 | ||||||
| 19646873 | Fulvia Verde | 2009-11-23 | ||||||
| 19714215 | Jurg Bahler | 5 | 4 | 5 | 2 | 16 | 2009-11-23 | |
| 18923417 | Nick Boddy | 2009-11-23 | ||||||
| 18667531 | Nick Boddy | 2009-11-23 | ||||||
| 19686339 | Luis Rokeach | 2009-11-23 | ||||||
| 17114925 | Danesh Moazed | 2009-11-23 | ||||||
| 19707600 | Felicity Watts | 2009-11-23 | ||||||
| 19394293 | Danesh Moazed | 2009-11-23 | ||||||
| 18574244 | Peter Baumann | 2009-11-23 | ||||||
| 19520858 | Peter Espenshade | 9 | 1 | 10 | 2009-11-23 | |||
| 18503029 | Peter Espenshade | 1 | 1 | 2009-11-23 | ||||
| 19427212 | Anna Paoletti | 2009-11-23 | ||||||
| 18223116 | Simon Labbe | 2009-11-23 | ||||||
| 19915076 | Simon Labbe | 2009-11-23 | ||||||
| 19571115 | Shelly Sazer | 2009-11-23 | ||||||
| 18272791 | Rosa Aligue | 2009-11-23 | ||||||
| 19838064 | Jan Paluh | 3 | 29 | 9 | 4 | 55 | 2009-11-23 | |
| 19696784 | Takashi Toda | 2 | 3 | 2 | 7 | 2009-11-23 | ||
| 17409354 | Elena Hidalgo | 14 | 7 | 3 | 2 | 26 | 2009-11-24 | |
| 19416828 | Jacob Dalgaard | 2009-11-24 | ||||||
| 19473263 | Mathias Sipiczki | 2009-11-24 | ||||||
| 19836238 | Caroline Wilkinson | 2009-11-24 | ||||||
| 18252721 | Caroline Wilkinson | 2009-11-24 | ||||||
| 17986863 | Erik Boye | 2 | 0 | 3 | 0 | 5 | 2009-11-24 | |
| 20531409 | Juan Mata | 3 | 90 | 0 | 0 | 93 | N/A | |
| 19720063 | Nimisha Sharma | 2 | 3 | 3 | 2 | 10 | 2009-11-23 | |
| 19625445 | Jose Cansado | 2009-11-23 | ||||||
| 19486165 | Takayoshi Kuno | Yue Fang | 2 | 10 | 4 | 0 | 16 | 2009-11-23 |
| 19713940 | Kentaro Nakano | Masakatsu Takaine | 4 | 2 | 2 | 0 | 8 | 2009-11-24 |
| 19409973 | Kurt Runge | 2009-11-24 | ||||||
Comprehensive manual curation of the S. pombe literature is a primary goal of the PomBase project, and among the most important activities of the curation staff. Increasing numbers of new publications, and a large backlog of older papers, however, mean that complete literature curation will require input from the research community as well as the efforts of dedicated professional curators.
The PomBase Community Curation system enables researchers to contribute annotations directly to PomBase based on their publications using Canto, a web-based tool that allows both curators and researchers to create annotations. Canto supports GO, phenotype, interaction, and modification annotations, and can be configured for use with other ontologies as the need arises. Annotations made in the community curation system will be prioritized for inclusion in PomBase and will therefore also be more rapidly disseminated to other databases (e.g. GenBank/ENA/DDBJ, UniProtKB, BioGRID and GO), making data from annotated papers widely visible.
How to contribute: For newly published papers, PomBase curators email authors inviting them to participate, with specific instructions and links. Lab members are also welcome to evaluate existing annotations and create new annotations from past publications — use the PubMed ID search on the main PomBase Canto page. Anyone can also try the demo version of Canto.
Progress and attribution: Curation statistics track S. pombe papers curated in Canto by PomBase and community curators, and the annotations obtained. Canto will soon allow contributors to register ORCID identifiers in the system, which will support more formalised attribution of community contributions to PomBase, and thereby enable researchers to cite community curation in institutional reports, funding applications, etc. To supplement the existing permanent publication-centred links in Canto, we are currently investigating possible ways to link to external resources such as ORCID or OpenRIF via ORCID IDs.
Further reading: For an in-depth analysis of our approach, and the status of community curation as of early 2019, see our publication:
Lock A, Harris MA, Rutherford K, Hayles J, Wood V.
Community curation in PomBase: enabling fission yeast experts to provide detailed, standardized, sharable annotation from research publications. Database (Oxford) 2020 Jan 1;2020. pii: baaa028.
PMID:32353878 DOI:10.1093/database/baaa028
For a bit of historical perspective, you can browse the results of the Community Curation Pilot Project that took place in 2009.
1. How often do you use S. pombe GeneDB?
| Response Percent | Response Total | |
| Every day | 18.2% | 66 |
| A few times a week | 52.9% | 192 |
| A few times a month | 25.1% | 91 |
| On rare occasions | 3.9% | 14 |
| Total Respondents | 363 | |
| (skipped this question) | 0 | |
2. For what type of work do you use GeneDB?
| Response Percent | Response Total | |
| To access annotation, curation and analysis for my gene(s) of interest | 91.2% | 331 |
| To identify candidate genes in my field of interest | 74.7% | 271 |
| Bioinformatics research | 44.9% | 163 |
| Teaching | 8.3% | 30 |
| Other | 4.4% | 16 |
| Total Respondents | 363 | |
| (skipped this question) | 0 | |
3. Which GeneDB features and associated tools do you use?
| frequently | occasionally | rarely | never | I have not seen this feature | Response Total | |
| The Gene Page | 83% (301) | 14% (52) | 2% (7) | 0% (1) | 1% (2) | 363 |
| AmiGO Gene Ontology (GO) browser | 12% (43) | 31% (112) | 30% (109) | 19% (68) | 9% (31) | 363 |
| Blast Tools | 45% (165) | 33% (121) | 13% (46) | 8% (28) | 1% (3) | 363 |
| Boolean Query Tool | 5% (19) | 14% (50) | 23% (85) | 31% (114) | 26% (95) | 363 |
| List Download | 9% (31) | 26% (95) | 25% (89) | 25% (89) | 16% (59) | 363 |
| Expression links | 26% (96) | 34% (123) | 17% (62) | 12% (45) | 10% (37) | 363 |
| YOGY (Retrieval of eukaryotic orthologs) | 13% (48) | 26% (93) | 23% (83) | 18% (67) | 20% (72) | 363 |
| User defined 'Motif Search' | 14% (51) | 24% (87) | 27% (99) | 21% (75) | 14% (51) | 363 |
| Browsable Catalogues (products, curation, Pfam) | 18% (66) | 29% (104) | 26% (94) | 19% (69) | 8% (30) | 363 |
| Artemis (genome browser) | 23% (84) | 28% (102) | 25% (89) | 15% (53) | 10% (35) | 363 |
| GBrowse (genome browser) | 10% (36) | 26% (94) | 27% (98) | 23% (84) | 14% (51) | 363 |
| Gene Name Registry | 9% (33) | 22% (80) | 31% (114) | 28% (102) | 9% (34) | 363 |
| Cross-organism search page | 11% (39) | 35% (126) | 27% (99) | 15% (53) | 13% (46) | 363 |
| Total Respondents | 363 | |||||
| (skipped this question) | 0 | |||||
4. Which GeneDB features and associated tools do you use?
| very useful | useful | not very useful | not at all useful | I have not seen this feature | Response Total | |
| General information | 77% (279) | 22% (81) | 0% (1) | 0% (0) | 1% (2) | 363 |
| Location | 53% (191) | 40% (144) | 6% (20) | 1% (3) | 1% (5) | 363 |
| Context map | 43% (157) | 44% (158) | 8% (28) | 2% (6) | 4% (14) | 363 |
| Curation, and curated ortholog data | 46% (166) | 42% (153) | 6% (23) | 0% (1) | 6% (20) | 363 |
| Predicted peptide properties | 37% (136) | 46% (167) | 10% (35) | 1% (2) | 6% (23) | 363 |
| Gene Ontology annotation | 33% (118) | 47% (171) | 13% (48) | 2% (6) | 6% (20) | 363 |
| Published expression profiles | 52% (188) | 37% (135) | 6% (23) | 1% (3) | 4% (14) | 363 |
| Literature link | 48% (174) | 42% (153) | 8% (28) | 0% (1) | 2% (7) | 363 |
| Domain information | 48% (176) | 44% (158) | 5% (19) | 1% (2) | 2% (8) | 363 |
| Database cross-references | 39% (142) | 45% (163) | 11% (40) | 0% (0) | 5% (18) | 363 |
| UniProt annotation for this protein | 27% (99) | 51% (186) | 12% (42) | 1% (4) | 9% (32) | 363 |
| Total Respondents | 363 | |||||
| (skipped this question) | 0 | |||||
5. Which other internet resources do you use for your work? (select all which apply)
| Response Percent | Response Total | |
| PubMed | 99.2% | 360 |
| Gene Ontology (GO) Website | 25.3% | 92 |
| UniProt | 24.2% | 88 |
| Pfam | 49% | 178 |
| Interpro | 15.2% | 55 |
| Saccharomyces Database (SGD) | 67.5% | 245 |
| Comprehensive Yeast Genome Database (CYGD) | 17.1% | 62 |
| PombePD | 41.9% | 152 |
| NCBI (Entrez) | 90.4% | 328 |
| 86% | 312 | |
| GRID | 12.9% | 47 |
| Other (please specify) | 16.3% | 59 |
| Total Respondents | 363 | |
| (skipped this question) | 0 | |
6. Which of these new types of information would you most like to see in the S. pombe database? Rank your results in order of preference from '1' MOST desirable to '8' LEAST desirable (each value can only be selected once)
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | Response Average | |
| Transcriptional start/stop | 17% (60) | 14% (50) | 9% (32) | 14% (49) | 13% (44) | 12% (42) | 11% (37) | 10% (34) | 4.18 |
| Regulatory motifs | 8% (26) | 22% (77) | 18% (61) | 16% (56) | 14% (49) | 12% (41) | 8% (27) | 2% (7) | 3.85 |
| Phenotypes | 52% (182) | 13% (47) | 16% (55) | 8% (27) | 4% (13) | 4% (15) | 2% (7) | 1% (3) | 2.23 |
| Signalling pathway data | 6% (20) | 8% (26) | 13% (46) | 17% (57) | 13% (46) | 18% (60) | 15% (53) | 10% (34) | 4.89 |
| Sequence/feature variation in related strains | 3% (9) | 5% (16) | 5% (18) | 11% (39) | 14% (49) | 13% (45) | 24% (83) | 25% (87) | 5.90 |
| Full text literature searching | 5% (16) | 8% (27) | 6% (22) | 7% (25) | 13% (44) | 16% (55) | 17% (58) | 29% (101) | 5.75 |
| Protein modifications | 7% (24) | 17% (60) | 18% (62) | 15% (51) | 15% (53) | 13% (46) | 11% (37) | 5% (17) | 4.20 |
| Microarray datasets | 6% (20) | 14% (50) | 16% (58) | 13% (46) | 14% (50) | 11% (40) | 11% (39) | 15% (52) | 4.67 |
| Total Respondents | 361 | ||||||||
| (skipped this question) | 2 | ||||||||
7. How accurate, in general, do you consider the S. pombe curation and S. pombe GO curation?
| Response Percent | Response Total | |
| highly accurate | 26.1% | 95 |
| mostly accurate | 61.8% | 225 |
| badly inaccurate | 0% | 0 |
| cannot assess | 12.1% | 44 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
8. How accurate, in general, do you consider the S. pombe gene models?
| Response Percent | Response Total | |
| highly accurate | 19.2% | 70 |
| mostly accurate | 60.4% | 220 |
| badly inaccurate | 0.8% | 3 |
| cannot assess | 19.5% | 71 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
9. Have you ever contacted GeneDB, and if so, what was the reason? (select all which apply)
| Response Percent | Response Total | |
| Report an error | 35.6% | 47 |
| Reserve a gene name | 45.5% | 60 |
| Ask a question | 50.8% | 67 |
| Make a suggestion | 21.2% | 28 |
| Submit data/curation | 29.5% | 39 |
| Total Respondents | 132 | |
| (skipped this question) | 231 | |
10. If you answered question 9, in general how satisfied were you with the response(s)?
| Response Percent | Response Total | |
| very satisfied | 90.4% | 122 |
| somewhat satisfied | 6.7% | 9 |
| somewhat unsatisfied | 3% | 4 |
| very unsatisfied | 0% | 0 |
| Total Respondents | 135 | |
| (skipped this question) | 228 | |
11. How easy is it to find the information you require in S. pombe GeneDB?
| Response Percent | Response Total | |
| very easy | 32% | 116 |
| relatively easy | 55.1% | 200 |
| sometimes confusing | 11.6% | 42 |
| difficult | 0.3% | 1 |
| no opinion | 1.1% | 4 |
| Total Respondents | 363 | |
| (skipped this question) | 0 | |
12. At what kind of institution do you work?
| Response Percent | Response Total | |
| University | 63.6% | 231 |
| Research Institute | 33.9% | 123 |
| Company | 0% | 0 |
| Government | 2.5% | 9 |
| Other | 0% | 0 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
13. What is your position?
| Response Percent | Response Total | |
| Student | 32% | 116 |
| Post Doctoral Fellow | 25.3% | 92 |
| Database Curator | 1.4% | 5 |
| Research Investigator | 8.8% | 32 |
| Principal Investigator | 29.5% | 107 |
| Other | 3% | 11 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
14. What kind of computer operating system do you primarily use to access GeneDB?
| Response Percent | Response Total | |
| PC/Windows | 49.3% | 179 |
| Mac | 47.1% | 171 |
| Linux/UNIX | 3.6% | 13 |
| Other | 0% | 0 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
15. Which Internet browser do you prefer?
| Response Percent | Response Total | |
| Internet Explorer | 41% | 149 |
| Netscape | 5% | 18 |
| Mozilla/Firefox | 27.5% | 100 |
| Safari | 25.6% | 93 |
| Other | 0.8% | 3 |
| Total Respondents | 364 | |
| (skipped this question) | 0 | |
16. If you could add one feature to the database immediately, or improve one feature immediately, what would it be?
Total Respondents: 135
(skipped this question) 228
17. How have the data and curation helped your research? Please provide specific examples and publications if possible. These examples will be helpful to secure future funding.
Total Respondents: 144
(skipped this question) 219
18. Do you work experimentally on any other organisms in addition to fission yeast for your area of research, and if so which? (list all, including fission yeast, in order of relative importance to your work/degree of use)
Total Respondents: 157
(skipped this question) 206
19. Please provide any additional comments and information about the current resource which you feel were not covered by this survey
Total Respondents: 58
(skipped this question) 305
Note that some of the links below go to pages listing subdirectories that are organised slightly differently from the links on this page. Your browser may prompt you to open or download files.
If you have trouble finding anything, please ask the helpdesk.
Main directory for S. pombe data
| Annotation type | Description |
|---|---|
| Protein datasets | Protein sequence FASTA database, peptide features, properties, etc. |
| GO annotations | Gene Ontology annotation files |
| Macromolecular complexes | Subunits of protein and ribonucleoprotein complexes (GO cellular component terms and annotated genes) |
| Phenotype annotations | FYPO phenotype annotation files - complete annotation set (PHAF) or viability summary |
| HCPIN datasets | Physical interaction and GO substrate data that make up the High Confidence Physical Interaction Network datasets; also see documentation |
| Modifications | Protein modification data file (RNA modifications to be added in future) |
| Orthologs | Manually curated ortholog sets for human and S. cerevisiae; also see documentation |
Mappings between PomBase systematic IDs, gene names, product descriptions, and UniProt accession numbers
Current GO slim IDs and term names:
Current fission yeast Mondo Disease Ontology slim IDs and term names
Note: S. pombe files are no longer available from the old “pombase” FTP site within the EBI domain. If you have a link that contains ftp.ebi.ac.uk, please check these pages for a link using https://www.pombase.org/. Please contact the PomBase curators if you need help finding a file or directory.
Originally sent by Val Wood to pombelist Sat Apr 23 16:00:37 BST 2011
The changes reported in PMID:21511999 are visible in GeneDB.
Gene Structure Changes
We have imported 306 of the gene structure changes. Some reported
changes were rejected because :
i) The change was already incorporated
ii) The gene is known to be frame-shifted (the correct, albeit gene
structure is currently represented) the confirmed frame-shifts will be
fixed in the next round of sequence changes.
iii) A different start site was reported, but homology or experimental
evidence supports the existing coding sequence start site (if this was
inconclusive I used the Broad start site)
iv) The existing structure was already experimentally supported (in
these cases alternative transcript features will be created once we move
to the new PomBase)
Most of the changes are small, alterations to gene structures and
include mainly:
i) Additional in-frame introns
ii) Use of an alternative starting methionine
iii) Use of an alternative, but proximal acceptor (in these cases it
is possible that both variants occur, but we have used the new
experimentally supported one)
iv) A couple of genes were “un-merged” and one merged.
A small number of changes were larger, and involved additional N or C
terminal exons, and occasionally gross changes to coding sequence.
As there are a large number of changes it is possible that your gene(s)
of interest could be affected.
All of the updated genes are annotated with:
“warning, gene structure updated”PMID:xxxxxxxx” (this will change to
PMID:21511999 when GeneDB is next updated)
in the “controlled curation” section of the gene page
New Genes
New gene structures have been created for the new genes reported
All new genes identified in this analysis are annotated with:
“warning, new gene PMID:xxxxxxxx” (this will change to PMID:21511999
when GeneDB is next updated)
in the “controlled curation” section of the gene page
ncRNAs
All non coding RNAs were imported.
Some are clearly coincident with existing predicted RNAs (However, some
of the previously annotated RNA’s may appear on the incorrect strand as
they were derived from Affymetrix data),
Over time, these will be assessed and merged where appropriate.
UTRs
The UTRs derived from the Broad data have been used for the consensus
UTR set, the precedence for the current annotated consensus set is now :
Individual published sources> PMID:21511999 >PMID:20118936
We hope to make the entire datasets available in the new PomBase.
If you have any questions, please direct them to the new helpdesk,
helpdesk at pombase.ac.uk, or send your query directly using the curator
feedback on the GeneDB web page.
The PomBase genome browser can be accessed in multiple ways:
Tracks for annotated sequence features — genes, repeats, etc. — on the forward and reverse strands are displayed by default.
To show the track containing the reference DNA sequence, use the “Genome sequence and features” filter and enable the “DNA sequence” track as described below.
See this FAQ to display a sequence region using coordinates.
To download sequence, see the “Exporting data” section below (it works the same way as for any other track).
To show data tracks:
Click on the “Select tracks” button in the top left corner.
Locate the track(s) of interest (see below), and then click the tickbox for any individual track to toggle it on/off, or use the tickbox in the header to enable/disable all of the listed tracks at once.
Click the “Back to browser” button at the top.
The tracks should now be displayed. For example, the sequence feature and DNA sequence tracks look like this:
To hide a track, click the (X) button to the left of the track label, or go to the “Select tracks” page and clear its tickbox.
Drag and drop tracks to change the order in which they appear.
By default, the scale fits the range of the data being displayed in the current viewing window. The scale can be manually defined.
Click the downarrow to the right of the track label, and click on edit config:
Change the scale by defining a max_score and/or a min score:
The scale can be made consistent across tracks:
jbrowse_rescaled.png
More wiggle track configuration option in the official JBrowse documentation
Each entry in the left-hand column can be used to filter the track list. Filter criteria fall into several categories, corresponding to some of the track metadata (see below):
As you select filters, the screen will update to show only relevant criteria on the left, and matching tracks on the right.
You can also search for names, keywords, etc. using the “Contains text” box.
Any applied filters, including text, can be cleared by clicking the red X button that appears next to a selected filter (in the search box or the left-hand column), or by using the “Clear All Filters” button.
For a list of recently enabled tracks, click “Recently Used”.
Information about each track is captured as part of the curation process. Metadata includes:
The metadata can be viewed in two ways:
In the track selector, tracks are listed with associated metadata on the right hand side:
In the browser, hover over a track label to display a down arrow:
Click the arrow, then click “About this track” in the dropdown menu:
The metadata and stats are displayed:
To dismiss the popup, click the ‘X’ in the upper right corner or the ‘OK’ button at the bottom.
There are several ways to navigate the genome.
Use the box at the top that displays the chromosomal coordinates to navigate to a specified location: 
In the coordinates box,
In the uppermost bar, a red box indicates the size and position of the currently displayed region, in the context of the whole chromosome. Click in the bar or drag the red box to change position.
Use the arrows next to the bar with the box for chromosomal coordinates to move right or left in increments.
Drag or swipe (depending on device) in the main browser window to scroll.
To zoom:
Use the + and - buttons, or
In the main browser window, double-click to zoom in, and shift-double-click to zoom out, or
Use the narrow bar below the chromosomal coordinates:
Click and drag to highlight a region, then click within the highlighted region to zoom so the region fills the browser window:
To see the DNA sequence, zoom in until it appears, first as color-coded blocks, and then labeled with letters.
More S. pombe-specific information can be found in the Genome browser FAQ list.
To export the data for any track, hover over the track label to display a down arrow:
Click the arrow, then click “Save track data” in the dropdown menu:
In the popup, choose a data format. DNA sequence is provided in FASTA format. GFF3 is available for most tracks; other options depend on the data type. You can also edit the name of the file where the data will be saved.
Click ‘View’ to see how the data will appear in the saved file. To download the data file click ‘Save’ (available in the original popup or the ‘View’ panel). To dismiss the popup withous saving, click the ‘X’ in the upper right corner or the ‘Close’ button at the bottom.
Originally sent by Val Wood to pombelist Fri Feb 4 12:08:34 GMT 2011
A set of genome wide transcription start and termination sites manually
annotated by Lantermann et. al in PMID: 20118936, based on
transcriptome data from Dutrow et. al. PMID: 18641648 have been used to
create 5’ and 3’UTR features for the reference genome, for genes with no
previously annotated transcript from another source.
This increases the number of manually annotated UTRs from
298 to 3605 for 5’
778 to 3693 for 3’
Because it appears that transcription start and end can be fuzzy,
these features should be considered as an “indicator” of the likely
extent of transcription. We will continue to revise the reference
transcript set as updates are reported, to represent the longest
discrete transcript for a region as the consensus.
Data Access
You can access the transcription start and end from individual GeneDB
gene pages for genes of interest using the sequence viewers GBrowse or
Artemis. The links to these 2 browsers are to the right and left of the
“context map” on the “Location” section of the gene page.
(Artemis tips: Use the “Artemis applet” option selected; If you are
interested in a specific gene, reduce the upstream and downstream range
of to 1000 before clicking “submit”; the page will take a few seconds
to render the first time in a session)
You can download this data as part of the complete annotation in the “rich EMBL files” from here: ftp://ftp.sanger.ac.uk/pub/yeast/pombe/Chromosome_contigs/ (the files chromosome*.contig) and view them in Artemis on your desktop (see the Artemis FAQ and the Artemis manual (pdf; Sanger site) for additional information).
Hosting Further Transcriptome Datasets
Clearly, as more transcriptome data becomes available the community will
require access to the different datasets, in addition to the consensus
transcripts. We intend to provide this in the future through the new
PomBase using the Ensembl viewer.
Note: This documentation is still a work in progress. Please contact the helpdesk if you have any questions.
The PomBase advanced search allows you to construct complex queries for S. pombe genes. At present all advanced search results are lists of genes that match the query specifications. Hints for specific searches are available in the PomBase FAQ, and linked below (scroll down to Search tips).
In the Search menu, choose Advanced (or bookmark https://www.pombase.org/query).
In the Query panel (top), click one of the links in the list on the left to choose a query type (described below). Arrowheads indicate list entries that expand to offer two or more query types, organized in tabs. For each query, the interface guides your input.
In the History panel (bottom), queries are listed in reverse chronological order (most recently run first). Results are linked in the Count column; the link goes to a page that displays the gene name, systematic ID, and product description for matching genes. The Download button offers additional options, including nucleotide and (where applicable) protein sequence. To return to the search page, use the blue “<- Advanced search” button just above the result list, not your browser’s “Back” button.
You can select queries in the list to combine or delete them. To combine queries, you must select two or more from the list, and then click one of the operator buttons:
Results are added to the history list:
Queries using the NOT operator default place the more recently run query first (newer NOT/Subtract older):
Click “Change direction” to switch the order. Click “Submit” to run the query.
You can also move any query to the top of the history list by clicking its “Results” link, and then clicking the “<- Advanced search” button.
Query results can remain available in the history list for several days. If changes in annotation cause results to change since a query was last run, an additional “Previous” column will be displayed in the history list, showing the out-of-date result count:
Click on the “Results” link to re-run the query and retrieve the up-to-date result.
If the parameters for a query are not all visible in the history, a “[details]” toggle (1) to show or hide additional details will appear. You can also edit the name that appears in the history list (2). The name will be used as part of the description when the query is used in any combined query (which can, in turn, be given a new name).
Clicking on any up-to-date count in the “Results” column goes to a page that shows the count, query details, and a list of matching genes.
Return to the main Advanced search page (you can also use the browser “back” button)
Click on a header to sort by the column
Select columns to display. A set of gene expression data sets are hidden by default; click “Show gene expression columns” to reveal the additional options.
Select from the pulldown to send the gene list to QuiLT for visualisation, or, for lists of up to 150 genes, see the genes highlighted in violin plots of quantitative expression datasets. (At present data from Marguerat S et al. (2012) and Carpy A et al. (2014) are included.)
Show GO slim annotations for genes in the list. Click “Slim with” to reveal a dropdown, and choose a slim. Note: when you return to the main Advanced search page, the query history will include an entry showing the query as a gene list. This is harmless.
Narrow the list: click the button to reveal checkboxes. Available for lists of up to 1000 genes.
Download selected data for genes in the list. The popup offers three sets of options:
Each results page has a stable, unique URL that you can bookmark, copy/paste, and share. Anyone who follows a shared link will see the same results page, and the query will be added to their query history.
The “Visualise” and “Slim” options also generate stable, unique, sharable URLs.
Ontology queries (GO, phenotype, protein modification, and protein sequence feature) retrieve genes that are annotated to the selected term(s), and to their descendants via specified relations (see the GO documentation on Ontology Structure and Ontology Relations for more information on relationships between terms in ontologies, and see the descriptions below of specific ontology filters for lists of which relations are followed to retrieve annotations). Ontologies can be searched by ID or term name. Type or paste a complete ontology ID, including the prefix (e.g. GO:0005634, FYPO:0002059), or simply start typing to search for a term name. Choose a term from the list of options offered by the autocomplete, and click “Submit”.
Note: Only terms that are used in annotations (direct or inferred by transitivity) will appear as autocomplete suggestions. This is to avoid having irrelevant terms, such as “chloroplast” or “echolocation” appearing. Any term without annotations can be found by searching by its ID, and will appear in the query history with “0” results.
This item offers convenient links to perform frequently used queries easily. Click on the query description to add the results to the query history.
Please contact the helpdesk if you would like any queries added to the selection.
Type or paste a list of gene names or systematic IDs (or a mixture), or click the “Browse” button to select a file to upload. Click “Lookup” to add the gene list to the history (useful for combining the list with other queries).
Links to the Identifier Mapper.
The Gene Ontology (GO) query retrieves gene products annotated to a GO term and to any of its child terms, following the is_a, part_of, regulates, positively_regulates,and negatively_regulates relationships in the ontology. You may also find it helpful to search or browse in QuickGO or AmiGO to find GO terms of interest. If one search does not seem to retrieve as many results as you expect, try again using a less specific term. Note: prior to the November 2014 PomBase release, the regulates relations were not followed, and PomBase GO search results therefore did not match those in AmiGO.
The phenotype (Fission Yeast Phenotype Ontology) query retrieves genes annotated to a FYPO term and to any of its child terms, following the is_a, part_of, output_of, has_output, and has_part relationships in the ontology. This query also offers additional context-dependent options. By default, the phenotype search retrieves genes from single-allele haploid and diploid genotypes annotated to the searched FYPO term:
You can alter the selected options to add genes from multi-allele genotypes, and/or to search specifically for haploids or diploids. See the gene page phenotype documentation and the genotype page documentation for more information.
If you select single-locus haploids, expression level options are also available:
Different alleles of one gene may have different phenotypes, and one allele may give rise to different phenotypes under different experimental conditions. At present, you can retrieve annotations for all alleles of a gene, or use the “Expression level” options restrict the query to null alleles (covers deletions and any other sequence changes, such as most disruptions, that completely abolish expression of the gene) or overexpression of the wild type allele.
The “Constrain condition” option restricts the results to include only genes that have phenotype annotations including the specified condition. The search uses the same condition descriptors as Canto and the PomBase web pages. Start typing, then choose from the autocomplete options.
Note that the results will include any gene that has phenotype annotations including the specified condition for any allele. Queries that include conditions can be combined using the AND, NOT, or OR operators like any other, but the result of any combination of phenotype queries will likely include annotations for different alleles. There may not be any individual annotation in which both/all of multiple conditions co-occur.
The search does not yet support querying for multiple conditions on the same annotation, nor for queries that exclude a given condition; both are planned for future development.
Search the Monarch Disease Ontology to find S. pombe genes whose human orthologs have been implicated in disease. Start typing ‘disease’ or the name of a specific disease, and choose from the autocomplete options. To retrieve all disease-associated genes, type or paste “MONDO:0000001”.
Choose a gene product type (e.g. protein coding, tRNA, etc.) from the pulldown menu.
Search for terms or IDs in the PSI-MOD ontology.
Queries for proteins that have a specified domain, sequence feature, or structural feature
Search for a protein domain using an ID from Pfam, PRINTs, PROFILE, ProSite, or InterPro. Type or paste an accession and click “Submit”.
This query searches for terms or IDs in the Sequence Ontology and retrieves protein-coding genes where the protein has the feature represented by the SO term (e.g. KEN box SO:0001807).
Find protein-coding genes with products that have a specified number of transmembrane domains. Use the appropriate button for any TM domains or none, or enter the desired minimum and maximum number and click “Search”.
Find protein-coding genes with products that have a specified number of coiled-coil regions. Use the appropriate button for any coiled-coil regions or none, or enter the desired minimum and maximum number and click “Search”.
Find protein-coding genes with products that have a specified number of disordered regions. Use the appropriate button for any disordered regions or none, or enter the desired minimum and maximum number and click “Search”.
Find protein-coding genes with products that have a specified number of low-complexity regions. Use the appropriate button for any low-complexity regions or none, or enter the desired minimum and maximum number and click “Search”.
Physical properties of protein gene products:
Find protein-coding genes with products in a specified length range. Enter the desired minimum and maximum length and click “Search”.
Find protein-coding genes with products in a specified mass range. Enter the desired minimum and maximum mass in kiloDaltons (kDa) and click “Search”.
Find genes in a specified region of a chromosome. Select a chromosome from the pulldown, and click “Search” to retrieve all genes on the chromosome. Or click the radio button to switch to “Genes overlapping range”, and enter start and end coordinates in the boxes to retrieve only genes in the specified region. Note that genes that partly overlap the entered coordinates will be included.
Find genes with a specified number of coding exons in the primary transcript (note: at present this query does not consider any annotated alternative transcripts). Enter the desired minimum and maximum number and click “Search”.
Find genes with a specified number of annotated transcript isoforms; Enter the desired minimum and maximum number and click “Search”. (Note: alternative transcripts are only explicitly annotated if functional differences between isoforms are identified- see the browser datasets for the full extent of known transcript variation)
Choose one of the descriptions from the pulldown menu. See the gene page documentation for more information.
Choose a species from the pulldown menu to retrieve all S. pombe genes with a curated ortholog in the selected species.
Choose one of the descriptions from the pulldown menu. See the gene characterisation page for more information.
FAQ entries relevant to using the advanced search are organised here by topic. Several of the topics also correspond to gene page sections.
Annotation extensions are used to provide additional specificity for annotations to GO, FYPO, and protein modification annotations. Each extension consists of a relation and another “entity”, which may be a gene in PomBase or another database, or another ontology term. (The GO Consortium wiki page on annotation extensions contains useful information on relations.) Because some relations have unwieldy names, the PomBase gene page display substitutes more readable text.
This table shows the underlying relation name and corresponding display text for the affected relations, and the reciprocal relation displayed in “Target of” annotations (derived from extension data):
| Relation name | Display name | Reciprocal |
|---|---|---|
| activated_by | activated by | N/A |
| coincident_with | at | N/A |
| during | during | N/A |
| exists_during | during | N/A |
| happens_during | during | N/A |
| has_regulation_target | regulates | regulated by |
| in_absence_of | in absence of | N/A |
| in_presence_of | in presence of | N/A |
| inhibited_by | inhibited by | N/A |
| not_exists_during | except during | N/A |
| not_happens_during | except during | N/A |
| occurs_at | at | N/A |
| occurs_in | in | N/A |
| required_for | required for | N/A |
For some relations, the best display string depends on term and its ancestry, as indicated in these tables:
The display for FYPO extensions indicating genes used in assays depends on whether the phenotype is normal or abnormal:
| Relation name | If descendant of | Display name | Reciprocal |
|---|---|---|---|
| assayed_using | FYPO:0001985 abnormal phenotype | affecting | affected by mutation in |
| assayed_enzyme | FYPO:0001985 abnormal phenotype | affecting activity of | activity affected by mutation in |
| assayed_substrate | FYPO:0001985 abnormal phenotype | affecting substrate | affected by mutation in |
| assayed_using | FYPO:0000257 normal phenotype | affecting | N/A (normal means no effect to report in “Target of” section) |
| assayed_enzyme | FYPO:0000257 normal phenotype | affecting activity of | N/A (normal means no effect to report in “Target of” section) |
| assayed_substrate | FYPO:0000257 normal phenotype | affecting substrate | N/A (normal means no effect to report in “Target of” section) |
GO annotation extensions display for part_of:
| If descendant of | Display name | Reciprocal |
|---|---|---|
| GO:0003674 molecular_function | involved in | N/A |
| GO:0008150 biological process | part of | N/A |
The display for the “input” relations (has_input or has_direct_input) follows this pattern:
| If descendant of | Display name | Reciprocal |
|---|---|---|
| GO:0003824 catalytic activity | has substrate | substrate of |
| GO:0006810 transport | transports | transported by |
| GO:0005215 transporter activity | transports | transported by |
| GO:0000976 transcription regulatory region sequence-specific DNA binding | regulates transcription of | transcription regulated by |
| GO:0001216 DNA-binding transcription activator activity | activates transcription of | transcription activated by |
| GO:0001217 DNA-binding transcription repressor activity | represses transcription of | transcription repressed by |
| GO:0003713 transcription coactivator activity | activates transcription of | transcription activated by |
| GO:0003714 transcription corepressor activity | represses transcription of | transcription repressed by |
| GO:0030234 enzyme regulator activity | regulates | regulated by |
| GO:0008047 enzyme activator activity | positively regulates | positively regulated by |
| GO:0004857 enzyme inhibitor activity | negatively regulates | negatively regulated by |
| GO:0051179 localization | localizes | localized by |
| GO:0005488 binding | binds | binds |
| (anything not listed above) | has input | input for |
PomBase displays also use human-friendly names for Protein Ontology (PRO) terms used in extensions (inculding “active form”). The display names include modification positions denoted with these abbreviations:
| Abbreviation | Meaning |
|---|---|
| Ac | acetylated |
| Clv | cleaved (residue specification optional) |
| DiUbiq | diubiquitinated |
| GDP+ | GDP-bound |
| GTP+ | GTP-bound |
| HyperOx | hyperoxidized |
| InitMet- | initiator methionine removed |
| Ip | prenylated |
| Me | methylated |
| Me2 | dimethylated |
| Me3 | trimethylated |
| MonoUbiq | monoubiquitinated |
| Ox+ | oxidized form |
| Phos | phosphorylated (specified residue) |
| PhosRes+ | phosphorylated (unspecified residue) |
| PhosRes- | unphosphorylated (unspecified residue) |
| PolyUbiq | polyubiquitinated |
| Red+ | reduced form |
| Sumo | sumoylated |
| Ubiq | ubiquitinated (residue specification optional) |
| UnMod | unmodified (residue specification optional) |
| UnPhos | unphosphorylated (residue specification optional) |
| UnUbiq | unubiquitinated |
Gene and publication pages include manually curated annotations of several types that cannot be represented using available ontologies.
For each annotation, the summary view shows a text description, which corresponds to an entry in the internal PB term set. The detailed view adds the PBO ID, evidence (if available), reference, and count. The count links to the ontology term page for the description.
Links in the left-hand navigation menu include:
Complementation - Indicates that an S. pombe gene complements, or is complemented by, a gene from another species
Miscellaneous
Subunit composition - Brief description of homo- or heteromeric complex(es) in which the gene product is found
Warnings - Alerts to changes or anomalies that can affect interpretation of experimental results, such as changes to the sequence or feature annotation
In the Miscellaneous category, annotations fall under one of these sub-headings:
Catalytic activity attributes: Features of a gene product’s catalytic activity, such as KM, kcat, substrate specificity
Experimental tools: Indicates that the gene or its product is used as an experimental tool (e.g. reporter gene construct, selectable marker, antibody)
Genome organization: Attributes of the genomic region around the gene, e.g. duplications, repeats, alternative transcripts
Miscellaneous functional group: Function-related descriptions that are not covered by GO molecular function or biological process annotations
Comment: Experimental observations and other notes that do not fit into ontologies or any of the above controlled curation categories; truly miscellaneous but interesting information
PomBase welcomes submissions of published HTP sequence-linked data, suitable for viewing in a genome browser. We require JBrowse compliant data files and associated metadata descriptions. Please see the FAQ on file formats for links to the file format descriptions, and other entries in the data submission FAQ category for more information.
All features in data files need to use these chromosome IDs:
We have devised a file format for the metadata we need, with downloadable spreadsheet templates available in Excel and Open Document Format (links may download files, depending on your browser). Letters in the table below refer to spreadsheet columns.
If you prefer, you can prepare a file without using the template. Create a tab-delimited text file, and include a header line that labels the columns, using the entry in the Contents column below as the column header text.
| Column | Contents | Example | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 (A) | Data type | Transcripts, Chromatin binding, Nucleosome positioning, Poly(A) sites, Replication origins | Yes | No |
| 2 (B) | Track label | see below for format and examples*** | Yes | No |
| 3 (C) | Assayed gene product | Fkh2 | Only required for chromatin binding data, to specify the protein binding to chromatin | No |
| 4 (D) | Strain background | h- cdc25-22, leu1-1 | Yes | Yes |
| 5 (E) | WT or mutant (strains with only background mutations are considered WT) | WT | Yes | No |
| 6 (F) | Mutant alleles | clr4delta, dfp1-3A | No | Yes |
| 7 (G) | Conditions | YES, high temperature; glucose MM, standard temperature + HU | No | No |
| 8 (H) | Comment | free-text field for additional information | No | Yes |
| 9 (I) | Growth phase or response | vegetative growth, meiosis, quiescence, glucose starvation, oxidative stress, heat shock | Yes | Yes if the track combines data |
| 10 (J) | Strand | forward, reverse | No | No |
| 11 (K) | Assay type | tiling microarray, RNA-seq, HT sequencing | Yes | No |
| 12 (L) | First author (surname) | Soriano | Yes | No |
| 13 (M) | Publication year | 2020 | Yes | No |
| 14 (N) | PubMed ID | 31077324 | Yes | No |
| 15 (O) | Database | GEO, ArrayExpress | Required for data available in public repository databases | No |
| 16 (P) | Study ID | GSE110976, PRJEB7403 | Required if the Database column has an entry | No |
| 17 (Q) | Sample ID | GSM3019628, ERS555567 | No | Yes |
| 18 (R) | Data file type | bigwig, bed | Yes | No |
| 19 (S) | File name | name given to submitted data file relevant to the track | Yes | No |
The track label must uniquely describe each track. For consistency in track label descriptions, please follow the recommended format as closely as possible:
“Assayed gene product” “Data type” “in mutant” “during Growth phase or response” “additional experimental detail of importance (Conditions, Strain background)” “; repeat” “(strand)” “- First author (Publication year)”
Examples:
To submit the files, or if you have any questions, please contact the PomBase curators.
The Disease association section lists disease descriptions from the Monarch Initiative’s Mondo Disease Ontology (Mondo) for fission yeast orthologs of human disease-causing genes.
The summary view shows slim terms (see below) and the names of the most specific terms used to annotate the gene.
The detailed view shows more information for each annotation, and may display additional terms:
Mondo slim terms applicable to the gene.
The Mondo term ID and name, which link to a page with additional information, including the term definition, any synonyms, relationships to other Mondo terms, and annotations to the term or its descendants.
Indicates whether the annotation was created by PomBase curators or obtained from an external source (usually Malacards
The paper from which the annotation comes.
The number of genes annotated to the term, linked to an ontology term page as described above.
At the top of each gene page is a set of basic information about the gene:
The External references section of a gene page provides links to information on a gene or its product in each of several external databases. For each database, a category, the name and a brief description are shown, and the identifier used by the database is displayed and linked.
The resources linked in this section cover a wide range of databases and data types. Because all are external, PomBase staff cannot provide assistance with any of the resources other than problems with the actual links.
The Gene expression section of a gene page displays curated qualitative and quantitative information about the level and timing of the gene’s expression. In each subsection, a simple summary appears by default:
Click “Show details” to reveal additional information:
Important: Note that the condition descriptions are rather broad, and therefore do not necessarily capture all details of every aspect that may affect gene expression. We are also unable to capture strain details at present. We therefore recommend consulting the papers cited for the data before comparing or combining data from different publications.
Several of the External References also link to gene expression data.
PomBase uses the Gene Ontology (GO) to describe the biological context of genes.
GO consists of three distinct ontologies (or sets of vocabularies) that describe a gene’s:
A gene product may be annotated to several GO terms from each of the three ontologies; mcm3, for instance, is annotated to single-stranded DNA helicase activity, ATP binding, and DNA replication origin binding (MFs), it acts in mitotic DNA replication initiation and negatively regulates the MCM helicase activity (BPs), and is found locations including the replication fork and the pre-replicative complex (CC).
Each table includes ontology term details and supporting data. The GO annotation display on PomBase gene pages includes ontology term details and supporting data. The summary view shows just the essentials: The list of terms is filtered, using the ontology structure, so that it shows only the most specific terms used to annotate a genotype, and each unique combination of gene, GO term, and extension(s) is shown once:
The detailed view shows annotations to all GO terms, and includes more details for each annotation. It shows separate entries for repeat determinations of a given gene/term/extension combination (if supported by more than one line of evidence and/or reported in more than one paper), and annotations to terms hidden in the summary view:
The unique ID and name for a GO term, linked to an ontology term page as described above.
An abbreviation (code) for the type of (see “Evidence codes” below) that supports the annotation. The evidence categories come from the set of evidence codes defined by the GO Consortium.
An additional ontology term or identifier that provides supporting details for annotations using certain evidence codes (see below and GO documentation).
An optional qualifier that modifies the connection between the gene product and the GO term. Entries come from the set of allowed qualifiers described in GO’s annotation overview or internal PomBase usage.
The paper from which the annotation comes.
The number of genes annotated to the term, linked to an ontology term page as described above.
GO Slim terms applicable to the gene.
GO annotations may have extensions(see “Annotation extensions” below) to capture any of several types of additional detail. S. pombe genes link to PomBase gene pages. Protein Ontology (PRO) terms, which identify specific processed or modified forms of a protein, can be used in extensions or to indicate which form is active; both are displayed here.
Annotations are made to the definition of a term, not the term name itself, so we recommend that users always read the term definition. The definition is critical because an ontology term name may change over time, but if the meaning of a definition changes the term must be obsoleted, and the associated genes must be reannotated to the correct definition. This procedure makes ontologies very robust to changes in biological knowledge, because if the definition is constant terms can be repositioned in the ontology (i.e. parents terms can be added or removed) without affecting the validity of the annotations that are attached to it.
The definition of a term can be found on the ontology term page linked to the term name and ID.
GO is structured in a hierarchal order with less specific terms being parents of more specific child terms. A child term may have multiple parents and multiple children; the BP mitotic sister chromatid segregation, for instance, has child terms representing each part of the segregation process (sister chromatid cohesion, separation, etc.) as well as parent terms connecting it to both the mitotic cell cycle and chromosome segregation. Crucially, whenever an annotation is made to a term, the gene product is automatically annotated to all the parent terms. The ancestry of a term can be viewed in browsers such as AmiGO or QuickGO, accessible via links on the ontology term page. For more information, see the GO graph documentation.
Multiple relationships exist to describe the links within the ontologies. A child term can have an is_a relation to the parent term, where the child is a more specific type of the parent, or a part_of relationship where the child makes up a part of the parent. For instance, the mitochondrion is_a intracellular organelle and is part_of a cell. Additionally, GO also include regulatory relationships. For more information on relationships in GO, see the Relations in GO documentation.
In PomBase, every annotation is supported by a reference that states where the annotation comes from, and an evidence code that describes the type of data that supports the annotation. An annotation may be inferred from experimental ‘wet lab’ data, backed by a literature reference and citing experimental evidence such as IDA (Inferred from Direct Assay) or IMP (Inferred from Mutant Phenotype). Further information on evidence codes is available in the GO Evidence Codes documentation.
Another source of annotations come from computational methods. Please note that all computational annotations are based on predictions. In cases where a sequence model has been used to annotate genes, but the genes annotated based on the model have not been manually checked, the IEA (Inferred from Electronic Annotation) evidence code is assigned. If the annotations have been manually checked other evidence codes may be used, for instance ISO (Inferred from Sequence Orthology) or ISM (Inferred from Sequence Model). PomBase uses ISO to cross-reference to the roles of known S. cerevisiae genes, and uses ISM when domains present in a gene product can give clues to its biological role.
For some types of evidence, such as sequence comparisons or interaction data, it is important to note what gene or gene product was used in the comparison or detected in the interaction. In these cases the With/From column provides more information regarding the source of the information.
Where available, annotation extensions are displayed underneath the GO term name. The extensions provide additional specificity to the annotation by linking the term to another ontology term or a gene product via a relationship. Examples include specifying substrates of molecular functions or specifying the cellular localization during a process (for instance, S. pombe pka1 has protein serine/threonine kinase activity and has the substrates mei3 and rst2. It is a cellular component of the nucleus during nitrogen starvation, but found in the vacuole during glucose starvation).
The GO Consortium provides further information on annotation extensions in its file format guide, on a wiki page, and in publications from 2014 and 2017. PomBase converts many extension names to more human-friendly text, as described here.
If an extension mentions another S. pombe gene, the extension data will also be displayed as an annotation in the “Target of” section of the page for that gene.
PRO terms can be used in extensions, and PRO terms that are used to associate a GO annotation with a specific modified or processed form are also listed with annotation extensions. In both cases, PRO IDs link to Protein Ontology web pages. Note that PomBase uses human-friendly display names that differ from the full names on the PRO pages; abbreviations used in the display names are included in the extension display documentation.
From a gene page, all S. pombe genes annotated to a term (or its children) can be found by clicking on a term name or ID to reach the ontology term page.
Additionally, the advanced search can be used to search for all genes annotated to a particular GO term (see the advanced search documentation for more information). To find annotations to specific GO terms in organisms other than S. pombe we recommend using AmiGO or QuickGO.
The “Gene structure history” section in the gene page shows all previous gene structures for the main feature of a gene (CDS for coding genes, and transcript for RNA genes). If available, the reasons for the change are indicated as comments or references to databases such as PubMed. In addition, a link to the annotated genome sequence before the structure was changed is provided.
You can find a list of all changes to all gene structures in this file. To download the file, right-click here and select “Save link as…”. Every pair of rows in the file corresponds to a change in the gene structure. The column Before / After indicates whether the coordinates refer to the gene structure before or after the change. In addition, if a reference was added or removed, it appears on the added or removed row, respectively. Comments associated with changes are also included.
Before using these coordinates for analysis, take into account that they may refer to a previous genome sequence / assembly (nucleotide sequence may have changed). You can find a list of the dates where the genome sequence has changed in this file. The relevant columns in the file are:
For example, to extract the sequence of SPAPB15E9.01c before 2002-03-22, complement(3980427..3982657):
The Literature section of a gene page lists the papers that have curated data for the gene or its product.
At the top of the section, there is a link to search PubMed for any papers on the gene. This may retrieve papers not on the gene page Literature list, if there are papers not yet curated (or spurious matches to the search criteria).
For each paper, the full citation and the number of genes curated from the paper are shown, and a “Details” link goes to the publication page.
By default, the list is sorted alphabetically by first author. Use the “Sort by” links to change the order.
The Modifications section lists protein modifications that have been manually curated, using terms from the PSI-MOD ontology, for protein-coding genes. PomBase will add RNA modifications to this section in the future, when relevant data are curated.
The summary view shows only the names of the most specific terms used to annotate the gene:
The detailed view shows more information for each annotation, and may display additional terms:
Where available, annotation extensions are displayed underneath the ontology term name. The extensions provide additional specificity to the annotation, often by linking the term to another ontology term or a gene product via a relationship. Examples include specifying the gene product that adds or removes a modification, specifying modified residues, or specifying that the modification is observed during a phase or process. For example, in S. pombe Lys4 (shown above) is phosphorylated on a serine residue during M phase of the mitotic cell cycle. Likewise, S. pombe Cdc2 is phosphorylated during G2, and phosphorylated on Tyrosine 15 by Wee1; it is phosphorylated during G2 but not M phase of the mitotic cell cycle; other extensions are also available for Cdc2.
The annotation extension field can also be used to indicate modification site occupancy, for experiments that measure the proportion of copies of the protein (or RNA) that have the modification.
Note: unlike GO annotations, for modification annotations extensions are not considered for display filtering. Annotations to less specific terms are hidden in the summary view whether they have extensions or not.
PomBase defines a phenotype as an observable characteristic, or set of characteristics, of an organism that results from the interaction of its genotype with a given environment. In PomBase, phenotypes are annotated using terms from the Fission Yeast Phenotype Ontology (FYPO). FYPO uses several existing ontologies from the Open Biological and Biomedical Ontologies (OBO) collection to construct formal definitions. Basic documentation for FYPO is available at the OBO Foundry, and further information is available on the FYPO wiki).
In the phenotype annotation display on PomBase gene pages, the first item shown is a brief summary indicating whether cells with a null (deletion) allele of the gene are viable or inviable, or either depending on experimental conditions. Next, single-locus phenotypes are shown in two tables. The first table lists phenotypes observed at the population level, such as viability in culture, and the second shows cell-level phenotypes. Note that the viable/inviable population terms describe whether a gene is essential or not, and see the wiki FYPO Content and Structure documentation for more information on cell and population phenotypes. Finally, two more tables list population-level and cell-level multi-locus phenotypes, i.e. phenotypes associated with double mutants, triple mutants, etc, and the relevant genotype details. Diploid genotypes are included in the single- or multi-locus tables as appropriate.
Each table includes ontology term details and supporting data. The summary view shows just the essentials: The list of terms is filtered, using the ontology structure, so that it shows only the most specific terms used to annotate a genotype, and each unique combination of gene, FYPO term, allele(s) and extension(s) is shown once. For single-allele phenotypes, the display includes:
Choose one to restrict the annotation display to terms in the selected branch of FYPO. When term filtering is active, a message appears to indicate that not all annotations are shown:
Change the selection back to “No filter” to see annotations to all terms.
The detailed single-locus phenotype view shows annotations to all FYPO terms, and includes more details for each annotation. It shows separate entries for repeat determinations of a given gene/term/allele/extension combination (if supported by more than one line of evidence and/or reported in more than one paper), and annotations to terms hidden in the summary view:
The unique ID and name for a term in the phenotype ontology. The ID links to a page with additional information, including the term definition, any synonyms, relationships to other FYPO terms, and annotations to the term or its descendants. (See the ontology term page documentation for more.)
Allele details, including a name (if one is used in the literature) and description (where known). The column is headed “Genotypes” for consistency between the single- and multi-locus displays. Diploid genotypes specify both alleles for the locus, and are shown in bold. Each genotype name links to a page with full details (type, description, and expression) for its allele(s), links to gene pages, and a list of all phenotype annotations for the genotype. If you can provide a description for any allele shown as “unknown”, please contact the PomBase curators.
Mouse over the allele name to show the allele type, which indicates whether partial deletions or altered residues refer to amino acids or nucleotides, and expression level.
The phenotype display can be filtered to show subsets of the total set of annotations. The ploidy filter (not shown in this screenshot) selects haploid, diploid, or both genotypes where curated. The term filter, available in the summary or detailed view, lists several broad phenotypic categories derived from high-level FYPO terms. Choose one to restrict the annotation display to terms in the selected branch of FYPO. Change the selection back to “No filter” to see annotations to all terms. In the detailed view, annotations can also be filtered by evidence or throughput by choosing an descriptions from pulldown menus. Change the selection back to “No filter” to see annotations using any evidence type. Different filters, such as term and evidence, can be combined (note that some term/evidence combinations have no matching annotations). When any filtering is active, a message appears to indicate that not all annotations are shown.
A brief descriptor for the type of evidence that supports the annotation. The evidence categories come from the Evidence Ontology (ECO).
Information about experimental conditions, such as temperature, type of medium used, etc. Descriptions come from a small ontology maintained by PomBase curators.
The paper from which the annotation comes.
Phenotype annotations may have extensions to capture penetrance (proportion of a population that shows the phenotype) or severity (previously designated “expressivity”), or to document which gene or protein used in an assay for level, localisation, etc. S. pombe genes link to PomBase gene pages. Severity and penetrance use the relations has_severity and has_penetrance respectively, and can have values such as “high”, “medium”, or “low”. Penetrance can also use numerical values. A gene or gene product used in an assay is stored using the appropriate PomBase systematic ID and the relation assayed_using; the relation is converted to affecting in the gene page display. If a mutation affects an activity that modifies another gene product, extensions may capture the affected enzyme, the affected substrate, or both. The relation assayed_enzyme is displayed as affecting activity of on gene pages, and assayed_substrate is shown as affecting substrate.
Similar displays are used for multi-locus phenotypes. Unless otherwise noted below, all items are as described above for single-locus phenotype displays.
The multi-locus summary shows FYPO terms and genotype descriptions:
The detailed view includes:
Annotation extensions are also included in the multi-locus Summary and Full views (although none are included for the annotations in the above illustrations), using the same display as for single-locus phenotypes.
Also see the Advanced search documentation for information on finding genes annotated to phenotype terms.
Gene pages for protein-coding genes have a section describing protein features. Also see the Modifications documentation.
Note that some of the listed features (e.g. transmembrane domains from TMHMM) are predictions. Consult the contributing databases for further information, or contact the PomBase curators if you notice any problems with annotated or predicted features.
The Sequence section of a gene page provides a widget to download DNA sequences for any gene, and amino acid sequences for protein-coding genes, as well as links to send sequences to BLAST. For protein-coding genes, the predicted amino acid sequence is displayed by default:
If two or more transcripts are annotated for a gene, the primary transcript is shown by default. Use the selector to switch between transcript isoforms.
Toggle to show the amino acid sequence for protein-coding genes (not available for non-coding RNA genes, which always show nucleotide sequence).
Button to save the displayed sequence to a file, with the following options:
Links to send the displayed sequence to BLAST at NCBI or Ensembl.
The peptide sequence header shows the transcript ID and the protein length.
For non-coding RNA genes, and for protein-coding genes with “Show nucleotide sequence” selected, more options are available:
Transcript selector (as above)
Toggle to show the amino acid sequence (not available for non-coding RNA genes).
Controls to add UTRs, introns, or flanking sequences to the displayed sequence. For upstream or downstream sequence, use the up/down control to increment by one base, or type or paste a number in the box.
Link to save the displayed sequence to a file.
Links to send the displayed sequence to BLAST at NCBI or Ensembl. DNA sequences link to BLASTN by default.
The nucleotide sequence header shows the transcript ID and indicates what is included.
When the “Show translation” option is selected, irrelevant controls are hidden and BLASTP links are shown:
The “Target of” section describes genes that affect the gene of interest. Genes listed under “Target of” may include upstream regulators or enzymes that modify the product of the gene of interest. For example, the “Target of” annotations for S. pombe cdc2 indicate that it is a substrate of, and regulated by, the kinase Wee1 and the phosphatase Cdc25 (among others).
Target of data are derived by taking the reciprocal of ontology annotation extensions (using GO annotation extensions and phenotype annotation extensions). The table includes:
The Transcript section of a gene page shows the positions of introns and exons in each transcript. The default is a graphical view:
The default view shows one diagram per annotated transcript, with intron and exon positions hidden. Click “Show exon/intron/UTR positions” to display a table under each transcript diagram:
ID(s) and genomic location(s). The transcript systematic ID is the gene systematic ID with a suffix appended. The primary transcript suffix is “.1”, and any additional annotated transcript isoforms receive sequentially numbered suffixes.
By default, intron and exon positions are shown in the table as genomic coordinates. When the “Show transcript coordinates” button is checked, positions in the table are numbered using the annotated transcription start site as 1.
Mouse over any exon or intron to highlight its coordinates in the table, and bring up a box with position details. Genomic coordinates and within-transcript positions appear in the pop-up no matter which is selected in the main display.
Mouse over any entry in the exon/intron tables to show the box with position details.
The Interactions section of a gene page displays genetic and physical interactions for a gene (or its product), in BioGRID format. All interactions are curated manually by PomBase or BioGRID curators.
Each table has five columns:
The first column (with no header) describes the interaction. The text reflects the type of evidence listed in the Evidence column and, where applicable, the directionality of the interaction.
Interacting gene: The gene that interacts with the gene of interest, linked to its gene page
Interacting product: The description of the interacting gene’s product, from its gene page
Evidence: The type of genetic interaction observed, or the type of experiment performed to detect a physical interaction. The evidence categories come from BioGRID, and are described on their Experimental Evidence Codes documentation page.
Reference: The paper cited to support the interaction
Since November 2022, new or updated Genetic Interaction annotations are linked to phenotype annotations and alleles. We continue to display interactions in the old format by default (showing only genes and interaction type), but if you expand the annotation, you can view the associated genotypes and phenotypes.
The definitions of all genetic interactions can be found in the BioGRID wiki. It is worth reading these definitions, as the language often used in publications does not match the naming of genetic interactions. For example, in publications we can find “double deletion of gene X and Y rescues the defects cellular morphology caused by deletion of gene Y”. However, for BioGRID this is a phenotypic suppression not a rescue, since rescue is reserved for lethality or growth defect. The genetic interactions that are used in low throughput curation in PomBase are:
In addition, we curate the following types of genetic interaction not covered by BioGrid.
When exporting the data to BioGrid, “Synthetic Phenotype” genetic interactions are exported as “Phenotypic Enhancement”, see this GitHub issue for details.
Below is a decision making tree to determine the type of genetic interaction from the phenotypes of the single and double mutant. “Interacting allele” refers to the allele that is not present in the single mutant:
Genotype pages are analogous to gene pages, but describe the alleles that make up a genotype, and show phenotypes associated with the genotype.
The genotype name. A short and/or memorable name can be assigned, but otherwise the default name is constructed by concatenating the names of the alleles that make up the genotype.
Each genotype in composed of one or more alleles. The table lists details for each allele of interest in the genotype. Any curated background details will be shown above the table of alleles.
Phenotypes annotated to the genotype are displayed as described in the gene page documentation.
For diploid genotypes, the table of details includes both alleles of each locus:
The Locus column contains the gene name, linked to its gene page, and spans two rows, one for each allele at the locus. Allele details are as described for haploid genotypes.
To get started as a new community member, you can:
For PomBase help you can read our Frequently Asked Questions or send us an email at helpdesk@pombase.org.
If you use Pombase for your research, please cite or acknowledge the resource in your publications. This is extremely important to indicate the importance of resources to funders. How to cite PomBase.
PomBase is centred around Gene Pages so this is a good place to begin to familiarise yourself with how data is organised. You should visit your favourite gene page, but for this example we are using pol1, the DNA polymerase alpha catalytic subunit. You can access the page by typing the gene name (i.e. pol1) into the search box at the top-right of the website, or at this link.
At the top of the page, you will find some basic information about the locus and gene product. Immediately below is a view of the genomic context of the gene in the JBrowse genome browser. (documentation to access browser data tracks is here):
The same gene may be known by different names. In PomBase, we consider three types:
On the left side of the Gene Page, there is a menu listing the sections in the page (GO molecular function, GO biological process, etc.). Each section contains different kinds of annotations. Go through them and click on the button to see what information is displayed in each section. Most sections show a “summary view” of the experimentally relevant information so that it is easier to consume the biological context. The “Show details” link uncollapses the section to show important associated information such as evidence and provenance, often presenting multiple sources supporting the same annotation. You also will notice that many of the displayed annotations are blue and link to other types of pages:
GO term pages: contain the definition of the GO term and lists all the genes annotated to a specific GO term and its “child” terms. Read more…

Phenotype pages the Fission Yeast Phenotype Ontology (FYPO) term pages: provide the phenotype definition and list all the genotypes annotated to a FYPO term and its ‘child’ terms, as well as link to the parent terms. Read more… Read more…
Genotype pages: contain all the phenotypes associated with a genotype as well as the alleles that constitute that genotype. Example: mal3delta.
Other ontology term pages. Read more
You can query PomBase annotations using a Graphical User Interface, the “Advanced search” (https://www.pombase.org/query). You can make lists of genes that satisfy a certain condition, and perform operations with these lists. Below some examples:
Disease-associated genes that give a cytoskeleton phenotype in Schizosaccharomyces pombe: Read how to make this query…
Genes that locate to the Golgi apparatus or the endoplasmic reticulum and cause an exocytosis or endocytosis phenotype. Read how to make this query…
Full documentation of advanced search can be found here.
The PomBase High Confidence Physical Interaction Network (HCPIN) is a collection of physical interaction data based on three subsets of Gene Ontology (GO) annotations:
The data can be downloaded in tab-delimited format from the Download Datasets page.
The identifier mapper retrieves S. pombe gene systematic IDs and standard names for a selection of different input ID types:
Select an input identifier type in the pulldown, and enter IDs by typing, pasting, or uploading a file:
Click “Clear” to empty the input box or “Lookup” to retrieve results.
For all query types, the number of matching S. pombe genes is shown at the top. Any unmatched IDs are shown next.
“Go back” returns to the start page, with the search settings and IDs you used filled in.
You can use the list of matching S. pombe genes in the Advanced Search “Gene names and IDs” query.
For orthology ID searches, matching S. pombe genes may fall into any of into three categories:
For S. pombe UniProt accessions, almost all results are one-to-one; the show/hide toggle works the same as for ortholog results.
PomBase accepts batch submissions of certain types of data that appear on PomBase gene pages. For these data types, we use dedicated PomBase-specific formats:
For data that can be connected with sequence features or coordinates, and displayed as tracks in the genome browser, see the data format FAQ and further details linked there.
Linking to PomBase: To link to any PomBase gene page, use the systematic ID for the gene in a URL with the syntax “https://www.pombase.org/gene/[systematic ID]”. For example, https://www.pombase.org/gene/SPBC11B10.09 links to the gene page for cdc2.
Linking from PomBase to external resources: We can provide links from PomBase gene pages to gene- or gene product-specific S. pombe data for any resource that uses URLs with PomBase systematic IDs. Please contact the PomBase Curators for more information.
We plan to add specific documentation about comparative genomics using S. pombe here. In the meantime, you can look at the documentation for Ensembl Compara.
For help with anything in PomBase not covered here, you can contact the curators.
Sequence features can also downloaded from data directory and viewed in Artemis. See this FAQ for more information.
PomBase welcomes submissions of published large-scale modification data sets. We have devised a tab-delimited text file format for bulk modification data.
Include a header line that labels the columns – use the entry in the Contents column below as the column header text.
| Column | Contents | Example | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 | Gene systematic ID | SPBC11B10.09 | Yes | No |
| 2 | Gene name | cdc2 | No | No |
| 3 | Ontology ID | MOD:0000001 | Yes | No |
| 4 | Evidence | ECO:0000006 | Yes | No |
| 5 | Residue | S72 | No | Yes |
| 6 | Extension | added_by(PomBase:SPBC11B10.09) | No | Yes |
| 7 | Reference | PMID:24763107 | Yes | No |
| 8 | Taxon | 4896 | Yes | No |
| 9 | Date | 2014-05-01 | Yes | No |
Notes:
At present we accept protein modification data, using PSI-MOD IDs in the Ontology ID column. We plan to accept RNA modification data in the future. More information is available in the gene page modifications documentation.
Use one line per modified position (multiple entries are allowed only in the Extension column).
File columns:
Allowed annotation extensions:
Annotation extensions can be used to provide additional information, such as a gene whose product adds or removes a modification, a process or cell cycle phase during which a modification is present, or modification site occupancy (see the gene page modifications documentation for more information). Each annotation extension consists of a relation and either an identifier or a number.
| Extension relation | Meaning | Example |
|---|---|---|
| added_by | identifies a gene product that adds the modification | added_by(PomBase:SPBC11B10.09) |
| affected_by | identifies a gene product that has some influence on the modification, but has not been conclusively shown to add or remove it | affected_by(PomBase:SPBC11B10.09) |
| removed_by | identifies a gene product that removes the modification | added_by(PomBase:SPAC24H6.05) |
| added_during | identifies a biological process or cell cycle phase during which the modification is actively added | added_by(GO:0000085) |
| removed_during | identifies a biological process or cell cycle phase during which the modification is removed | removed_by(GO:0000087) |
| present_during | identifies a biological process or cell cycle phase during which the modification is observed (note that the modification may have been added during this process – if this is known use the added_during relation – or during a preceding process) | present_during(GO:0000085) |
| absent_during | identifies a biological process or cell cycle phase during which the modification is not observed (note that the modification may have been removed during this process – if this is known use the removed_during relation – or during a preceding process) | absent_during(GO:0000087) |
| decreased_in_presence_of | use when the modification is observed at a lower level in the presence than in the absence of an extraneous substance | decreased_in_presence_of(CHEBI:84327) |
| increased_in_presence_of | use when the modification is observed at a higher level in the presence than in the absence of an extraneous substance | increased_in_presence_of(CHEBI:84327) |
| required_for | indicates that a modification is required for a GO function or process | required_for(GO:0000086) |
| occupancy | percent representing what proportion of copies of the protein have the modification | occupancy(51.5%) |
| level_fluctuates_during | identifies a biological process (e.g. the cell cycle or one or more of its phases) during which the modification site occupancy is observed to vary | level_fluctuates_during(GO:0000278) |
| multiplicity | number of modified sites detected within the same peptide fragment (relevant to mass spec. methods) | multiplicity(2) |
| in_absence_of | This relation is used to indicate attenuation of the activity of a specific gene product (either by deletion or inactivation). This extension must be used with an additional extension describing the modification | in_absence_of(PomBase:SPBC11B10.09) |
| decreased_during | identifies a biological process or cell cycle phase during which the modification is actively increased | decreased_during(GO:0034605) |
| increased_during | identifies a biological process or cell cycle phase during which the modification is actively deceased | increased_during(GO:0034605) |
Please contact the PomBase curators if you have any questions about what to use for modification IDs, Evidence, annotation extensions, or anything else you need to represent your data in this format.
The peptide motif search finds short peptide sequence matches in the predicted amino acid sequences of S. pombe proteins.
Type or paste a motif using the single-letter amino acid code. As you type, matches will appear. The results table shows each matching sequence in the context of a longer stretch of the protein sequence. The list of genes with one or more matches can be sent to the advanced search.
The search can also use wildcards, codes for groups of amino acids (e.g. any charged amino acid), and syntax to specify motifs at the beginning or end of a protein:
| Sequence | will find |
|---|---|
| CADR | any protein containing CADR |
| CA[DE]R | any protein containing CADR or CAER |
| CA[DE]+LQ | CA(any sequence of D and E)LQ |
| CA…R | CA(any three amino acids)R |
| CA.+R | CA(one or more amino acids)R |
| SPR. | SP.R |
| ^ME | proteins beginning with ME |
| LAA$ | proteins terminating LAA |
| ^.{{ "{1,20}MCA" }} | proteins with MCA in the first 20 amino acids |
Amino acid group codes
| AA group | Code | Amino acids |
|---|---|---|
| acidic | 0 | DE |
| alcohol | 1 | ST |
| aliphatic | 2 | AGILV |
| aromatic | 3 | FHWY |
| basic | 4 | KRH |
| charged | 5 | DEHKR |
| hydrophobic | 6 | AVILMFYW |
| hydrophilic | 7 | KRHDENQ |
| polar | 8 | CDEHKNQRST |
| small | 9 | ACDGNPSTV |
| tiny | B | AGS |
| turnlike | Z | ACDEGHKNQRST |
Examples:
For each ontology term loaded into PomBase, a page summarizes essential details about the term, and shows any annotations to it or its descendants via is_a, part_of, and the regulates relations (the GO documentation on Ontology Structure and Ontology Relations has some useful information on this topic). For FYPO terms only, the has_part relation is also used.
The main illustrations use a GO term page. Note that not all ontology terms have all of the depicted features.
As on gene pages, a more detailed annotation display is available:
FYPO term pages have a few distinctive features:
Ontology term pages are available for GO, FYPO, SO, PSI-MOD, and PomBase internal ontologies including the PBO description collection, the PomGeneEx descriptions for qualitative gene expression, and FYECO (previously known as PECO) for phenotype experimental conditions.
The “Orthologs” section of a gene page includes two subsections.
The first lists any orthologous genes in budding yeast (Saccharomyces cerevisiae) or human (Homo sapiens) that have been assessed and recorded manually, as described below, by curators. Budding yeast entries link to the Saccharomyces Genome Database (SGD), and human genes link to HGNC; the text descriptions come from these databases. For more information, including how to search the curated orthologs, see the FAQs on budding yeast and human orthologs.
The second subsection provides links to several resources that predict orthologs in all fungi or all species (PomBase does not manually curate orthologs in species other than budding yeast and human). For further information, see the FAQ on orthologs in additional species. (Note: these links also appear in the External references section.)
Manual ortholog prediction methods: The human and budding yeast orthologs are manually predicted based on a variety of sources. In some cases the consensus ortholog from the major ortholog predictors (Compara, Inparanoid, OrthoMCL) is used. Many distant orthologs have also been identified by PSI-BLAST matches; these alignments have been submitted to the Pfam protein family database. Other ortholog predictions come from experimental data demonstrating functional correspondence or involving membership of corresponding complexes. These predictions are also aligned and submitted to Pfam before inclusion. PomBase’s approach ensures that the breadth of coverage is greater than any individual prediction method, and includes many ortholog calls which are not detected by any automated method. Gradually, we will add and display supporting references for all orthology calls.
The Paralogs section lists any curated paralogous fission yeast genes.
PomBase welcomes submissions of published large-scale phenotype data sets. We have devised a tab-delimited text file format for bulk phenotype data. A similar format is used for the downloadable file of single-allele phenotype data (with one more column at the start of each line to identify PomBase as the source; note that, because Database is column 1 in the downloadable file, column numbers differ by 1 between the download and upload formats).
Include a header line that labels the columns – use the entry in the Contents column below as the column header text.
| Column | Contents | Example (from S. pombe) | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 | Gene systematic ID | SPBC11B10.09 | Yes | No |
| 2 | FYPO ID | FYPO:0000001 | Yes | No |
| 3 | Allele description | G146D | Yes | No |
| 4 | Expression | overexpression | Yes | No |
| 5 | Parental strain | 975 h+ | Yes | No |
| 6 | Background strain name | SP286 | No | No |
| 7 | Background genotype description | h+ ura4-D18 leu1-32 ade6-M210 | No | No |
| 8 | Gene name | cdc2 | No | No |
| 9 | Allele name | cdc2-1w | No | No |
| 10 | Allele synonym | wee2-1 | No | Yes |
| 11 | Allele type | amino acid mutation | Yes | No |
| 12 | Evidence | ECO:0000336 | Yes | No |
| 13 | Condition | at high temperature | Yes | Yes |
| 14 | Penetrance | 85% | No | No |
| 15 | Severity | medium | No | No |
| 16 | Extension | assayed_using(PomBase:SPBC582.03) | No | Yes |
| 17 | Reference | PMID:23697806 | Yes | No |
| 18 | taxon | taxon:4896 | Yes | No |
| 19 | Date | 2012-01-01 | Yes | No |
| 20 | Ploidy | homozygous diploid | No | No |
Notes:
Please include all 19 columns. If you have nothing to put in one of the non-mandatory columns, include the header and leave the column blank in the rest of the rows.
Details for allele types and descriptions:
General note: Nucleotide and amino acid positions should reflect the current sequence data in PomBase. Please refer to the Gene Coordinate Changes page to ensure that your residue position entries are up to date.
For protein-coding genes, number nucleotide residues from 1 starting with the A of the initiator ATG.
For histones, amino acid residue numbering assumes that the initiator methionine is removed.
| Allele type (col. 11) | Example allele description (col. 3) | Notes |
|---|---|---|
| amino acid mutation | S123A | use one-letter code; if more than one change, separate with comma(s) |
| deletion | deletion | use this description for complete deletions |
| nucleotide mutation | C123A | if more than one change, separate with comma(s) |
| disruption | pab1::ura4+ | expression will usually, but not always, be null |
| other | RGTPI inserted after I254 | include a brief text description |
| partial amino acid deletion | 1-100 or A123* | indicate deleted residues; use comma-separated ranges for discontinuous deleted segments; use * for nonsense mutations. |
| partial nucleotide deletion | 500-800 | indicate deleted residues; use comma-separated ranges for discontinuous deleted segments |
| unknown | unknown | an allele name is required if the type and description are unknown |
| wild type | wild type | use with altered expression (overexpression or knockdown) for single-allele phenotypes |
Please contact the PomBase curators if you have any questions about what to use for Evidence, Conditions, etc., or anything else you need to represent your data in this format.
Return to the Fission Yeast Phenotype Ontology page
“GO slims” are subsets of the Gene Ontology (GO) that provide a broad overview of annotation distribution. Slims can offer a useful overview of a genome or the results of a large-scale experiment. For more information on GO slims, please see PomBase GO Slimming Tips and the GO Subset Guide at the Gene Ontology website.
PomBase provides a GO slim term set for each major branch of GO:
Each fission yeast GO slim has been constructed to optimise coverage of gene products annotated to terms in the branch of GO. For the biological process and cellular component branches, coverage is almost complete; the molecular function branch has somewhat lower coverage. These slims provide good starting points for users who wish to identify terms of biological interest to create a “custom slim”, or to become familiar with the genome contents.
In the GO slim tables, GO IDs link to the QuickGO browser, where you can explore the ontology and annotations further. The annotation totals include annotations to the slim term and to descendants following the is_a, part_of, regulates, positively_regulates, and negatively_regulates relationships, and link to gene lists. (Note: the cellular component ontology does not contain any “regulates” links.)
The GO biological process slim table also includes links to visualisations in esyN for the physical interaction network of genes annotated to each term.
The bottom of each GO slim page lists some simple statistics: the total number of gene products annotated to slim terms, and the number of protein-coding gene products not covered by the slim, either because they are not annotated to any term in the GO branch, or because they have annotations to terms not covered by the slim.
Current GO slim IDs and term names can be downloaded from the PomBase ftp site:
For each publication loaded into PomBase, a page summarizes essential details about paper, and shows any annotations that cite it.
Publication details, including links to PubMed and EuropePMC
Any community curators who have contributed annotations via Canto are acknowledged.
Summary views are identical to those on gene pages (GO example).
In detailed views annotations are displayed as on gene pages, except that a column for the annotated gene is included and the Reference column is omitted.
Term and evidence filtering are available for phenotype annotations as described in the gene page documentation.
Like gene pages, publication pages include annotations of all types, with summary and detailed views available for most types:
PomBase welcomes submissions of published large-scale gene expression data sets. We have devised a tab-delimited text file format for bulk data representing qualitative assessments of protein or RNA levels.
Note: Please use this format only for data that you want to appear in the “Qualitative gene expression” section of PomBase gene pages. If you have gene expression data that should be included as a data track in the PomBase genome browser (microarray, RNASeq, etc.), please use the data submission form for HTP sequence-linked data.
Include a header line that labels the columns – use the entry in the Contents column below as the column header text.
| Column | Contents | Example | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 | Gene systematic ID | SPBC11B10.09 | Yes | No |
| 2 | Gene name | cdc2 | No | No |
| 3 | Type | protein | Yes | No |
| 4 | Evidence | ECO:0000006 | Yes | No |
| 5 | Qualifier | increased | Yes | No |
| 6 | Extension | during(GO:0000084) | Yes | Yes |
| 7 | Reference | PMID:18203864 | Yes | No |
| 8 | Taxon | 4896 | Yes | No |
| 9 | Date | 2014-05-01 | Yes | No |
PomBase welcomes submissions of published large-scale gene expression data sets. We have devised a tab-delimited text file format for bulk data representing representing protein or RNA copy number per cell.
Note: Please use this format only for data that you want to appear in the “Quantitative gene expression” section of PomBase gene pages. If you have gene expression data that should be included as a data track in the PomBase genome browser (microarray, RNASeq, etc.), please use the data submission form for HTP sequence-linked data.
Include a header line that labels the columns – use the entry in the Contents column below as the column header text.
| Column | Contents | Example | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 | Gene systematic ID | SPBC11B10.09 | Yes | No |
| 2 | Gene name | cdc2 | No | No |
| 3 | Type | protein | Yes | No |
| 4 | Extension | during(GO:0051329) | No | No |
| 5 | Copies per cell | 1234 | Yes | No |
| 6 | Range | 1100-1350 | No | No |
| 7 | Evidence | ECO:0000006 | Yes | No |
| 8 | Scale | single_cell | Yes | No |
| 9 | Condition | minimal medium, high temperature | Yes | Yes |
| 10 | Reference | PMID:23101633 | Yes | No |
| 11 | Taxon | 4896 | Yes | No |
| 12 | Date | 2014-05-01 | Yes | No |
PomBase’s Quick Little Tool (QuiLT) allows you to view multiple types of annotation for genes in a list in a single graphical display.
On any gene list page, including Advanced Search results and the gene lists linked to ontology term pages, click the “Visualise” button to reach QuiLT. To return to the previous page, use the “Finish visualisation” button.
In the QuiLT display, each row represents a single gene, and each column is an annotation type.
Use the checkboxes (1) to toggle an annotation type on and off. When annotations are shown, a link appears to sort on that annotation type. You may want to try different combinations of which types are shown, and which used to sort the list, until you get a display you like. You can download the graph (with key) in SVG format at any time (2). The key (4) shows only terms used to annotate genes in the list, so for small gene lists not all terms may appear.
Click on a row to select a single gene, or click on a box in any column (3) to select all genes in it. In the displayed gene list, you can clear the selection (5) or use the “Filter” button (6) to create a new gene list from the selection (which you can then visualise in QuiLT).
Each QuiLT visualisation page has a stable, unique URL that you can bookmark, copy/paste, and share. Anyone who follows a shared link will see QuiLT displaying the same gene list. Clicking the “Advanced Search” button adds a query that would produce the gene list to the query history.
At present, QuiLT includes:
In each branch of GO, only one term per gene can be included for display. If a gene is annotated to more than one GO term, one is selected for the QuiLT display according to a set order of precedence:
The simple search is available via the search box in the header on every PomBase page:
The simple search works for:
Start typing to see a pulldown of autocomplete matches, then choose one, or if there is a single match simply hit return, to go to the matching gene page.
For publications or ontology terms, type or paste an ID as directed. If no autocomplete suggestions appear, enter the ID and hit return to execute the search.
The Taxonomic conservation section provides manually assigned classifiers of taxon distribution (at the domain/kingdom level) of the product of a protein-coding gene. The classifiers come from a small controlled vocabulary maintained by PomBase curators. All applicable terms are assigned to a protein.
For each annotation, the summary view shows a text description, which corresponds to an entry in the internal PBO term set. The detailed view adds the PBO ID and a count that links to the ontology term page for the description.
Note: Your browser may prompt you to open or download the linked documents.
pombe2017 Banff, Alberta, Canada 14-19 May 2017
pombe2015 Kobe, Japan 21-25 June 2015
pombe2013 London, UK 24-29 June 2013
pombe2011 Boston, MA, USA 25-30 June 2011
Boston, MA, USA, 25-30 June 2011
London, UK, 24-29 June 2013
Kobe, Japan, 21-26 June 2015
Banff, Alberta, Canada, 14-19 May 2017
The new, improved PomBase
External link to conference program
The nightly release of PomBase data includes a dump from the PomBase Chado database.
Archived Chado data dumps are also available for download. From January 2018 onwards, monthly data snapshots are provided. Earlier archived dumps correspond to the intermittent PomBase releases made between July 2012 and January 2017. For these dumps, the file names include release numbers that correspond to the “Annotation Version” numbers in the Data version history table.
Please contact the curators if you need any data not available at the links above.
Note that most of the datasets available here are compressed (.gz), and can be uncompressed by utilities available in all common operating systems. Your browser may prompt you to open or download files.
The current genome sequence is available in FASTA format. The linked directory contains a file for the whole genome sequence as well as separate files for each chromosome.
These files contain coordinates, but no sequence data:
Sequences in FASTA format for:
| Region | Description |
|---|---|
| Telomeres | Telomeric sequence |
| Centromeres | Centromeric sequence and maps |
| Mating Type Region | Links to genome browser for 972 h- (chromosome 2 coordinates) and h+ (mating region contig) |
S. pombe GO annotations are available as tab-delimited files in GAF 2.2 format. The files include annotations made by manual literature curation, annotations inferred from keyword mappings based on curated descriptions, and annotations shared by the UniProt GOA team.
Also see the list of protein complexes, which uses GO macromolecular complex terms and IDs.
The contents of the files downloadable from PomBase may differ from files available elsewhere (e.g. see this FAQ), and will not include annotations inferred by transitivity (see this FAQ).
Previous versions of the S. pombe GO annotation file can be retrieved from the archive directory. Note that files produced before March 2021 are only available in GAF 2.1 format.
To cite the fission yeast GO data, please see Citing PomBase.
Downloadable intron datasets are available in FASTA format
Note that you can also use the Advanced Search to find all genes containing introns, as described in the FAQ on introns.
We also provide access to archived intron data. Please note that this set of intron data reflect the dataset at the time of publication of the S. pombe genome sequence, and does not include any new introns, or changes to introns, since then. The intron data archive includes:
These files are available in the names and IDs directory
gene_IDs_names.tsv tab-delimited file of systematic ID, primary gene name (where assigned), and all synonyms for each gene
gene_IDs_names_products.tsv tab-delimited file of systematic ID, primary gene name (where assigned), chromosome, product description, UniProtKB accession, all synonyms, and product type (protein coding, ncRNA, etc.) for each gene
Files include systematic name, primary name (where assigned), synonyms (where assigned), and gene product description
Note: A tab-delimited file of systematic identifiers mapped to EC numbers was previously maintained, but has not been updated since March 2012. The most recent version of the gp2EC.txt file is available in the archive, but because it is out of date it may contain errors or omissions.
Phenotype annotations (link downloads gzipped file from PomBase) for alleles of S. pombe genes are manually curated from the literature using Fission Yeast Phenotype Ontology (FYPO) terms. Note: this file contains annotations for single allele phenotypes (single mutants) only.
The file is in a version of the PomBase phenotype data bulk annotation format (PHAF), detailed below. This format in nearly identical to the one that can be used to submit phenotype annotations to PomBase in bulk, as described on the Phenotype data bulk upload format page, with the addition of the Database column. Note that, because Database is column 1 in the downloadable file, column numbers differ by 1 between the download and upload formats.
Propagating phenotype annotations: Note that the file contains only direct annotations to FYPO terms. It does not include annotations that can be inferred by propagating between terms within the ontology. To make full use of the FYPO annotation data, we strongly recommend also using the ontology structure and inferred annotations. Please contact the PomBase helpdesk if you need assistance.
A set of “viability summary” data as shown at the top of the FYPO table on each gene page, is available as a downloadable file. The file has two columns: the gene systematic ID and one of three values: “viable”, “inviable” or “condition-dependent”.
To cite the fission yeast phenotype data (complete or viability summary), please see Citing PomBase.
A column marked “mandatory” will always have an entry; non-mandatory columns may be empty.
| Column | Contents | Example | Mandatory? | Multiple entries allowed? |
|---|---|---|---|---|
| 1 | Database | PomBase | Yes | No |
| 2 | Gene systematic ID | SPBC11B10.09 | Yes | No |
| 3 | FYPO ID | FYPO:0000001 | Yes | No |
| 4 | Allele description | G146D | Yes | No |
| 5 | Expression | overexpression | Yes | No |
| 6 | Parental strain | 975 h+ | Yes | No |
| 7 | Background strain name | SP286 | No | No |
| 8 | Background genotype description | h+ ura4-D18 leu1-32 ade6-M210 | No | No |
| 9 | Gene name | cdc2 | No | No |
| 10 | Allele name | cdc2-1w | No | No |
| 11 | Allele synonym | wee2-1 | No | Yes |
| 12 | Allele type | amino acid mutation | Yes | No |
| 13 | Evidence | ECO:0000336 | Yes | No |
| 14 | Condition | at high temperature | Yes | Yes |
| 15 | Penetrance | 85% | No | No |
| 16 | Severity | medium | No | No |
| 17 | Extension | assayed_using(PomBase:SPBC582.03) | No | Yes |
| 18 | Reference | PMID:23697806 | Yes | No |
| 19 | taxon | taxon:4896 | Yes | No |
| 20 | Date | 2012-01-01 | Yes | No |
| 21 | Ploidy | homozygous diploid | No | No |
Notes:
The full protein dataset is available in FASTA format (link downloads gzipped file from PomBase).
The protein data directory contains assorted data (see the README for file formats):
Also see the protein modification annotations directory.
Welcome to the PomBase FAQ. Choose a link in the left-hand menu to see the questions and answers in that category.
If you can’t find the information you need here or in the PomBase documentation, please contact the Helpdesk.
There are two APIs for PomBase data:
The PomBase data can be accessed programmatically using the InterMine API. See the InterMine Documentation and examples to find out more.
Available data types include:
InterMine Client libraries are available in multiple languages.
This API can be used to query S. pombe data in Ensembl Genomes. Note that EG is updated much less frequently than PomBase, so EG data will rarely be as up-to-date as the PomBase web site.
Documentation:
PomBase does not have a publicly accessible SQL query server, but Chado database dumps (PostgresQL) are available to download and query locally.
The Ensembl Fungi MySQL database server does provide access to query S. pombe data. Note, however, that Ensembl Genomes (EG) is updated much less frequently than PomBase, so EG data will rarely be as up-to-date as the PomBase web site.
MySQL dumps of EG data, including Schizosaccharomyces species, are available from EG’s FTP site.
PomBase does not offer a GFF-to-GTF converter. There is a perl script on SEQanswers, which uses the module Bio::Tools::GFF from the BioPerl library, available from http://seqanswers.com/forums/showpost.php?p=22529&postcount=4
PomBase does not offer a converter. The Sequence Ontology project offers a conversion tool available for download or usage via web form from their GitHub site
PomBase has an identifier mapper that retrieves S. pombe gene systematic IDs and standard names for a selection of different input ID types:
For UniProt IDs, we also provide a static mapping file of PomBase systematic IDs and UniProtKB accessions, available on the Data Mapping page and by FTP from https://www.pombase.org/data/names_and_identifiers/PomBase2UniProt.tsv.
For IDs not included in the PomBase mapper, we suggest you try the EBI’s PICR web service (http://www.ebi.ac.uk/Tools/picr/), which can convert between UniProtKB, RefSeq, Ensembl Genomes (including S. pombe systematic IDs), and many other common database IDs.
For other Schizosaccharomyces species (S. japonicus, S. octosporus, S. cryophilus), the PICR service converts between UniProtKB accessions and the identifiers used in Rhind et al. Comparative functional genomics of the fission yeasts (PMID:21511999), but with one caveat: the IDs used by PICR, UniProtKB, and QuickGO contain underscores, whereas those in Rhind et al. do not (e.g. SJAG_00455 versus SJAG00455). The IDs with underscores are correct.
A small number of enrichment tools use phenotype data. See the FAQ on FYPO term enrichment.
Yes, the Phenotype annotations page offers two options, a complete phenotype annotation file and a “viability summary” for deletion mutants. At present, the full file contains all manually curated single mutant phenotypes, and is in the same format as PomBase uses for bulk phenotype data submissions (see the file formats FAQ). Further information on the viability summary is available in the essential genes FAQ.
The S. pombe networks in esyN use the PomBase High Confidence Physical Interaction Network (HCPIN) data. The data can be downloaded in tab-delimited format from the Download Datasets page, which links to an FTP directory with two files. One contains physical interaction data, and the other contains GO substrate data. Each file lists two gene systematic IDs and a reference identifier (usually a PubMed ID).
Yes, sequence and feature annotations data files are available for each chromosome on the Genome datasets page.
Yes; first use the advanced search to find the set of genes you want (see the documentation as needed).
Click on a count in the query history to see the results, with a button for “Download” options. In the popup, click on the Sequence tab, select Nucleotide, then tick boxes to add any of: 5’ UTR, introns, 3’ UTR. To include flanking sequences, type or use the arrow buttons to set the desired length of upstream and downstream sequence.
To download track data from the genome browser (or follow a link from a gene page), first, make sure the you have enabled the track(s) of interest (see the FAQ on showing tracks if necessary).
Next select a region by entering coordinates or by highlighting it. For any data track, click on the end of the track label to show the dropdown menu, and choose “Save track data”. In the popup that appears, choose a data format, edit the file name if desired, and click “Save”.
Most track data are available in GFF3 format; other options will depend on the data type (e.g. BED, Wiggle, etc.).
See the PomBase JBrowse guide for more information.
Orphan genes are generally defined as genes without homologs in other organisms. In PomBase, protein-coding genes conserved in the Schizosaccharomyces genus are distinguished from genes conserved only in S. pombe.
To retrieve either set of genes, use the “Taxonomic conservation” query in the Advanced Search. Choose “Schizosaccharomyces specific” for genes found in more than one Schizosaccharomyces species, or “Schizosaccharomyces pombe specific” for genes found only in S. pombe. See the Advanced Search documentation for help with performing searches.
Historical note: Prior to August 2014, PomBase and its predecessor GeneDB referred to single-copy genes conserved within, but not outside, the Schizosaccharomyces genus as “sequence orphans”. See the Gene characterisation statistics history page for more details (note that the gene characterisation classifications reflect whether a gene has been studied experimentally as well as the extent of its conservation).
There are very few manually curated promoters in PomBase; they are included in the forward and reverse strand feature tracks, which are enabled by default. To search the manually curated promoters, we suggest that you use Artemis. Follow the instructions in this FAQ, and search for features with “Key” = “promoter”.
Computationally identified matches to the DNA binding sites found in S. pombe are available as a data track in PomBase JBrowse. To launch JBrowse with the track loaded, use this link.
The genome browser also includes transcription start site datasets, such as the CAGE-defined transcription start sites across 5 different conditions from Thodberg et al. (2018).
We will also soon add the dataset from Li et al. (2015) Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE. RNA Biol. 12:525-37 (PMID:25747261), which was available in the previous version of the PomBase genome browser.
We will also add any new promoter data sets that are submitted to us.
Replication origins cannot yet be viewed or searched as features on PomBase pages, but they can be displayed on tracks in the genome browser. Select one or more of the tracks with data type “Replication Origins” (see the browser track FAQ if necessary).
You can also use the data collated by Conrad Nieduszynski in S. pombe OriDB:
PomBase maintains a list of genetic loci that have not been cloned or mapped. The page lists the names published for the loci and the publications that use the names. In a few cases, unmapped loci have been shown to be allelic with each other.
Note that some locus names coincidentally match the standard names of cloned genes. In these cases PomBase curators have determined that the unmapped locus is not the same as the named gene.
No, but this can be done within Artemis.
Install Artemis (available from http://www.sanger.ac.uk/science/tools/artemis; for S. pombe we recommend using Artemis Version 16.
You can then read in the EMBL format chromosome contig files of sequence and annotation (available from the Genome datasets page). To generate a restriction map:
A file of cDNA sequences in FASTA format is available on the Genome datasets page, under the “Feature sequences” heading.
The genomic GFF3 file available on the Genome datasets page includes all gene features, but not LTRs or other repeats. The files in EMBL and GenBank formats contain all annotated sequence features.
Another option for extracting all annotated features (or if you need to specify which feature types to include) is to use the Ensembl API.
See the FAQ “Can I access PomBase via an API?” for more information on using the API.
If an essential gene is deleted, the cell cannot survive under normal laboratory conditions. A search for deletion alleles annotated to the Fission Yeast Phenotype Ontology term “inviable vegetative cell population” (FYPO:0002061) would therefore identify essential fission yeast genes. Similarly, deletion alleles annotated to “viable vegetative cell population” (FYPO:0002060) represent non-essential genes.
Note that viability/inviability annotations are fairly complete for protein-coding genes, but very few non-coding RNA genes have been tested.
Downloadable summary
A set of “viability summary” data, as shown at the top of the FYPO table on each gene page, is available as a downloadable file. The file has two columns: the gene systematic ID and one of three values: “viable”, “inviable” or “condition-dependent”.
Querying
To find genes annotated to “inviable vegetative cell population”, You can also set up the query manually: select the “phenotype” query and type or paste the ID, FYPO:0002061. Select the “Null” option for “Expresion level” and submit the query. The results include all genes that showed inviable phenotypes in the HTP deletion project as well some manually annotated genes. Similarly, there is a query for genes annotated to “viable vegetative cell population” (FYPO:0002060).
For some deletion mutants, viability depends on experimental conditions, which cannot yet be queried in PomBase. These genes are annotated to both viable (FYPO:0002060) and inviable (FYPO:0002061) at once. To find them, do both searches above, then click the boxes beside both in the query history table and click the “Intersect” button (equivalent to the “AND” operator).
See the advanced search documentation for more information on performing the searches described here.
A brief note about FYPO terms
At present, there are very few null mutants annotated as inviable in life cycle stages other than vegetative growth, and “inviable vegetative cell population” best fits the most common usage of “essential gene”. If you do want to include other stages (such as “inviable spore”), you can use the very generic term “inviable cell population” (FYPO:0002059) or “viable cell population” (FYPO:0002058) in your query. All of the caveats about alleles and conditions still apply.
Query links
Yes: From the PomBase name and identifier mappings page, retrieve this file:
https://www.pombase.org/data/names_and_identifiers/sysID2product.tsv
Also consider other files listed on the page.
Data that appear on gene pages – sequence feature annotations, ontology annotations, etc. – are stored in a database that uses the Chado schema. Snapshots of the PomBase Chado database are available via the Downloads page.
Yes, you can type or paste a list, or upload a file, into the “Gene names and IDs” query in the advanced search. Note that usisg systematic IDs is the best way to avoid ambiguity. Names or IDs can be separated by spaces, commas, or newlines. Click “Lookup” to retrieve the results. You can use the list in the query history to combine with other queries, or download selected details for the genes. See the documentation to learn more.
The best way to find metabolism-related annotations for S. pombe genes is to use the GO annotation data available from PomBase in combination with mappings between GO terms and entries in the various metabolism-oriented databases.
For example, many GO molecular function (MF) terms representing enzymatic activities are mapped to the corresponding Enzyme Commission (EC) number for the reaction, and some are also mapped to entries from KEGG or from the Rhea database of annotated chemical reactions. GO MF and biological process (BP) terms may be annotated to reactions or pathways, respectively, in MetaCyc or Reactome.
A complete list, with descriptions and links, is available on the GO Consortium’s Cross-References page.
You can find the GO annotations for your genes corresponding to functional roles and localizations. Our recommended approach depends on how many specific topics you are interested in:
For a small number of specific GO terms (e.g. localization to the nucleus or cytoplasm, or a role in signaling or DNA metabolism), you can use the advanced search. Paste your gene list into the “Gene names and IDs” query, and then combine it with a GO query for each term of interest (see the search documentation for more information).
If you are interested in many GO terms, or if you do not know in advance which terms may be relevant, we recommend that you use a “GO term enrichment” tool. Such tools are typically used to find terms overrepresented for a gene list, but can be used to retrieve all GO annotations if the p-value threshold is set artificially high.
Both the Advanced Search and term enrichment tools take advantage of the hierarchical structure of GO, such that annotations to specific terms are propagated to “ancestor” terms via is_a and part_of relations. See the PomBase GO documentation, and the GO Consortium documentation linked there, for more information. (These approaches also make it easier to maintain and update your data than storing individual GO annotations locally.)
Also see the FAQ on GO term enrichment and the PomBase GO Slim documentation page.
Yes, you can download the term names and IDs for the each of the fission yeast GO slims, and the Mondo Disease Ontology slim:
Current GO slim IDs and term names
Current fission yeast Mondo Disease Ontology slim IDs and term names
For further information on using the S. pombe slims, please see the PomBase GO slim pages (biological process, molecular function, cellular component), GO slimming tips, and GO slim documentation.
Although old cosmid sequences used in the reference assembly are not available in PomBase directly, they are all stored in the International Nucleotide Sequence Database Collaboration database (ENA, GenBank, DDBJ) archives. For ease of searching, PomBase curators recommend finding the accession, e.g. AL137130, for a cosmid, and using GenBank to retrieve the sequence:
Go to http://www.ncbi.nlm.nih.gov/nucleotide/ (or choose “Nucleotide” in the search pull-down menu on any NCBI search page). Enter the accession. The resulting page will inform you that the sequence has been replaced by one of the whole-chromosome entries, but offers links to both the current chromosome entry and the obsolete contig entry.
At present this is not possible; all advanced search results are ordered alphabetically by gene name, or by systematic ID for unnamed genes, by default. Click the “Product” column header to sort alphabetically by product description. We plan to add an option to preserve input order soon.
In the meantime, we suggest that you download the results using the “Details” link, and import them into a spreadsheet. You can then combine the results with other data in the spreadsheet, and use the spreadsheet software to sort on any column.
Yes, use the “Taxonomic conservation” query in the advanced search.
Example query:
A selection of protein sequence motifs and features have been manually curated using terms from the Sequence Ontology (SO). For example, Rad54 has a KEN box (a motif recognized by the anaphase-promoting complex; SO:0001807), and Cuf1 and Trz1 have nuclear localization signals (NLS; SO:0001528). These annotations are included in the Protein Features section of the gene page.
To search for these features, use the “Protein feature” query in the advanced search (enter a SO ID or description; see the documentation for help with searching).
Also see the FAQs on transmembrane domains and protein families, and the section of the search documentation on protein feature and protein domain queries.
Example query:
Yes. In the advanced search, each results page has a stable, unique URL that you can bookmark, copy/paste, and share. Anyone who follows a shared link will see the same results page, and the query will be added to their query history.
The “Visualise” and “Slim” options also generate stable, unique, sharable URLs, and QuiLT visualisations have the stable URLs no matter how you reach the QuiLT page.
PomBase does not maintain a BLAST server, but the BLAST tools available at NCBI and Ensembl allow a target species genome to be selected.
Note, however, that we recommend alternate approaches for some search purposes, especially for proteins:
Also see other FAQs in the Orthology category and the Ortholog curation documentation.
Yes, you can search for short nucleotide sequences, such as primers or other oligomers. We recommend NCBI BLAST, where you can search for short nucleotide sequences, such as primers or other oligomers (PomBase does not maintain its own BLAST server).
For short peptide sequences, we recommend the PomBase peptide motif search.
The simple search finds search strings anywhere in IDs, gene names, and product descriptions. It does not require any wildcard character, and shows autocomplete suggestions as you type.
Yes, if you have locally stored data that you want to see in the context of the genome browser, you can add it as a custom track. In the Track menu, select “Open track file or URL”, and enter the location in the popup.
PomBase does not have its own alignment viewer. DIOPT, Compara, and PANTHER, three of the tools we recommend for finding orthologs, have alignment display options. See the FAQ on orthologs in other species for more information.
Yes. First, make sure the DNA sequence track is enabled (see the FAQ on showing tracks if necessary).
Then simply zoom in until sequence appears. The graphic will first display colored blocks representing color-coded nucleotides, and then legible sequence.
At any zoom level, use the arrows to scroll along the sequence.
See this FAQ to display a sequence region using coordinates. For more information on downloading sequence, see the PomBase JBrowse guide.
The PomBase genome browser includes variation data from natural S. pombe isolates, published in:
Jeffares DC et al. 2015. The genomic and phenotypic diversity of Schizosaccharomyces pombe. Nat Genet. 47(3):235-241. doi: 10.1038/ng.3215 PMID:25665008
To view the variation data, enable one or more of the tracks under “Variation” (see the FAQ on showing tracks if necessary). Insertions/deletions (indels) and SNPs can be enabled as separate tracks.
Clicking on any variation feature in either the track brings up a pop-up box with further details about the variation.
This is an area of active development at PomBase. At present, PomBase links GO terms to the web-based network tool esyN 1: on the GO biological process slim page and on ontology term pages for GO biological process slim terms, each GO slim term links to the HCPIN physical interaction network in esyN. For example, the GO process slim page and the ontology term page for “regulation of mitotic cell cycle phase transition” (GO:1901990) link to http://www.esyn.org//builder.php?type=Graph&term=GO:1901990&interactionType=physical&source=pombase&includeInteractors=false.
We plan to provide gene-centred network displays on gene pages in the near future.
Using the esyN network display:
You can also use EsyN to:
Visualize interactions for a user-defined list of genes. To do this, visit http://www.esyn.org/builder.php?type=Graph, click on the “Network from list” option in the left-hand panel, and follow the instructions in the pop-up.
Build your own network – either an Interactome graph or a Petri net – from scratch (see the tutorial at http://www.esyn.org/tutorial.html). In both cases you can use the Advanced Tools to retrieve the interactions for a number of model organisms from several databases (see http://www.esyn.org/builder.php?type=Graph#interactions).
Save and share your networks. By logging in via the “My esyN” link (at the top of every esyN page), any user can save, share privately with collaborators, or publish any network.
Browse, view and modify, previously published, models (both graphs and Petri nets) at http://www.esyn.org/browse.php. We describe these networks are “public” in the sense of the open source movement, so that they are not only free to be copied, modified and (when possible) re-published, but we also actively encourage any collaborative effort to build and improve these biological networks.
1esyN reference: Bean DM, Heimbach J, Ficorella L, Micklem G, Oliver SG, Favrin G. 2014. esyN: network building, sharing and publishing. PLoS One. 2014 Sep 2; 9(9):e106035. doi: 10.1371/journal.pone.0106035. eCollection 2014. PMID:25181461
Note: Links from PomBase web pages use HTTPS for downloads, but if you have a link containing “ftp”, and your browser supports FTP, this information is relevant:
You do not need a password to download anything from the PomBase FTP site. In some web browsers, clicking a link to an FTP directory takes you to a page listing the contents, and clicking a file link produces a dialog box asking whether to open or save the file. Other browsers require a separate connection step:
If your browser asks “Do you want to allow this page to …?”, answer “yes” or “allow”.
If you’re prompted to “connect as guest or registered user”, select “guest”.
You should then be able to connect and download files (note: we have observed that this step can be sensitive to slow network connections).
If these steps don’t work, please let us know via the Helpdesk, and we will try to assist you.
Fission yeast polyadenylation data are available in the genome browser. To display the data, enable one or more of the tracks with the data type “Poly(A) sites”.
Help with configuring browser tracks is available.
We have received occasional reports of problems with access to Canto, apparently due to firewall issues, especially from users in China. If you have any trouble, we have some suggestions relayed from affected colleagues:
If none of these solve your problems, or if you have any other suggestions, please contact the PomBase helpdesk.
As described in detail in this online tutorial (external link) provided by the Nielsen lab, S. pombe switch between the two mating types M and P.
Genetic information encoded by the mat1 locus determines the mating type: if this locus contains the Pc and Pi genes, the cell is mating type P, and if it contains the Mc and Mi genes the cell is mating type M. Additionally, S. pombe contains two silent loci: mat2 and mat3. These loci are not expressed but host the information needed for each mating type configuration. Mat2 contains the two genes Pc and Pi, and Mat3 contains the two genes Mc and Mi. Recombinational DNA repair during mitotic cell division ensures production of one daughter cell of parental mating type and one daughter of the opposite mating type.
A wild type S. pombe cell thus contains 6 mating type specific genes: 1. mat1-P/Mc - expressed 2. mat1-P/Mi - expressed 3. mat2-Pc - silent 4. mat2-Pi - silent 5. mat3-Mc - silent 6. mat3-Mi - silent
The sequenced S. pombe reference strain (972 h-) is in the M mating type configuration (encodes the Mc and Mi genes at the mat1 locus). The mat2 genes are deleted in this strain for technical reasons, whereas the mat3 genes are intact.
The DNA seqence of the WT silent mating type region containing the mat2 and mat3 genes was reconstructed yielding an extra mating type region contig (see ‘current genome’ link). Only the P genes from this contig have gene pages in PomBase.
The systematic IDs and contig source of the mating type specific genes are: 1. mat1-Mc - SPBC23G7.09 (from the chromosome 2 contig) 2. mat1-Mi - SPBC23G7.17c (from the chromosome 2 contig) 3. mat2-Pc - SPMTR.01 (from the mating type contig) 4. mat2-Pi - SPMTR.02 (from the mating type contig) 5. mat3-Mc - SPBC1711.02 (from the chromosome 2 contig) 6. mat3-Mi - SPBC1711.01c (from the chromosome 2 contig)
The duplicate M genes without gene pages are: 7. mat3-Mc - SPMTR.04 (extra copy from the mating type contig) 8. mat3-Mi - SPMTR.03 (extra copy from the mating type contig)
For the M specific genes, functional annotation (GO, phenotypes…) is attached to the mat1-Mc and mat1-Mi genes. For the P specific genes, functional annotation is attached to mat2-Pc and mat2-Pi out of necessity (the reference strain is in the M configuration).
Most non-coding RNAs in PomBase are based on transcriptome data, either from Jürg Bähler’s lab (Solexa/deep sequencing; PMID:18488015) or Nick Rhind’s lab (RNA sequencing; PMID:21511999). For any ncRNA, the source should be linked as a publication in the “Literature” section at the bottom of the PomBase gene page. To get an idea of the transcription in a region, you can look at the Bähler Lab Transcriptome Viewer, which is linked from most gene pages, e.g. SPNCRNA.200. Unfortunately some genes, such as SPNCRNA.1115, post-date the viewer and therefore do not have entries, but you can look at transcription in this region by finding a neighboring gene.
Systematic IDs follow patterns based on the feature type, and in some cases the chromosome, as shown in the table below.
Open reading frame (ORF) IDs also indicate which cosmid or plasmid they were found on in genome sequencing. In most cases, ORF IDs that end with a digit indicate that the ORF is on the forward (Watson) strand, and an ORF with an ID that ends with ‘c’ is on the reverse (Crick) stand. There are a few exceptions, however, because some cosmids were moved and their orientation reversed late in the sequence assembly procedure.
IDs with ‘.1’ appended are transcript IDs; the dot-and-digit IDs follow Ensembl’s standard. If any given feature has alternative transcripts annotated, the digit will be incremented (.2, .3, etc.).
Systematic ID patterns
| ID pattern | Description |
|---|---|
| SPAC* | features, usually ORFs, on chromosome 1, sequenced on cosmids |
| SPBC* | features, usually ORFs, on chromosome 2, sequenced on cosmids |
| SPCC* | features, usually ORFs, on chromosome 3, sequenced on cosmids |
| SPAP* | features, usually ORFs, on chromosome 1, sequenced on plasmids |
| SPBP* | features, usually ORFs, on chromosome 2, sequenced on plasmids |
| SBCP* | features, usually ORFs, on chromosome 3, sequenced on plasmids |
| SPATRNA* | tRNA genes on chromosome 1 |
| SPBTRNA* | tRNA genes on chromosome 2 |
| SPCTRNA* | tRNA genes on chromosome 3 |
| SPLTRA* | LTRs on chromosome 1 |
| SPLTRB* | LTRs on chromosome 2 |
| SPLTRC* | LTRs on chromosome 3 |
| SPNCRNA* | non-coding RNA genes (no chromosome info in ID) |
| SPRPTA.* | repeats (other than LTRs or centromeric repeats) on chromosome 1 |
| SPRPTB.* | repeats (other than LTRs or centromeric repeats) on chromosome 2 |
| SPRPTC.* | repeats (other than LTRs or centromeric repeats) on chromosome 3 |
| SPRPTCENA* | centromeric repeats on chromosome 1 |
| SPRPTCENB* | centromeric repeats on chromosome 2 |
| SPRPTCENC* | centromeric repeats on chromosome 3 |
| SPRRNA* | rRNA genes (no chromosome info in ID) |
| SPSNORNA* | snoRNA genes (no chromosome info in ID) |
| SPSNRNA* | snRNA genes (no chromosome info in ID) |
| SPTF* | transposons (no chromosome info in ID) |
| SPMTR* | features on the separately sequenced mating type region contig |
| SPMIT* | features on the mitochondrial chromosome |
| SPMITTRNA* | subset of SPMIT*; tRNA genes on mitochondrial chromosome |
| SPNUMT* | NUMTs (nuclear mitochondrial pseudogenes) (no chromosome info in ID) |
S. pombe genome features were originally annotated using Artemis. As noted in the manual (ftp://ftp.sanger.ac.uk/pub/resources/software/artemis/artemis.pdf - see p. 9), Artemis draws from a list of feature keys that is documented at EBI: (ftp://ftp.ebi.ac.uk/pub/databases/embl/doc/FT\_current.html\#7.2\)
In the genome sequence data files, features are defined using Sequence Ontology terms. Gene pages use a selection of human-friendly text descriptions for feature types.
In the future, we plan to make Fission Yeast Phenotype Ontology (FYPO) terms and annotations available in a browser analogous to AmiGO or QuickGO. Until such a browser becomes available, FYPO is accessible in these external resources:
NCBO BioPortal - search on the BioPortal home page, go to the FYPO summary page, or go to the FYPO terms page. For assistance, see the “User Interface” part of the BioPortal Help.
EBI’s Ontology Lookup Service (OLS) - search on the OLS home page or go to the FYPO page. Help is provided on each page.
Go to the genome browser, and enter coordinates in the location box. The format is ‘I:100000..200000’ (i.e. use Roman numerals to specify the chromosome, and don’t include the word “chromosome”; use ‘..’ between the start and end coordinates.)
You can also choose a chromosome from the pulldown, and enter just the numbers specifying position in the location box.
To see the DNA sequence, see this FAQ. For more information on downloading sequence, see the PomBase JBrowse guide.
You can search for genes annotated to a Fission Yeast Phenotype Ontology term in the advanced search. In the “Phenotype” query, if you know the ID (for example, “inviable cell” is FYPO:0000049, and “elongated cell” is FYPO:0000017) you can type or paste the ID into the box. Otherwise, start typing a term name or description; the autocomplete feature will suggest phenotypes. Choose one to retrieve annotated genes.
Note that the FYPO search retrieves annotations by following the is_a, part_of, output_of, has_output, and has_part relationships in the ontology. For example, FYPO includes the relation “inviable swollen elongated cell with enlarged nucleus” (FYPO:0002083) has_part “swollen cell” (FYPO:0000025). Genes annotated to FYPO:0002083 will therefore be retrieved in a search for FYPO:0000025. See the advanced search documentation for more information.
Example query:
Also see the FAQ on finding essential genes.
Almost all genes that are conserved between fission yeast and human are also conserved in other vertebrates (there are two exceptions, both of which are genes encoding amino acid biosynthesis proteins that have become pseudogenes in human). To retreive these genes, go to the advanced search, click the “Taxonomic conservation” query option, and choose the description “Conserved in vertebrates”.
Also see the FAQs on finding disease gene orthologs, finding the ortholog of a specific gene, and on downloading the full set of curated orthologs.
Query link:
There are various ways you can find protein family members or domains.
Example query:
You can do this in the genome browser (or follow a link from a gene page). First enter the coordinates.
Ensure that the PomBase forward and reverse strand feature tracks are visible (they are enabled by default). For each strand, click the small triangle at the right-hand end of the track label to reveal the popup menu. Select “Save track data”, then choose from the options in the popup.
You can also use the advanced search to retrieve genes in a region, but at present other sequence feature types are not included. Use the “Genome location” query. First, select a chromosome in the pulldown. You can then either add start and end coordinates to specify a region, or leave the “Restrict to region” boxes blank to retrieve all genes on the chromosome.
To retrieve genes in a region in the advanced search, use the “Genome location” query. First, select a chromosome in the pulldown. You can then either add start and end coordinates to specify a region, or leave the “Restrict to region” boxes blank to retrieve all genes on the chromosome.
You can also use the genome browser to find all features (not only genes), as described here.
Example query:
PomBase uses Gene Ontology (GO) molecular function terms to capture the activities – including enzymatic activities, binding, transporters, etc. – of gene products. You can therefore use the GO term query in the advanced search to retrieve genes whose products have a given activity.
In the “GO” query, if you know the ID (for example, “histone acetyltransferase activity” is GO:0004402, and “calcium ion transmembrane transporter activity” is GO:0015085), type or paste it into the box. Otherwise, and start typing a name or description; the autocomplete feature will suggest terms. Choose one to retrieve annotated genes. You can try using more specific or less specific terms to retrieve the results that best fit your expectations and needs. See the advanced search documentation and the Gene Page GO documentation for more information, including how [ontology searches retrieve annotations] to general terms.
Example query:
The PomBase genome browser includes a dataset of intron branch sites as a track. Follow this link to view the data.
The data were published in: Bitton DA et al. (2014), PMID:24709818; DOI:10.1101/gr.166819.113
Protein modifications (where curated) are included in the Modifications section on gene pages. (We plan to include RNA modifications later.) The gene page modifications documentation describes the display.
To retrieve all genes whose products have a given modification, use the “Protein modifications” query in the [Advanced Search]. If you know the ID (for example, “phosphorylated residue” is MOD:00696), type or paste it into the box. Otherwise, start typing a name or description; the autocomplete feature will suggest terms. Choose one to retrieve annotated genes. See the advanced search documentation for more information, including how ontology searches retrieve annotations to general terms.
Example query:
There is also an ontology term page for each modification term used to annotate S. pombe proteins, e.g. MOD:00696.
In FYPO, terms for increased chemical sensitivity are grouped under increased sensitivity to chemical (FYPO:0002683). Similarly, decreased chemical sensitivity (increased resistance) terms are grouped under increased resistance to chemical (FYPO:0002682).
The ontology term pages for each term shows more specific terms, most of which identify specific chemicals (e.g. sensitive to hydroxyurea (FYPO:000088), and the genotypes annotated to them.
In any phenotype annotation display (on gene pages, ontology term pages, or publication pages), phenotype annotations can be filtered to show only “sensitive to chemical” annotations.
You can also use the advanced search Phenotype query to search for
In the advanced search, you can use the “Proteins with S. japonicus orthologs” item under “Commonly used queries”
For any other Schizosaccharomyces species, we suggest:
On a gene-by-gene basis, you can use the Ensembl genome browser link to reach Fungal Compara as described in the FAQ on orthologs in other species.
For a full set of orthologous genes in S. pombe, S. cryophilus, S.japonicus and S. octosporus, see Table S12, columns AD-AG, in Rhind et al. Comparative functional genomics of the fission yeasts (PMID:21511999).
Gene Ontology (GO) cellular component annotations capture the localizations of gene products to subcellular structures such as organelles or complexes. GO Cellular Component annotations are displayed on PomBase gene pages as described in the PomBase GO documentation. The GO Consortium’ ontology overview describes what the Cellular Component ontology includes. To search for proteins (or functional RNAs) with a particular localization, use the GO query in the advanced search to find genes annotated to the relevant GO Cellular Component term(s).
PomBase GO Cellular Component annotations include data from the whole-genome localization study (Matsuyama et al. 2006) as well as manually curated data from papers on small-scale experiments, and inferences from ortholog annotations. Macromolecular complex annotations are also available in a file (see FAQ).
Example query:
In the advanced search, use the “Number of TM domains” query. Enter the minimum and maximum number of domains (use the same number as minimum and maximum to retrieve proteins with, e.g. exactly 7 transmembrane domains).
Example query:
In the advanced search, click “Product type”, then select “rRNA” from the pulldown.
Also see the FAQ on rDNA sequences.
Query:
S. pombe genes whose human orthologs have been implicated in disease are annotated with terms from the Monarch Disease Ontology. To retrieve all of these genes, you can use the most general “disease” term in a query. In the advanced search, select “Disease”, and copy or paste the ID “MONDO:0000001”.
Also see the FAQs on finding genes conserved in human, finding the ortholog of a specific gene, and on downloading the full set of curated orthologs.
Example queries:
If there is complementation data available for an S. pombe gene, it will be displayed in the Complementation section of the gene page. For example, ura3 can be complemented by S. cerevisiae URA1, and itself complements human DHODH.
In PomBase, human orthologs are curated for S. pombe genes as described in the Orthologs documentation.
To find S. pombe orthologs for a human gene, you can search for the standard human gene name in the simple search box in the page header. For example, searching for human ABTB1 will retrieve the S. pombe gene btb3. To find standard human gene names, you can search HGNC. Note that in a few cases, a human gene name will coincidentally match a name or synonym of a non-orthologous S. pombe gene as well as the actual curated ortholog(s), so please check the gene pages carefully, especially if your search retrieves more than one result.
Also see the FAQs on on finding genes conserved in human, finding disease gene orthologs, and on downloading the full set of curated orthologs. You may also find the FAQ on orthologs in other species useful.
For orthologs that are not manually curated by PomBase, we suggest a few approaches:
DIOPT
From any gene page, follow the link to DIOPT (in the Orthologs section and under External References).
The Drosophila RNAi Screening Center Integrative Ortholog Prediction Tool (DIOPT) is a web-based tool that integrates several orthology prediction tools to identify orthologous proteins for nine species (Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Homo sapiens, Mus musculus, Rattus norvegicus, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Xenopus tropicalis).
PANTHER
The PANTHER (Protein ANalysis THrough Evolutionary Relationships) Classification System classifies proteins (and their genes) according to family and subfamily, molecular function, biological process, and pathway.
From any gene page, follow the link to PANTHER (in the Orthologs section and under External References). The linked page includes a list of orthologs, and links to phylogenetic tree views that can also display alignments. Help is available.
Compara
You can search for orthologs/paralogs in Fungi, or in a pan-taxonomic comparison (eukaryotes), using Compara in the Ensembl browser.
On any gene page, follow the link to the Ensembl genome browser under Orthologs or External References.
Click the “Gene:” tab to show Compara links in the left-hand margin - for fungal alignments, choose “Fungal Compara”, or for all eukaryotic species choose “Pan-taxonomic Compara”.
You should see a “collapsed” gene tree highlighting your fission yeast gene of interest. From here you can click on any node to see a menu of options:
To configure the protein entries visible in the alignment, select the most “inclusive” node you require. You can reduce the number of entries by collapsing individual sub-trees before you generate your alignment.
Information about how the Compara trees are generated, homology types, and species is available from the Ensembl comparative genomics documentation.
PSI-BLAST
To search for putative orthologs not fund in DIOPT or Compara, we recomment PSI-BLAST (Position-Specific Iterated BLAST) at NCBI or EBI. As described in the NCBI tutorial, PSI-BLAST derives a position-specific scoring matrix (PSSM) or profile from the multiple sequence alignment of sequences detected above a given score threshold using protein–protein BLAST.
FYPO enrichment analysis is analogous to GO term enrichment, using phenotypes rather than GO annotations, i.e. analysing a gene list by finding FYPO terms that are significantly over- or under-represented among the annotations for the genes.
At present, PomBase does not have its own FYPO enrichment tool, and very few ontology enrichment tools can use phenotype data. One that does is AnGeLi, produced by Jürg Bähler’s lab.
GO term enrichment identifies GO terms that are significantly overrepresented (or underrepresented) among a set of genes.
At present PomBase does not have its own GO enrichment tool. We recommend using the Generic GO Term Finder at Princeton, because it offers a simple interface and up-to-date ontology and annotation data, including the current PomBase GO annotation dataset (you can upload your own background set, GO annotation file, or both). The results are provided in an tabular format. You can also use the GO Term Finder to retrieve all annotations for your gene list by setting the p-value to 1.
Before you perform an enrichment analysis, we recommend that you do a GO slim analysis of your gene list, for a broad overview of the annotation set (for more information, see the Fission Yeast GO slim documentation page and FAQ). This will enable you to focus on. the most important terms in your enrichment.
You can slim your gene lists for any GO aspect (MF, BP or CC) using the PomBase “Advanced search”:
A few other enrichment tools are described on the GO Consortium’s GO Enrichment Analysis page. If you choose one of these, we recommend that you only use an enrichment tool that allows you to upload a background set representing the genes used in your experiment. Even if you regard the whole genome as the relevant background, it is important to specify the background gene set explicitly to obtain meaningful results, especially if you have data only for protein-coding genes. For example, annotated tRNA genes can obscure enrichment of protein-coding genes annotated to translation.
For any GO analysis, we strongly recommend that you describe your approach fully in methods, and include the release details (number and/or date) for PomBase and the GO terms and annotations you use.
In the advanced search, click “Product type”, then select “snoRNA” from the pulldown.
Note that there are likely a number of snoRNAs that have not yet been identified and annotated in S. pombe; we hope to investigate further in the future.
Query:
There is a data track available for transcription factor binding sites in the genome browser. To enable the track, follow the instructions for showing tracks, and filter on the data type “Promoters”, or use this link:
Transcription factor binding sites in JBrowse
Also see the FAQ on finding transcription factors.
All sequence-specific DNA-binding transcription factors should be annotated to at least two GO Molecular Function terms, either directly or by transitivity (i.e. annotated to a more specific “descendant” term linked to one of these terms):
Annotation extensions are used to capture two types of “target” data (where available):
Because it is not yet possible to query annotation extensions in the PomBase advanced search, to identify target genes you must either inspect transcription factor gene pages manually, or search the GO annotation dataset. For the latter:
Finally, note that not all S. pombe transcription factors have been extensively characterised with respect to target genes, and for those that have, target curation in PomBase may be incomplete. You may therefore wish to query for transcription factors that have been have been experimentally characterised, and therefore might have targets which are not yet curated. To do so, use the Advanced Search to find which of the genes annotated to the transcription factor-related GO terms above have the annotation status “published” (e.g. GO ID “GO:0000978” AND Annotation Status “published”; see the advanced search documentation for more tips on setting up the query).
Query links:
In the advanced search, click “Characterisation status”, then select “transposon” from the pulldown.
At present, there are 11 full-length transposons annotated, and two frameshifted copies.
Query link:
Lone LTRs are also annotated as sequence features. They cannot yet be retrieved by the simple or advanced searches, but they are included in the forward and reverse strand sequence feature tracks in the genome browser.
Finally, if you wish to install Artemis (available from The Sanger Institute Artemis page; for S. pombe we recommend using Artemis Version 16), you can use it to view LTRs in more detail. Read in the EMBL format files of sequence and annotation (available from the Genome sequences page). To see LTRs,
See the Artemis FAQ and the Artemis manual (pdf; Sanger site) for additional information.
Please enquire with the Sanger Institute archives@sanger.ac.uk about clones included in the final genome sequence.
The best route depends on the amount and type of data you have.
You can do both Canto curation and large-scale data submission for a single publication, if it reports both large- and small-scale experimental results.
For any data types not listed above, or if you have any questions, please contact the PomBase helpdesk.
The best way to find genes that have any effect on a process, we recommend searching for both GO and FYPO terms relevant to the process.
As described in the FAQ on GO and FYPO annotations, PomBase curators annotate all genes with phenotypes that affect a process, whereas GO annotations are restricted to genes whose products act directly in a process or its regulation. By querying for genes annotated to either a GO term or a FYPO term, you can find genes with relevant phenotypes (including “downstream effects”) as well as genes involved in a process (with or without mutant phenotypes affecting the process).
Use the union (OR operator) button in the PomBase advanced search, available in the query history, as described in the advanced search documentation. For example, to find genes that affect cellular respiration, search for “FYPO:0000078 (abnormal cellular respiration)”; search for “GO:0045333 (cellular respiration)”; and then combine them in a third query. For any process, you can try using more specific or less specific terms to retrieve the results that best fit your expectations and needs.
Example query:
The pombe Slack account is separate from PomBase and pombelist, and not run by PomBase staff. To join, email one of the pombe Slack admins (Gautam Dey, EMBL, Mary Elting, NCSU, Maitreyi Das, University of Tennessee).
Centromeres can be retrieved in the PomBase genome browser; the coordinates are:
Chromosome I: 3753687-3789421 Chromosome II: 1602264-1644747 Chromosome III: 1070904-1137003
Sequence features within the centromeres, such as repeats, are annotated with Sequence Ontology terms. For more details, see the Centromeres page.
Browse for Chromosome II:2129208-2137121, and see the Mating type region page.
The mating type region will soon be annotated as a feature, and refer to a Sequence Ontology term.
The current S. pombe genome assembly does not include the complete telomeric regions or the telomeric short repeats. These omissions are beyond the control of PomBase curators. Subtelomeric repeats are also not explicitly defined at present, although we hope to provide this information in the future. Additional information about S. pombe telomeres is available at on the Telomeres page.
The current version of the manually curated list of orthologs and orthologous groups identified between fission yeast and human is available for download from the orthologs FTP directory (linked from the Datasets page).
Also see the FAQs on finding genes conserved in human, finding disease gene orthologs, and finding the ortholog of a specific gene.
The Names and identifiers page provides lists of all genes, including non-coding RNA genes. The gene_IDs_names.tsv file contains the systematic IDs and names for both protein-coding and non-coding RNA genes, whereas two separate files are available that also include product descriptions.
The advanced search includes a query that retrieves all protein-coding genes at once, as decribed in this FAQ.
This query retrieves genes of all types (protein-coding, non-coding RNA, and pseudogenes) by combining the “product type” options with the OR operator:
The advanced search includes a query that retrieves all protein-coding genes at once. Click “Canned queries”, then click “All protein coding genes (ex. dubious and transposon)”.
Further explanation: All protein coding genes have the type “protein coding”, but this type also includes a few transposon genes and several genes that are dubious (i.e. predicted by automated methods considered unlikely to actually encode protein), which you will presumably want to exclude from the set. The canned query does this.
Query link:
You can retrieve sequences from a gene page or in the genome browser, although flanking sequences are only available from gene pages at present.
On the gene page: Scroll down or click the left-hand menu link to the Sequence section of the page, where a DNA sequence is displayed by default. For protein-coding genes, the CDS is shown, and you can click boxes to add the sequences of any annotated introns or 5’ or 3’ UTRs. To include flanking sequences, enter a number of nucleotides in the “upstream” and/or “downstream” boxes. Only applicable options appear for non-coding RNA genes. The “Download sequence” button saves a FASTA file with your selection.
To use the Genome Browser: Click the “View in JBrowse” link under the map graphic on a gene page. In the browser, click on any feature to show a popup with details, including the sequence. Use controls in the popup to save FASTA sequence.
To retrieve flanking regions for more than one gene at a time, see this FAQ.
Downloadable intron datasets are available in FASTA format from the Intron Data page.
You can also find genes with introns using the PomBase advanced search. To find all genes with introns, search for genes with a specified number of exons, and use the range 2 (i.e. at least one intron) to 20 (more than the maximum known, 16 introns). You can also restrict the search to protein-coding genes. Note that the PomBase count includes introns in UTRs.
Instructions for searching PomBase
Click on a count in the query history to see the results, with a button for “Download” options including coordinates and sequence.
Also see the FAQ on finding sequence features in a region.
Query link:
Available options:
Download one of the files available via the Genome Datasets page. The GFF3 files contain coordinates, and you can parse the files for the feature type you need. For example, to find all non-coding RNAs, search for “ncRNA_gene”; for coding sequences, use “CDS”, etc. There are also separate files available for CDS and UTR data.
If you only need genes, you can use the advanced search to find all genes of a given type. (Note that non-gene features such as repeats cannot be retrieved by this method.) Select the “Product type” query, then choose a type from the pulldown menu. The “Download” options include coordinates and sequences in FASTA format. If you need more than one feature type, query for each type and then use Query Management to combine the individual queries with the “Union” (OR operator) button. See the advanced search documentation for more information. Click on a count in the query history to see the results, with a button for “Download” options including coordinates and sequence.
The bioinformatically inclined can also use the Ensembl Genomes REST API to retrieve transcript feature coordinates, as described in the FAQ on pombe transcriptome sequences. Select the desired feature type(s) from the output file of stable IDs (bear in mind that Ensembl idiosyncratically uses “biotype” to mean feature type). Note, however, that EG is updated much less frequently than PomBase, so EG data will rarely be as up-to-date as the PomBase web site. Documentation is available:
Query:
Go to the genome browser, and make sure the DNA sequence track is enabled (see the FAQ on showing tracks if necessary). Enter region coordinates (as described in this FAQ).
In the “DNA sequence” track label, click on the small triangle at the right-hand end of the label box to reveal the popup menu, then select “Save track data”.
You can customize the headers for FASTA files of downloaded results from the advanced search (i.e. for any list of genes). The Download dialog offers several options for items to include in the headers. See the advanced search documentation for more information.
A file of all non-coding RNA gene sequences is available on the Genome sequences page.
If you need sequences for all genes of a single type (tRNAs, rRNAs, other ncRNAs, etc.) we recommend using the advanced search and results download as described in the FAQ on retrieving sequence coordinates for all features of a particular type.
Transcript start and end coordinates from all sources will be available as individual data tracks in the genome browser in the near future, which will allow you to view, evaluate and download them. We also provide downloadable UTR data sets that are updated periodically, available on the Genome sequence and features page.
Also see the precedence criteria used to choose default UTR features to display on gene pages.
To retrieve UTRs for a specified list of genes, see the FAQ on downloading sequences for multiple genes (choose 5’ UTR and/or 3’ UTR in the popup).
The advanced search GO query retrieves gene products annotated to a GO term and to any of its child terms, following the is_a, part_of, and regulates relationships in the ontology (also see the PomBase GO documentation. GO search results for Biological Process terms therefore include genes involved in the process and its regulation.
Genes annotated directly to the process can be distinguished from those annotated to regulation on the ontology term page for the term.
You can search for GO terms by name or ID in the PomBase advanced search, and retrieve a list of all genes annotated to the term and its descendants via the relations is_a, part_of, regulates, positively_regulates, and negatively_regulates. For example, a search for “cytokinesis” will include genes annotated to “regulation of cytokinesis”. (See the GO documentation on Ontology Structure and Ontology Relations for more information.)
S. pombe GO annotations are also available in browsers that use the GO repository, notably AmiGO and QuickGO. Both browsers have extensive documentation available:
Hint: to find S. pombe annotations, use Organism: Schizosaccharomyces pombe, Taxon: 4896 (Schizosaccharomyces pombe) or Source: PomBase. You can download the results in GAF format.
In PomBase, GO term names and IDs on gene pages link to ontology term pages for GO terms, which in turn offer links to AmiGO, QuickGO and BioPortal.
In PomBase, S. cerevisiae orthologs are curated for S. pombe genes as described in the Orthologs documentation.
To find S. pombe orthologs for a budding yeast gene, you can search for the systematic name (ORF name) or the SGD ID (e.g. SGD:S000001123) of the S. cerevisiae gene in the simple search box in the page header. For example, S. cerevisiae LRP1 has the systematic name YHR081W, and a search on this in PomBase will retrieve the S. pombe gene cti1. Note that only systematic names or SGD IDs can be searched for S. cerevisiae, to avoid confusion in cases where unrelated genes coincidentally have the same name in S. pombe and S. cerevisiae. To find systematic names of S. cerevisiae genes, you can search SGD.
Also see the FAQ on downloading the full set of orthologs.
At present there are two ways to view nucleotide-level similarity between any pair of Schizosaccharomyces species S. pombe, S. japonicus, S. octosporus, S. cryophilus). Both use the genome browser at the Ensembl Fungi site.
In JBrowse, click the “Select tracks” box in the upper left corner to display the list of available tracks. The list can be filtered using the items in the left-hand column, or searched. Tick boxes to enable tracks, then click the “Back to browser” button.
PomBase welcomes large sets of published data. The recommended submission route depends on the data type:
If you have any other type of large-scale data – or if you have problems or questions regarding the available submission forms – please contact the helpdesk.
The Fission Yeast GO slim pages provide generic GO slims for S. pombe, and show total genes annotated to each term directly or to any of its descendants.
If you want GO slim annotations for your own list of S. pombe genes, use the advanced search “Gene names and IDs” option, and then use the “Slim” button on the search results page. See the advanced search documentation for more information.
If you want to use a different slim, we recommend using the GO Term Mapper at Princeton. Upload your list of genes, and select “Schizosaccharomyces pombe (PomBase)” in the Organism pulldown. For the slim, select one of the radio buttons, or scroll down to Advanced Options to choose GO terms to make up a custom slim. GO Term Mapper’s interface and documentation should make the rest straightforward, but let PomBase staff know if you have any problems.
For further information on using the generic S. pombe slims, or on creating your own GO slim, please see the Fission Yeast GO slimming tips page.
Click the downarrow to the right of the track label and click on ‘edit config’. Define a max_score and/or a min score by typing e.g.
“max_score”: “200”,
within the curly brackets.
More wiggle track configuration option in the official JBrowse documentation
See the Citing PomBase page, which lists papers to cite for PomBase, the S. pombe genome sequence, Canto, FYPO, annotations and Compara. Additional key papers may be added as needed.
Specific modified residues is not a download option from the query builder. If you want build a table of all residues with a specific modification, download the table in the modifications data directory, and filter for your modification of interest. The column descriptions are in the README.
This dataset includes all high throughput and low throughput curated data. Note that some older datasets have no residue information.
See also: How can I find modifications for my protein of interest?
To join or leave pombelist, go to the list management page:
https://lists.cam.ac.uk/sympa/info/ucam-pombelist
To join, click “Subscribe” in the left-hand menu, and follow the instructions on the page.
An “Unsubscribe” link is also available in the left-hand menu.
If you want to change the email address you use for pombelist, go to the upper right corner to log in, and then (still in the upper right corner), hover over your name to reveal a menu. Select “My preferences” to see options including a field for a new email address.
The current version of the manually curated list of orthologs and orthologous groups identified between fission and budding yeast is available for download from the orthologs FTP directory (linked from the Datasets page).
5’UTRs were created using Transcription Start Sites (TSS) data (in vegetative growth / minimal media) from the Deep CAGE data provided by Thodberg et al.. Transcription start sites are heterogeneous, we selected the major peak, and in cases of multiple potential start sites, the major cluster from the major TSS peak to create canonical 5’UTR features. Therefore, with the exception of a small number of curated isoforms only genes expressed during vegetative growth will currently have 5’UTRs. To inspect meiotic 5’UTRs please refer to the extensive RNA-seq or TSS datasets hosted in the genome browser.
3’ UTR features use four data sources and a set of precedence criteria:
More information is available in the descriptions of two HTP datasets originally sent to pombelist: - Broad email - Lanterman/Dutrow email
Transcript start and end coordinates from all sources will be available as individual data tracks in the genome browser in the near future, which will allow you to view and evaluate them. PomBase will also curate splice and transcript variants as data become available.
Note: exon and CDS coordinates are available in the Transcript section on PomBase gene pages.
As genes are annotated, each is assigned a status, as described on the Gene characterisation status page. Taxonomic conservation of a gene is assigned manually on a case-by-case basis, taking into account multiple criteria. Additional information is available from PomBase curators upon request.
Genes listed on the Priority unstudied genes page are those that have “conserved unknown” characterisation status and the “conserved in vertebrates” taxonomic distribution.
You can also use the advanced search to find conserved unstudied genes as described in the FAQs on characterisation status and taxonomic conservation. Start by searching for Characterisation status “conserved unknown”, and refine the search by adding a Taxonomic conservation query if you wish.
We recommend using only the genome sequence, either from PomBase downloadable files or from the sequence retrieval tools on the gene pages and in the genome browser. Although there are some sequence updates still pending, the genome sequence is more accurate than individual gene sequences that predate the genome.
Many older S. pombe sequence submissions to the DNA databases (International Nucleotide Sequence Database Collaboration databases, i.e. ENA, GenBank, DDBJ) contain one or more errors (sometimes with an error rate as high as 20%), and we do not have the resources to maintain past sequences or flag every error in PomBase.
There is no single transcriptome sequence file available from PomBase at present. Several transcriptomic data sets are available as tracks in the PomBase genome browser. The GFF3 genome feature files available from the Genome Datasets page include the coordinates of the annotated full-length transcript features.
The bioinformatically inclined can also use the Ensembl Genomes REST API to retrieve transcript feature coordinates. (Note that, while the sequence has not changed recently, annotation data are likely to be out of date relative to the PomBase web site Ensembl Genomes is updated much less frequently than PomBase.) The FAQ on programmatic access to PomBase provides an introduction to using the API, some pombe-specific examples, and links to additional documentation.
The Broad Institute has archived genomic data files for the Schizosaccharomyces species, including transcript files.
The Ensembl Genomes REST API Endpoints page provides a REST-ful interface allows language-independent programmatic access to all genomes accessible through Ensembl Genomes, including the same Schizosaccharomyces pombe genome sequence data available in PomBase. (Note that, while the sequence has not changed recently, annotation data are likely to be out of date relative to the PomBase web site Ensembl Genomes is updated much less frequently than PomBase.) The REST interface provides data in a variety of formats including GFF3, FASTA and JSON. Data types accessible via this interface include:
In addition, the interface also provides access to the Variant Effect Predictor tool and a tool for mapping genomic coordinates between different versions of genome assemblies.
The user guide provides comprehensive descriptions of interface functionality, plus examples using a variety of languages and interfaces. The following URLs are examples specific to S. pombe:
The reference genome sequence excludes most of the ribosomal DNA (rDNA) repeats, which are present in two tandem arrays on chromosome III. These arrays are estimated to be 1225 kb and 240 kb in size for the sequenced strain (972 h-). The reference sequence includes two partial and one complete representative rDNA repeats:
The complete repeat sequence coordinates are Chromosome 3:5542-13722 (note that the reverse strand is transcribed). The link goes to the PomBase genome browser, where you can view and download the sequence. Because the reverse strand is transcribed, you may want to choose “-1” in the location settings.
Also see the FAQ on finding rRNA genes.
Unfortunately, the Java Applet technology has been depricated and is not supported by the major browsers.
We now use JBrowse and links to the Ensembl genome browser in place of the Artemis applet.
If you want to browse the S. pombe genome in Artemis on your laptop or desktop, it is free to download and run locally:
Once you have loaded the file(s), you can do many different things, e.g.:
The “Drugs with knowns S. pombe targets” page lists drugs that have been shown to affect S. pombe, with brief summaries of their targets.
If you notice any errors or omissions on this page, or can provide any supporting references, please email the helpdesk.
Yes, there is a file that lists GO macromolecular complex assignments for fission yeast gene products in the GO annotations directory:
https://www.pombase.org/data/annotations/Gene_ontology/GO_complexes/
Note that the complex inventory includes the RNA subunits of ribonucleoprotein complexes. There is some redundancy in the list, because some gene products are annotated to both complexes and subcomplexes. For example, three mcm genes are annotated to ‘MCM core complex’ (GO:0097373) as well as ‘MCM complex’ (GO:0042555). Additional notes are available in a README file: https://www.pombase.org/data/annotations/Gene_ontology/GO_complexes/README
Also see the FAQ on localization.
Annotation extensions can be used with annotations to terms from various ontologies, such as GO, FYPO, modifications, etc. Extensions provide additional specificity to the annotation by linking the term to another ontology term or a gene product via a relationship.
Extensions are most commonly used with GO annotations, where they can be used to capture details such as substrates of molecular functions or cell cycle phases during which a localization is observed. More information is available in the gene page GO annotation documentation.
The GO Consortium provides further information on annotation extensions in its file format guide, on a wiki page, and in publications from 2014 and 2017. PomBase converts many extension names to more human-friendly text, as described here.
Phenotype annotations using FYPO may have extensions that capture severity or penetrance, or identify a gene or gene product used in an assay, as described in the gene page phenotype documentation.
BAM is a binary file format used for nucleotide sequence alignment data.
The file format specification (PDF) is available from the SAMtools web site.
The UCSC Genome Bioinformatics FAQ and the Broad Institute file format guide provide additional information.
BED is a tab-delimited text format that defines a feature track for a genome browser.
BED format is described in the UCSC Genome Bioinformatics FAQ, and the Broad Institute file format guide provides additional information.
BedGraph is a file format that allows display of continuous-valued data in a track in genome browsers that support the format.
At present, JBrowse does not support bedGraph, so we cannot use data in this format for PomBase. If you have data in bedGraph format, we recommend converting to WIG or bigWig format.
BedGraph format is described at the UCSC Genome Bioinformatics web site, and the Broad Institute file format guide provides additional information.
BigBed is a binary file format that is created by conversion from BED, and thus stores similar types of data for display in a genome browser track.
BigBed format is described at the UCSC Genome Bioinformatics web site, and the Broad Institute file format guide provides additional information.
BigWig is a file format for display of dense, continuous data in a genome browser track, created by conversion from Wiggle (WIG) format.
BigWig format is described at the UCSC Genome Bioinformatics web site, and the Broad Institute file format guide provides additional information.
Each gene is assigned exactly one characterisation status that reflects how much is known about the gene, whether it is conserved, etc. Specific status descriptions:
A current summary of gene characterisation status for the S. pombe genome is available, as well as a table of historical characterisation status counts.
You can also retrieve current lists of genes with each characterisation status using the advanced search. Select the Characterisation status query, then choose a status from the pulldown menu, and submit.
At present, PomBase can host any types of data that can be connected with sequence features or coordinates, and can display the data as tracks in the genome browser. We accept data in any of several formats. To choose a file format for your data, consult the table below and the linked FAQs.
Also please see the HTP data submission page for instructions and submission templates, and consult the helpdesk to submit a file or if you need further assistance.
| File format | Recommended for |
|---|---|
| BAM | sequence alignments, especially from high-throughput experiments such as RNAseq |
| BED | sequence features with coordinates |
| bigBed | sequence features with coordinates |
| bigWig | values attached to genome locations/regions |
| GFF3 | sequence features with coordinates |
| VCF | structural variations, such as SNPs, insertions, deletions, or copy number variants |
| WIG | values attached to genome locations/regions |
We can also accept batch submissions of certain types of data that appear on PomBase gene pages. For these data types, we use dedicated PomBase-specific formats as shown in the table:
| Data type | File format description |
|---|---|
| Phenotypes | phenotype file format |
| Modifications | modification file format |
| Qualitative gene expression | qualitative gene expression file format |
| Quantitative gene expression | quantitative gene expression file format |
We may be able to accept data in other text formats. Please enquire via the PomBase helpdesk if you have any questions about your data format.
Generic Feature Format Version 3 (GFF3) is a tab-delimited text file format used to represent genomic sequence features.
PomBase produces GFF3 files of S. pombe sequence features, and accepts high-throughput data submissions in this format.
The file format specification is available from the Sequence Ontology GitHub site. Validation tools are available from various online providers.
“GO term enrichment” refers to analysing a gene list by finding GO terms that are significantly over- or under-represented among the annotations for the genes. Finding GO terms that are shared by genes in your list can help you find out what they have in common biologically.
PomBase does not have its own GO enrichment tool, but we recommend one, and provide a bit more information, in the FAQ on GO term enrichment.
PSL is a tab-delimited text format that represents sequence alignments.
PSL format is described in the UCSC Genome Bioinformatics FAQ, and the Broad Institute file format guide provides additional information.
Variant Call Format (VCF) is a text file format used to describe structural variations, such as SNPs, insertions, deletions, or copy number variants.
The file format specification is available from GitHub (see entries with “VCF” in the name).
The 1000 Genomes site, UCSC Genome Bioinformatics FAQ and the Broad Institute file format guide provide additional information.
Wiggle (WIG) is a file format for display of continuous-value data in a genome browser track.
BigWig format is described at the UCSC Genome Bioinformatics web site, and the Broad Institute file format guide provides additional information.
The reference sequence was last updated in January 2007; only feature coordinates and annotation have changed since then. See Sequence updates and Pending sequence updates for more information.
Genome sequence files can be downloaded from the Genome sequence and features page in several different formats.
A page of statistics is available, but note that it was last updated in January 2017.
PomBase annotations are updated each time the daily upload to the preview site (behind the scenes) succeeds, with snapshots archived on a monthly basis. To refer to PomBase in your publications, we recommend citing the date on which you view or download data. If you download an archived snapshot, cite its date.
Prior to the September 2017 PomBase upgrade, periodic data releases were flagged with version numbers and release dates. Each legacy version number has two parts, of which the first is the Ensembl Genomes (EG) version and the second is the version of curated PomBase annotations (sequence features, ontology annotations, etc.). For example, PomBase version 20_39 used EG version 20 and PomBase annotation data version 39. The Data version history page shows additional information about the versions of various data and software portions of the legacy PomBase releases.
The GO annotations available from PomBase (gene pages, advanced search, etc.) and the GO Consortium site (AmiGO; GO downloads) differ from those available from the UniProt GOA site (including QuickGO) for three main reasons:
The downloadable file of PomBase GO annotations is in the GO Consortium’s GAF format, and only includes “direct” annotations, i.e. the actual term-gene product connections made by manual curation or computational transfer. When an annotation is made to a term, the gene product is automatically inferred to be annotated to all the “ancestor” terms in the ontology. These inferred annotations are used in PomBase web pages and searches, but are not included in the GAF file. More information on ontology structure and annotation inference is available in documentation at PomBase and GO (ontology and annotation).
When you use GO annotations in any analysis, we strongly recommend using tools that take ontology structure and transitive inference of annotations into account.
GO annotations downloadable for search results are also in GAF format, so the same considerations apply.
One way this can happen is if you have “digest” mode enabled – this setting groups messages together and only sends them when a certain number have accumulated or a certain amount of time has elapsed. Typically members using digest mode receive messages about once a day.
To disable digest mode, or just check whether you have it on, go to the list management page:
https://lists.cam.ac.uk/sympa/info/ucam-pombelist
Log in (upper right corner), then go to “Subscriber Options” in the left-hand menu. In the “Receiving mode” pulldown. Choose “standard (direct reception)”. Click the “Apply modifications” button (below the next pulldown), and you can then log out.
PomBase curators use GO Biological Process annotations to indicate that a gene product is directly involved in a process or its regulation. FYPO annotations indicate when a mutation in a gene causes a change in a process, but do not say whether the effect is direct or indirect.
Many mutant phenotypes reflect downstream effects of compromising an upstream process. In these cases, we annotate the phenotypes using FYPO terms, but do not annotate to the GO corresponding biological process term. We use “regulation of biological process” GO terms in cases where there is evidence for a gene playing a regulatory role in wild-type cells, but not where defects in an upstream process affect a downstream process (even though the latter is sometimes described as “regulating” or “modulating” the downstream process).
For example, a defect in cellular respiration may arise from mutations in genes directly involved in respiration, but also as a downstream effect of mutations in genes involved in mitochondrial translation, respiratory chain complex assembly, or ubiquinone biosynthesis. Similarly, DNA replication defects often also lead to defects in chromosome segregation; for the genes involved we annotate both replication and segregation phenotypes, but only replication in GO biological process.
The cell cycle offers an even more dramatic example of why we restrict usage of GO annotations. Over 750 genes can be mutated to give an elongated vegetative cell phenotype, which is traditionally interpreted as indicating that cell cycle progression is blocked in interphase. Most of these genes, however, are involved in transcription, translation, transport or splicing, and cell cycle delays seen in mutants are due to activation of cell cycle checkpoints by the abnormal processes. To annotate all 750 genes to “regulation of mitotic cell cycle” would obscure the genes that actually are part of the cell cycle regulatory network, greatly reducing the usefulness and precision of GO annotations.
Also see the FAQ on finding genes that affect a process.
One gene can be correctly annotated to both a “viable” term and an “inviable” term from FYPO, under certain circumstances:
At present, alleles cannot be queried directly in the PomBase advanced search, but the FYPO phenotype filters do allow you to retrieve annotations for all alleles, or to restrict to null expression (deletions etc.) or overexpression of the wild-type allele. Comparing results with and without the allele restrictions may help resolve apparent discrepancies.
Note that it not yet possible to search for specific conditions, or for penetrance, but we plan to add these features to the Advanced Search.
If, however, the allele and condition details are identical, annotation to both viable and inviable terms is probably an error (either one of the terms is wrong, or there are missing or incorrect details for the alleles and/or conditions). Please let us know via the helpdesk if you notice any potential errors.
In PomBase, human and S. cerevisiae orthologs are manually curated for S. pombe genes as described in the Orthologs documentation. Because manual ortholog curation is extremely time-consuming, it is not done for any species other than human and S. cerevisiae. For automated ortholog prediction of orthologs in other species please see the relevant FAQ.
In the future we will add a tree view of consensus orthologs in key species to the gene pages.
Chen D, Toone WM, Mata J, Lyne R, Burns G, Kivinen K, Brazma A, Jones N, Bähler J. Mol Biol Cell. 2003 Jan;14(1):214-29. PMID:12529438
Decottignies A, Sanchez-Perez I, Nurse P Genome Res. 2003 Mar;13(3):399-406. PMID:12618370
Egel, R., Copenhagen, Denmark (Ed.) The Molecular Biology of Schizosaccharomyces pombe Genetics, Genomics and Beyond ISBN:3-540-00693-1
Correlations Between Gene Expression and Gene Conservation in Fission Yeast. Mata J, Bahler J. Genome Res. 2003 Nov 12 PMID:14613978
FELINES: a utility for extracting and examining EST-defined introns and exons. Drabenstot SD et al Nucleic Acids Res. 2003 Nov 15;31(22):e141. PMID:14602934
Genome-wide distribution of DNA replication origins at A+T-rich islands in Schizosaccharomyces pombe. Segurado M, De Luis A, Antequera F. EMBO Rep. 2003 Nov;4(11):1048-53. Epub 2003 Oct 17. PMID:14566325
Retrotransposons and their recognition of pol II promoters: a comprehensive survey… Bowen NJ et al Genome Res. 2003 Sep;13(9):1984-97. PMID:12952871
This issue of Methods includes 11 papers for fission yeast protocols including DNA damage checkpoint assays, cell wall analysis, TAP, nuclear envelope integrity assays, GFP imaging, TS mutant creation and plasmid use and construction. See the Methods site for details of the papers including PMIDs.
2021-08-18: Updated to remove out-of-date link.
The meeting was held at UC San Diego on August 24-29, 2004.
A project to record published genetic and physical interactions is underway with Mike Tyers and the GRID group at Toronto.
Second East Coast Regional pombe Meeting
This meeting took place from November 11-13, 2005 in Miami Beach, Florida.
Comparative Genomics of Eukaryotic Microorganisms:
Eukaryotic Genome Evolution, Approaches with Yeasts and Fungi
This conference took place from 12th-17th November 2005 in Sant Feliu de Guixols, Spain. Full details can be found here.
The European Fission Yeast Meeting (16th-18th March 2006) and The Fission Yeast Bioinformatics workshop (15th - 16th Mar 2006) both took place at the Wellcome Trust Genome Campus in Hinxton (Cambridge, UK).
The fission yeast database survey is now closed. You can view the survey results here.
The first fission yeast whole proteome localization study is now published: Matsuyama A. et al (2006): ORFeome cloning and global analysis of protein localization in the fission yeast Schizosaccharomyces pombe. Nat Biotech 24, 841-7.
The October issue of the journal Yeast is a fission yeast special issue containing 13 articles and reviews commissioned as a result of the European Fission Yeast Meeting, which are FREE to download.
GeneDB representation of the fission yeast data moved from contigs to chromosomes. See the pombelist archive for details.
4th International Fission Yeast Meeting held in Copenhagen.
Wellcome Trust Advanced Course ‘Genome-wide approaches with fission yeast’ held in Hinxton.
Baumann and Zakian labs identify elusive telomerase RNA (PMID:18157152 and PMID:18157149)
The h- mating type region has been provided by Xavier Marsellach and Lorena Aguilar.
Dynamic repertoire of the fission yeast transcriptome reveals: 94% of the genome is transcribed; extensive variation in different stages and conditions; global and condition-specific coupling between splicing efficiency and transcription; confirms the majority of introns; refines ~75 gene structures; identifies 453 new transcripts 26 of which were predicted to code for proteins.
S. pombe GeneDB now includes “deep links” to the Biological General Repository for Interaction Datasets (BioGRID) interaction datasets from the ‘Database Cross References’ section of the individual Gene Pages.
GeneDB is now using Version 23 of the Pfam protein family database. A total of 4154 (83%) S. pombe proteins now have at least one Pfam domain or family assignment (compared to 76% for S. cerevisiae), the highest percentage coverage for any eukaryote.
The fission yeast genome and annotation dataset is now available as part of Ensembl Fungi.
GeneDB (S. pombe) now uses the latest update to Pfam, release 24.0 and 88.5% of fission yeast proteins now contain a match to at least one Pfam domain (increased from 83% in version 23).
Fission yeast is one of the 12 key organisms of the reference genomes project. The goal of this project is to completely annotate twelve reference genomes so that those annotations may be used to effectively seed the automatic annotation efforts of other genome.
Funding was awarded by the Wellcome Trust for a fission yeast Model Organism Database, PomBase.
The analysis of the fission yeast deletion collection is now published online in Nature Biotechnology.
Further details are available on the pombe mailing list.
Further information on the pombe mailing list.
A paper describing the major findings of the Schizosaccharomyces Comparative Genome Project was published today in Science Express and reported changes are included in GeneDB.
Further details are described in the pombe mailing list posts:
A paper describing PomBase has been published online will be included in the 2012 Database Issue of Nucleic Acids Research. Abstract and open access full text are available.
A preview of PomBase, the new model organism database for the fission yeast Schizosaccharomyces pombe, has been announced to the S. pombe community for testing and feedback. For more on PomBase, see the NAR Database Issue paper (PubMed abstract) or contact the PomBase staff.
Note (2023-06-09): This is an archived news item about PomBase V1. See the documentation page to learn new Advanced search in PomBase V2.
We are pleased to announce that the PomBase web site, www.pombase.org, is now fully live; the preview phase has ended. The site has been updated with an assortment of new features, datatypes, and bug fixes.
More recent data, reflecting additions and changes through March 20, 2012, are now available on gene pages and in search results.
The updated site features a Gene List Search that provides behavior equivalent to GeneDB’s List Download. You can now type or paste lists into the Gene Systematic IDs and Gene Names filters, and use the Query History to combine a gene list search with other search options. For convenience, there is a direct link to a search page pre-configured to accept a list of systematic IDs available in the Find menu, on the Find page, and here: http://www.pombase.org/spombe/query/builder?filter=12
The Advanced Search also now offers:
We have also fixed a Sequence Download error reported by some users, so that the “CDS”, CDS + UTRs”, and “CDS + UTRs + Introns” options now retrieve the correct sequences.
In addition, numerous minor improvements have been made. Please send any questions or comments on the PomBase web site to us at <helpdesk@pombase.org>.
We are pleased to announce that we have updated both data and web site features for PomBase.
Most importantly, we have added new data types, and upgraded the gene pages to display them.
We have also added more annotations of existing data types, bringing the web site content up to September 11, 2012. The new annotations include the first contributions to come in via the new community curation system, and we thank the researchers who are participating in the initial phase of community curation.
New annotation types:
You can see these new data types on many gene pages, such as cdc2 or pka1.
New web site features:
What are annotation extensions?
Annotation extensions are a form of supporting data that can be added GO annotations (or other ontology annotations) to capture additional details not provided by the ontology term itself.
The information in GO annotation extensions encompasses several effector-target relationships, such as
Additional extensions describe spatial and temporal aspects of processes. For example, several S. pombe annotations now include extensions that indicate in which phase of the cell cycle a gene product is found in a cellular component or involved in a process – see the pka1 annotations to “nucleus” (GO:0005634) and “cytoplasm” (GO:0005737).
You may also find the GO wiki page on annotation extensions informative, although it is primarily aimed at curators.
Annotation extensions can also be used with phenotype annotations. The most common usage of phenotype annotation extensions is to capture which gene, protein, etc. was used in an assay. For example, the sam5 (G441E) mutation of pka1 causes nuclear accumulation of Ste11. This is represented by annotation to the ontology term “nuclear protein accumulation” (FYPO:0000255), with the extension “assayed_using(PomBase:SPBC32C12.02)”. Extensions can also indicate expressivity or penetrance for a phenotype.
We have updated the data available on the PomBase web site. The data now includes manual curation through December 17, 2012, and reflects complete curation of an additional 70 papers.
We have also made some improvements “under the hood” that should make gene page loading much faster. Please let us know if you have any problems with gene pages loading slowly or incompletely, whether or not you have reported issues in the past.
We are aware that there is an intermittent problem with the “Reference” column display in the data tables – sometimes a PubMed ID appears instead of an author name and year. This problem will be fixed as soon as possible. Please alert us if you notice anything else odd or wrong.
We have once again updated the data available on the PomBase web site. The data now includes manual curation through March 6, 2013.
We now expect to be able to update PomBase data every month, and will soon have an automated pipeline in place. We thank all of you for your patience during the long months when updates were infrequent.
You should also see a few small improvements in the site:
Last month we noted an intermittent problem with the “Reference” column display in the data tables. The occurrence of this problem should now be greatly reduced, so please let us know if you see it recurring.
As usual, please don’t hesitate to alert us of any other problems with data or site performance, or if you have any questions.
Dear Pombe Fans,
Please remember the imminent deadline (Monday 8th April) to register and submit abstracts for Pombe 2013: http://events.embo.org/13-pombe
Abstracts are also required from all who have already been invited to talk.
And do book your accommodation if you haven't yet done so.
More details are in previous email forwarded below.
Cheers,
-Jürg & Jacky
From: On Behalf Of Bahler, Jurg
Sent: 18 March 2013 17:49
To: pombelist at sanger.ac.uk
Subject: [Pombelist] Pombe 2013: Accommodation, registration & abstracts
Dear Pombe Afficionados,
Only three weeks left to register and submit abstracts for Pombe 2013, by Monday 8th April: http://events.embo.org/13-pombe
Speakers for 10 plenary talks and all workshop talks will be selected from abstracts, and there will be attractive poster prizes.
Payment is only requested after registration, by 10th May.
Important: if you require accommodation, please do book this real soon now. Especially the most cost-effective student accommodation (comfortable, with private bathrooms) may not be available much longer, as it will be put on general sale shortly. Both hotels and student accommodation will sell out in June, so you have to arrange it now. Information on accommodation is available here: http://events.embo.org/13-pombe/application.html
We will provide a number of free registrations for which you can apply during online registration (a few of which are reserved for student members of The Genetics Society: you become eligible if you join them now). The meeting is also supported by the Biochemical Society, so if you are, or become, a member you can apply to them for student bursaries or, if you have been a member for at least 1 year, also for travel grants.
We highly appreciate all the generous contributions from our sponsors so far:
Platinum: EMBO
Gold: Biochemical Society, Genetics Society, Formedium, Sunrise Science Products, Singer Instruments, F1000Research, PomBase/Wellcome Trust
Silver: MDPI - Open Access Publishing, Hybrigenics, Infors, Life Technologies, Bioneer
Bronze: Nature Communications, m2p labs, Imsol, Open Biology
We look very much forward to welcoming you in London this June!
All the best,
-Jürg & Jacky
Carl Singer, who was an integral part of the yeast research community for many years, passed away on February 8, 2013. Throughout his career, Carl supported yeast research both with his engineering expertise and with his good cheer. In tribute to Carl, the Singer family has now set up The Carl Singer Foundation, a charitable foundation dedicated to supporting scientific education in the field of yeast genetics. Questions about the foundation may be directed to Harry Singer at harry [at] thecarlsingerfoundation.org.
Carl’s family would be happy to receive memories of Carl’s life at regards [at] singerinstruments.com.
H/T SGD
We have extended the Gene Expression section of each gene page to support the display of quantitative expression data, and are now showing data from two publications:
We will also soon refine the display of the new expression data, and can add more datasets upon request. We thank Sam Marguerat for preparing the data from both papers for inclusion in PomBase.
We have also updated the PomBase site to include manual curation through April 4, 2013, and we have updated the “all gene names” file on the PomBase ftp site. The new file is available at
https://www.pombase.org/data/names_and_identifiers/gene_IDs_names.tsv
Link updated 2021-02-04
As of 14 May 2013, the old GeneDB database for S. pombe is no longer available. This resource consisted of static web pages, was not updated after March 2012, and not supported by an underlying relational database. The PomBase site fully supersedes GeneDB S. pombe, and provides improved infrastructure that will meet the current and future needs of the fission yeast community. Please e-mail the helpdesk if you cannot find a replacement for any GeneDB functionality in PomBase.
We have updated the data available on the PomBase web site. The data now includes manual curation through 13 May, 2013.
PomBase data now includes manual curation through June 9, 2013, and represents complete annotation for 664 publications (as well as partial curation of many more). A highlight of this month’s literature curation update is the addition of over 9400 phenotype annotations, representing about 95% of the phenotype data from the recently published genome-wide study of cell cycle and cell morphology (Hayles et al. Open Biology May 2013; PMID:23697806). We have also improved the display of allele details for phenotype annotations. Other changes include better support for gene synonyms in the simple search, regular updates to the UTR data files, and a number of minor adjustments to external links in the annotation data tables and the external references section.
At the pombe 2013 conference in London, PomBase officially launched its community curation initiative, which allows researchers to contribute publication-based annotations directly to the database. PomBase curators invite lab heads by individual email to curate newly published papers, providing links to the online curation system and its documentation. Researchers can also initiate curation of any older fission yeast publication in PubMed. Community curation uses the open-source online tool Canto.
We’d like to highlight a few improvements we’ve just made to the PomBase website. Most of the changes affect the gene pages:
In addition, the Motif Search output now includes standard gene names and product descriptions. As we noted in a separate message, CDS coordinate files are once again available from the Downloads, with accurate and up-to-date data.
Update: This item dates from July 2013, and the links in it no longer work. \ Please see the Fission Yeast Community page for the current mailing list link. \ (2020-02-18)
The pombe community mailing list, pombelist, has migrated from the Wellcome Trust Sanger Institute and is now hosted by EBI. The new address is pombelist@ebi.ac.uk (please note that the old address no longer works, and will generate an automatic notification including the new address). The link to subscribe has also been updated, and the entire archive is available at the new location.
To complement the mailing list and twitter (@PomBase) it is now possible to follow the activities of PomBase and interact with other members of the pombe community via the new LinkedIn Group and Google+.
Links to these are also available from the front page of the PomBase.org site.
At the pombe 2013 meeting in London, PomBase staff received numerous requests display various published data, such as gene expression, histone modifications, etc. in the genome browser. To provide this, we now invite pombe researchers to send data: If you have published any high-throughput experiments that produced data that can be associated with genome sequence coordinates, and thereby displayed as tracks on the PomBase genome browser, please fill out the HTP Data Submission Form. We can also accept large sets of phenotype data via the Phenotype Data Submission Form. If you have any problems or questions, contact us via the PomBase Helpdesk at any time.
We have once again updated the data available on the PomBase web site. The data now includes manual curation through August 11, 2013. We are particularly pleased to note that this update includes annotations from several dozen papers curated by the S. pombe community. Many thanks to all who have done, or are doing, paper curation in Canto.
We also have an updated version of the S. pombe/human ortholog table available upon request.
To guide current and future development, PomBase is now conducting a user survey, where we invite the fission yeast research community and any other PomBase users to evaluate the resources provided so far and comment on future priorities. The survey should take about 10 minutes to complete. Thank you for your participation!
The PomBase web site has been updated and now includes manually curated data through October 6, 2013. The number of community-curated papers continues to increase, ensuring that PomBase gene pages contain complete and up-to-date information. We are also pleased to announce that data tracks are now available in the genome browser for data from these two publications:
With the October 2013 update, gene pages now include “Target Of” annotations, which describe genes that affect the gene of interest. These annotations are essentially the reciprocal of ontology annotation extensions. Each “Target Of” annotation includes a relationship that indicates how the genes are connected, the name and product of the second gene, and a reference. Genes listed under “Target Of” may include upstream regulators or enzymes that modify the product of the gene of interest. For example, the “Target Of” annotations for cdc2 indicate that it is a substrate of, and regulated by, the kinase Wee1 and the phosphatase Cdc25 (among others). At present, “Target Of” data includes annotations derived from GO annotation extensions. We will soon extend it to include data from phenotype annotation extensions.
The 2013 PomBase user survey closed at the end of October, and the results are available here (PDF at FTP site). Some highlights have been sent to the pombe mailing list. Many thanks to all who completed the survey.
Link updated 2021-02-04
A series of mini-reviews, which were invited in association with the International Fission Yeast Meeting in London, have now been published in Biochemical Society Transactions: http://www.biochemsoctrans.org/bst/041/6/default.htm#c
(Thanks to Jürg Bahler for this item)
We have updated the data available on the PomBase web site to include manual curation through November 11, 2013. We now have future meetings available as a calendar or a list. The FAQ and some documentation pages have also been updated.
2021-08-18: Updated to remove out-of-date links (events are now listed only as news items).
We are about to release a data update for PomBase. Please note that there is still a problem with the human orthologs, as originally described on this list in mid-December (see archived message at http://listserver.ebi.ac.uk/pipermail/pombelist/2013/003926.html). We will correct this problem in the next PomBase release, and apologise for any inconvenience in the meantime.
We have once again updated the data available on the PomBase web site. The data now includes manual curation through January 10, 2014, and covers over 100 papers that have been curated in Canto by community members. We again thank all who have contributed curation via Canto.
We have made some improvements to the gene pages. Highlights:
In the genome browser, new data tracks are now available for data from these publications:
Now that more data tracks are available, we have added some categories to the track configuration section to improve organization. Additional documentation is in preparation, and will be announced here when available.
Genome sequences for additional Schizosaccharomyces species (S. japonicus, S. octosporus, and S. cryophilus) have recently become available in Ensembl Fungi, and the PomBase genome browser now includes comparative genomics data, with a view of region comparisons between each new genome and S. pombe.
Data on the PomBase web site now includes manual curation through February 24, 2014. Human orthologs that went missing from gene pages have been restored, and other small improvements have been made to gene pages. Community curation now covers over 130 publications.
We have updated the data available on the PomBase web site. The data now includes manual curation through April 28, 2014. Transcriptome data from Margeurat et al (2012) is now available as Ensembl Browser tracks.
Thank you to all who have done, or are doing, paper curation in Canto. Over 159 community-curated papers are now included in PomBase.
There are a number of routes to accelerate your data into PomBase, (either through community curation, or by supplying HTP sequence, modification or phenotype data in one of our specified formats), see http://www.pombase.org/submit-data for more details.
As usual, please don’t hesitate to alert us of any other problems with data or site performance, or if you have any questions.
Sincerely yours,
The PomBase Staff
PomBase was an early adopter of annotation extensions, which add spatial, temporal, or substrate/target details to GO annotations. The GO Consortium has now published a paper describing its implementation of annotation extensions, in which PomBase examples and its gene page display figure prominently:
Huntley, R.P. et al. (2014) A method for increasing expressivity of Gene Ontology annotations using a compositional approach. BMC Bioinformatics 2014, 15:155. doi:10.1186/1471-2105-15-155 PMID:24885854
We have updated the data available on the PomBase web site. The data now includes manual curation through June 6, 2014. In other improvements, a downloadable file of intron sequence data (FASTA format) is now available, and phenotypes are now included in the Target Of section on gene pages.
The gene pages also now display protein modification data from two large-scale datasets:
Link updated 2021-02-04
We have updated the data available on the PomBase web site to include manual curation through July 8, 2014. The gene pages also now display protein modification data from an additional large-scale dataset:
Koch A, Krug K, Pengelley S, Macek B, Hauf S. 2011. Mitotic substrates of the kinase aurora with roles in chromatin regulation identified through quantitative phosphoproteomics of fission yeast. Sci Signal. 4(179): rs6 doi: 10.1126/scisignal.2001588 PMID:21712547
We have also made corrections to some residue positions affected by sequence updates in one of the modification datasets we added last month:
Carpy A, Krug K, Graf S, Koch A, Popic S, Hauf S, Macek B. 2014. Absolute proteome and phosphoproteome dynamics during the cell cycle of fission yeast. Mol Cell Proteomics. 2014 Apr 23. [Epub ahead of print] PMID:24763107
We have updated the data available on the PomBase web site to include manual curation through August 8, 2014. Community curation now covers over 190 papers. Gene pages now include links to the S. pombe PeptideAtlas, a database of peptides identified in tandem mass spectrometry proteomics experiments.
We have updated the data available on the PomBase web site to include manual curation through August 30, 2014. Community curation now covers over 200 papers.
We have updated the data available on the PomBase web site to include manual curation through October 27, 2014, including 225 community-curated publications. The gene page Phenotype section now includes data from the high-throughput microscopy analysis of viable deletion mutants reported in:
Graml V, Studera X, Lawson JL, Chessel A, Geymonat M, Bortfeld-Miller M, Walter T, Wagstaff L, Piddini E, Carazo-Salas RE. A Genomic Multiprocess Survey of Machineries that Control and Link Cell Shape, Microtubule Organization, and Cell-Cycle Progression. Dev Cell. 2014 Oct 27;31(2):227-39. doi: 10.1016/j.devcel.2014.09.005 PMID:25373780. Links to the accompanying SYSGRO resource have been added to the External References section of the gene pages.
The genome browser now includes tracks for intron branch point data from:
Bitton DA, Rallis C, Jeffares DC, Smith GC, Chen YY, Codlin S, Marguerat S, Bähler J. LaSSO, a strategy for genome-wide mapping of intronic lariats and branch points using RNA-seq. Genome Res. 2014 Jul;24(7):1169-79. doi: 10.1101/gr.166819.113 PMID:24709818.
We have greatly improved search results for GO and FYPO annotations: both now follow more relationship types within the ontology to retrieve genes annotated to a term. The PomBase GO search now includes the regulates relationships, so its search results are consistent with those in the GO Consortium’s AmiGO browser. The FYPO search now uses has_part, has_output, and output_of as well as is_a and part_of. The Phenotype section now includes a highlighted sub-header that indicates whether a deletion mutant is viable or inviable. A file of protein complex subunits is available for download, and numerous smaller improvements have been made in the gene pages and static pages.
PomBase has implemented network visualisations for fission yeast in esyN, using data curated by BioGRID and PomBase. esyN is a web-based tool for building, sharing, and viewing network data developed by Dan Bean and Giorgio Favrin in the Cambridge Systems Biology Centre, University of Cambridge, UK.
On gene pages, we have links to gene-specific interaction networks in esyN in the table headers of the Interactions sections:
We also have esyN links on the GO Slim page and on ontology term pages for GO Slim biological process terms. Each GO Slim term links to the HCPIN physical interaction network in esyN (for example, see the “regulation of mitotic cell cycle” network).
To make the Gene Ontology (GO) annotations easier to read on PomBase gene pages, we have introduced a new, streamlined display that presents just the essentials. The summary shows the term name (hyperlinked to the ontology term page), the count of genes annotated to the term, and any annotation extensions. All of the previously visible annotation details are still available – simply click the “Summary” button to switch to the “Full” view. Or click the “+” and “-” icons to expand or collapse the annotation to a single term.
In addition, the top of the Biological Process table now lists any GO slim terms applicable to the gene.
We have updated the data available on the PomBase web site to include manual curation through January 12, 2015, including 240 community-curated publications. The gene page Phenotype section now features a compact default display. A downloadable “viability summary” data file is now available. The PomBase BLAST server has incorporated interface changes made Ensembl-wide.
We have updated the data available on the PomBase web site to include manual curation through February 2, 2015, including 245 community-curated publications. On the gene pages, the interaction tables now provides a bit of descriptive text for each annotation, indicating the nature and direction of the interaction.
Registration for Pombe 2015: 8th International Fission Yeast Meeting is now open at the conference web site, https://amarys-jtb.jp/web/Pombe2015/index.html
The registration deadline is 17 May 2015.
Thanks to Yasushi Hiraoka for this item.
We have updated the data available on the PomBase web site to include manual curation through March7, 2015, including 250 community-curated publications.The autocomplete feature of the Advanced Search ontology term filter has been improved with respect to response time and relevance of suggested terms.
Abstracts are due on Sunday, April 19, 2015 for the 8th International Fission Yeast Meeting in Kobe, Japan. Registration will remain open until May 17, but the abstract submission deadline cannot be extended.
We have updated the data available on the PomBase web site to include manual curation through April 7, 2015, including 260 community-curated publications.The Advanced Search now supports queries for proteins with a specified number of transmembrane domains.
The abstract submission deadline for the 8th International Fission Yeast Meeting in Kobe, Japan has been extended until midnight Friday, April 24 for posters only. Registration is open until May 17.
Applications are now being accepted for fellowships to provide financial support for students and postdocs attending the 8th International Fission Yeast Meeting in Kobe, Japan. To apply, follow the instructions sent to the pombase mailing list. The deadline is may 17, 2015 (same as the registration deadline).
Canto, PomBase’s literature curation tool, will be unavailable for approximately 3 weeks starting at 12:00 midnight UK time (BST) tonight, 27 May 2015, while we deploy an upgraded version.
The upgraded Canto will feature an entirely new interface for annotating multi-allele phenotypes and the corresponding genotypes, as well as improved workflows for single-allele phenotypes, GO, etc. All existing annotations will be retained, and users can resume curation using the new and improved features in any unfinished sessions when Canto is back online.
We will announce when the new version of Canto is released to the public.
We have updated the data available on the PomBase web site to include manual curation through May 8, 2015, including 265 community-curated publications.
We have updated the data available on the PomBase web site to include manual curation through May 26, 2015, including 270 community-curated publications. See you at Pombe 2015 in Kobe!
We have updated the data available on the PomBase web site to include manual curation through August 13, 2015, including 300 community-curated publications.
PomBase gene pages now include multi-allele phenotype annotations (i.e. phenotypes of double mutants, triple mutants, etc.). New sub-sections of the gene pages display multi-allele phenotypes at the population and individual cell level, paralleling the organisation of the single allele phenotype display. Compact and full views are available; both show phenotypes with the relevant genotypes and the alleles that make them up, and the full view adds details for evidence, expression, conditions, and references.
The genome browser now includes data tracks for two more publications:
DNA polymerase usage from:
Daigaku Y, Keszthelyi A, Müller CA, Miyabe I, Brooks T, Retkute R, Hubank M, Nieduszynski CA, Carr AM. 2015. A global profile of replicative polymerase usage. Nat Struct Mol Biol. 2015 Mar;22(3):192-8. doi: 10.1038/nsmb.2962 PMID:25664722
Promoters and transcription start sites from:
Li H, Hou J, Bai L, Hu C, Tong P, Kang Y, Zhao X, Shao Z. 2015. Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE. RNA Biol. 2015;12(5):525-37. doi: 10.1080/15476286.2015.1022704 PMID:25747261
Codon adaptation index (CAI) values are now included in the Protein Properties section of the gene pages and in the downloadable PeptideStats.tsv file. A file of amino acid composition data is also available from the FTP site and the Protein Datasets page.
The gene page section that was formerly misnamed “species distribution” is now called “taxonomic conservation”.
We have updated the data available on the PomBase web site to include manual curation through September 6, 2015.
Errors in the previous FYPOviability.tsv file have been corrected, and we recommend that all users update this file, especially those who downloaded it earlier in September 2015.
A new genetics primer, aimed at researchers interested in using fission yeast as a model system, has recently been published. The primer includes a brief history of fission yeast research, an introduction to available genetic tools, and the use of PomBase for data analysis
Hoffman CS, Wood V, Fantes PA. (2015) An Ancient Yeast for Young Geneticists: A Primer on the Schizosaccharomyces pombe Model System. Genetics 201:403-423. PMID:26447128 DOI:10.1534/genetics.115.181503
We have introduced new features to the Advanced Search:
We have updated the data available on the PomBase web site to include manual curation through November 9, 2015, including 340 community-curated publications.
We have updated the data available on the PomBase web site to include manual curation through January 25, 2016.
The genome browser includes variation data, in tracks under “Variation”, from natural S. pombe isolates, published in:
Jeffares DC et al. 2015. The genomic and phenotypic diversity of Schizosaccharomyces pombe. Nat Genet. 47(3): 235-241. doi:10.1038/ng.3215 PMID:25665008
New files are now available from the PomBase FTP site, and are linked from pages in the Download Datasets area:
The New and Removed Genes page has been updated to reflect recent deletions and merges.
Note: Ontology graph views are no longer available in the genome browser, so links have been removed from the GO, FYPO, and modification tables on the gene pages. For GO and FYPO, links to external ontology browsers that offer graphical views are available on the Ontology Term pages.
We have updated the data available on the PomBase web site to include manual curation through March 9, 2016.
Important: We have corrected a problem that made erroneous interaction data and literature appear on some gene pages.
The gene pages now include interaction data from the Vo et al. proteome-wide study (curated by BioGRID and imported into PomBase):
Vo TV et al. 2016. A Proteome-wide Fission Yeast Interactome Reveals Network Evolution Principles from Yeasts to Human. Cell 164(1-2): 310-23. doi: 10.1016/j.cell.2015.11.037 PMID:26771498.
The genome browser now includes transcriptome data published in:
Eser P, Wachutka L, Maier KC, Demel C, Boroni M, Iyer S, Cramer P, Gagneur J. 2016. Determinants of RNA metabolism in the Schizosaccharomyces pombe genome. Mol Syst Biol. 12(2): 857. doi: 10.15252/msb.20156526 PMID:26883383.
We have updated the data available on the PomBase web site to include manual curation through April 8, 2016.
We have updated the data available on the PomBase web site to include manual curation through May 12, 2016.
Several of the PomBase staff, joined by our advisor Sir Paul Nurse, have published a Comment in BMC Biology briefly describing the importance of model organism databases to the success of modern biomedical research:
Oliver SG, Lock A, Harris MA, Nurse P, Wood V. 2016. Model organism databases: essential resources that need the support of both funders and users.
BMC Biol. 2016 14(1): 49. doi: 10.1186/s12915-016-0276-z. PMID:27334346
In response to planned cuts to database funding, leading model organism researchers have prepared an open letter to NIH Director Dr. Francis Collins to demonstrate support for the independent community-focused databases that are essential to their work. Although PomBase is not directly funded by NIH, we collaborate extensively with those that are, including the GO Consortium and several model organism databases.
The Genetics Society of America website where the letter can be viewed and signed is at http://www.genetics-gsa.org/MODsupport
Please sign the letter to add your voice in support of the databases that help make your research possible. For more information, we recommend an email that Mike Cherry sent to the GO-Friends mailing list, archived at https://mailman.stanford.edu/pipermail/go-friends/2016-June/002355.html
We have updated the data available on the PomBase web site to include manual curation through September 11, 2016.
Registration for the 9th International Fission Yeast Meeting is now open. The meeting will be held in Banff, Canada from May 14-19, 2017. Early registration closes Dec 1, 2016! Please see our website at www.pombe2017.com for details. We look forward to seeing you in Banff!
- Conference Organizers: Dallan Young, Gordon Chua, Paul Young
Reminder: early registration for the 9th International Fission Yeast Meeting in Banff closes Dec. 31, 2016. Please see the conference website at www.pombe2017.com for details.
The new PomBase web site, which has been under development during 2017, has been released. The new site features:
We thank the members of the fission yeast research community who have followed its progress via the preview site, and welcome feedback from all users.
The Genetics Society of America (GSA) has announced two award winners familiar to the model organism database world:
The awards will be presented at the next Yeast Genetics Meeting, at Stanford University in August 2018. Congratulations and thanks to Mike and Steve!
Sadly, PomBase staff and the fission yeast community note the death of André Goffeau on April 2, 2018. In addition to initiating and coordinating the sequencing of the budding yeast genome, Prof. Goffeau will be remembered for his contributions to the fission yeast genome project and for his knowledge, leadership, and friendship.
PomBase has now implemented JBrowse, from the GMOD project, as its genome browser. The new browser offers a number of improvements over the old:
PomBase has a new book chapter in Eukaryotic Genomic Databases (Methods and Protocols). This chapter provides insight into the curation philosophy and data organization at PomBase, and provides a guide to using PomBase tailored for infrequent visitors and anyone considering extending their research to include S. pombe. The chapter is free to download courtesy of the Wellcome Trust.
We are very pleased to announce that we have loaded a number of new datasets into the PomBase [JBrowse genome browser (https://www.pombase.org/jbrowse/). These include:
For anyone wanting a quick introduction to our genome browser, Antonia Lock has written “Getting started with PomBase JBrowse”, a basic guide that covers loading tracks, navigating the browser, what metadata we provide, and more.
The pombe community mailing list, “pombelist”, is now hosted by the University of Cambridge. The new address for posting messages is pombelist@pombase.org. The link to subscribe has also changed.
We are very pleased to announce that we have loaded the transcript tracks from Atkinson et al. (2018) into the PomBase JBrowse genome browser. For a brief introduction to getting started with PomBase JBrowse, please see our documentation page. If you have published data that you would like to see hosted, please get in touch.
Registration for the 2019 Fungal Pathogen Genomics Course is now open. The course is hosted by Wellcome Genome Advanced Courses and Scientific Conferences, and will take place May 7-12, 2019, at the Wellcome Genome Campus, Hinxton, UK. Course content provides hands-on training on how to: - Take advantage of unique tools offered by FungiDB, EnsemblFungi, PomBase, SGD/CGD, and MycoCosm/JGI; - Develop testable hypotheses; - Investigate transcriptomics, proteomics and genomics datasets across multiple databases and different user interfaces. Please see the course website for more information, including how to apply, costs (limited bursaries are available), programme, and logistics.
Our NAR database update “PomBase 2018: user-driven reimplementation of the fission yeast database provides rapid and intuitive access to diverse, interconnected information” is now available. We have updated the Citing PomBase to recommend citing this new paper. Thank you all for guiding the development of the new, improved PomBase, and for your continued usage, curation contributions, and suggestions!
PomBase gene pages now use interactive graphics from PomBase JBrowse to depict the genomic region around the gene. Drag to scroll left and right, double-click to zoom in, shift-double-click to zoom out, and click a feature to see details in a popup. The “Full-screen view” link in the corner opens the fully functional JBrowse in a new tab or window. Reloading a gene page restores the display to the default location and zoom level.
RNAcentral is a comprehensive database of non-coding RNA sequences. PomBase is an RNAcentral Consortium member, and all of the curated non-coding RNAs from PomBase will be available in RNAcentral soon. For more information, see their recent NAR Database Issue paper, as well as current search results for S. pombe RNAs.
PomBase curators are major contributors to the Gene Ontology (GO) project — ontology content, annotations, and QC procedures — and co-authors on the new GO NAR Database Issue paper.
We recommend citing the GO and PomBase NAR papers when you use GO data in your analyses.
Our usage statistics informed us that over 20% of devices accessing PomBase are smartphones or tablets. We therefore spent some time optimizing the display for small screens. We hope that you will continue to enjoy PomBase on the go!
In a new publication, PomBase curators consider the challenges and opportunities that conserved, but persistently unstudied, proteins pose for diverse areas of basic and applied biology. To draw attention to these proteins, we develop metrics to define unknown lists, provide unknown inventories for human and yeast, classify S. pombe unknowns by numerous orthogonal attributes, and speculate about reasons for their neglect.
A pre-publication manuscript is available at bioRxiv.
The Gene Ontology “transmembrane transport” branch has recently been substantially revised. In line with these revisions, PomBase has standardised gene product descriptions for transporters, and overhauled GO annotations to be as complete and comprehensive as possible based on current knowledge.
Icon courtesy of Reactome.
PomBase now offers a new way to display gene lists graphically based on multiple orthogonal annotation types — the Quick Little Tool (QuiLT) for visualisation.
Inspired by our recent analysis of conserved unstudied proteins (see figures 4 and S1 in the manuscript at bioRxiv), QuiLT allows you to create a similar figure for any gene list you create or import using the advanced search. To use QuiLT, follow the link to your search results, then click the “Visualise” button. QuiLT visualisation is also available from the PomBase pages that list genes annotated to an ontology term, and on the Priority unstudied genes page.
To see the Unknowns dataset in QuiLT, visit the unknowns results page and click “Visualise”.
The QuiLT display is interactive, and you can:
See the QuiLT documentation for more information, and contact the curators if you have comments, questions or suggestions.
Many thanks to our star (and only) programmer, Kim Rutherford, for developing QuiLT.
We have loaded the nucleosome occupancy maps as described in González et al. (2016) PMID: 27662899. This dataset was generated using the paired-end sequencing protocol of Illumina and thus those maps are of higher resolution than those made with single-end (SE) sequencing hosted in the browser since before.
Here is a link that loads the tracks in PomBase JBrowse. And here is a link to our JBrowse quickstart guide.
Many thanks to Paco Antequera for sending us the bigwig files! If you would like us to load any datasets then please get in touch.
Responding to increasing interest in mitochondrial biology, especially relating to ageing, neurogenerative diseases, and processes at the ER-mitochondrion interface, we have reviewed S. pombe mitochondrial GO annotations. Although there is still relatively little fission yeast-derived experimental data in this area, we have refined many inferred annotations for mitochondrial complexes and sub-components as well as some for processes.
You can see all 753 S. pombe mitochondrial annotations on the ontology term page for mitochondrion (GO:0005739).
Icon courtesy of Reactome.
We are pleased to announce the release of our improved human disease mappings dataset. This dataset connects human disease causing genes to their S. pombe orthologs.
Diseases are now mapped to the Disease Ontology (DO) and the dataset has been extended by data from Malacards. All disease associations can be accessed from the top level disease page. A disease slim has been created to facilitate browsing of disease categories. Currently, 907 S. pombe genes are associated with disease (up from 610 in the original dataset). This number is due to increase as mappings are still in progress.
Many thanks to DO and Malacards for help in improving this annotation set. Icon courtesy of Julie McMurry.
Congratulations to PomBase project leader Val Wood, who has received the 2019 Exceptional Contributions to Biocuration Award from the International Society for Biocuration. Read more at the ISB site
Registration for the 10th International Fission Yeast Meeting is now open!
The conference will take place July 14-19, 2019, in Barcelona, Spain. Early registration closes on April 15th — or when capacity is reached. Please see the conference website for more information, including registration final deadline and costs (some travel grants are available), abstract submission, programme, accommodation, and logistics.
Our analysis of conserved unknown proteins has now been published in Open Biology. In it, PomBase curators consider the challenges and opportunities that conserved, but persistently unstudied, proteins pose for diverse areas of basic and applied biology. We develop metrics to define unknown lists, provide unknown inventories for human and yeast, and classify S. pombe unknowns by numerous orthogonal attributes, all with a view to drawing attention to the unknowns to alleviate their neglect.
Registration is now open for the Inaugural Trieste Cell Cycle Meeting, which will be held June 3-6, 2019, in Trieste, Italy.
This is the first of a planned series of biennial cell cycle meetings that will take place in Europe, and will alternate with the Salk Cell Cycle meetings held on the US west coast.
Organisers Rob de Bruin, Snezhana Oliferenko, Rosella Visintin and Peter Thorpe hope to see you there!
Icon derived from meeting image; credit: Chantal Roubinet, Baum lab
Registration is now open for the 26th annual South Eastern Regional Yeast Meeting (SERYM), which will be held April 12-14, 2019, in Atlanta, GA, USA.
Fission yeast’s own Susan Forsburg is the keynote speaker. The meeting brings together researchers who use any type of yeast as a model system, covering diverse, interdisciplinary topics from strategies for treatment of fungal disease to modeling human disease in yeast.
Icon: SERYM 2019
PomBase’s advanced search now allows you to retrieve GO slim annotations for any set of search results. To find GO slim annotations for your own list of S. pombe genes, use the advanced search “Gene names and IDs” option, and then use the “Slim” button on the search results page.
See the fission yeast GO slim page and the advanced search documentation for more information.
Registration is now open for the 29th International Conference on Yeast Genetics and Molecular Biology (ICYGMB), which returns to Gothenburg, Sweden, August 18-22, 2019.
Yeast2019 is the meeting of the international yeast research community where the latest, and even unpublished results are exchanged, and new projects, alliances, and collaborations are founded. Featuring 55 confirmed speakers including keynote lectures by Susan Gasser, Roger Kornberg and Frederick Roth, this conference will contain important news and information for all yeast researchers. A do-not-miss-event.
The PomBase motif search has been fully integrated into the website, and allows users to find protein motifs and send them directly to the PomBase advanced search.
S. pombe gene information is now included in the Gene Info extension (GIX) for the Chrome and Firefox web browsers. GIX allows you to retrieve information about a gene product directly on any webpage simply by double clicking an official gene name, synonym or supported accession. Searching or double-clicking on text terms retrieves gene function annotation, GO terms, external database links, and interaction data drawn from BioGRID and IntAct. Retrieved gene names are automatically hyperlinked for rapid recursive searches.
GeneInfo is fully open source, available online at GitHub. Tutorial videos, a step-by-step guide, and download links for Firefox Add-ons and the Chrome web storeare available online. GeneInfo was developed by James Knight in the Gingras Lab at the Lunenfeld-Tanenbaum Research Institute in Toronto, Canada.
PomBase now uses InterPro Version 73.0, which integrates 1,531 new methods from the CATH-Gene3D (122), CDD (330), PANTHER (1075), Pfam (2), PROSITE profiles (1) and TIGRFAMs (1) databases, and covers 81.2% of UniProt Knowledgebase release 2019_02.
See the news item at InterPro for additional information, including release notes.
You can now download nucleotide or peptide sequences for genes in Advanced search results in FASTA format, and customise what is included in the FASTA headers (e.g. gene names, product descriptions, sequence coordinates, or various IDs can be included).
We have added new external links to PomBase gene pages for structure and ortholog predictions:
Protein-specific links to SWISS-MODEL, a fully automated protein structure homology-modelling server, accessible via the ExPASy web server, lead to a SWISS-MODEL Repository page for each sequence and present results. If no structure or model is available, you can either trigger adding an entry to the repository with a single click or easily interactively search for templates and build models in your own SWISS-MODEL workspace.
Ensembl Fungi Compara and Ensembl Pan-taxonomic Compara links lead to orthology predictions from the Ensembl Compara pipeline for fungi and all species, respectively.
PANTHER links retrieve gene information, classification, and predicted orthologs.
The process of tRNA metabolism, and the associated molecular functions have recently been reviewed.
Please let us know if the annotation can be further improved.
We have loaded the Grech et al. (2019) “Fitness Landscape of the Fission Yeast Genome” dataset into JBrowse. In this study, transposon mutagenesis libraries were created to map transposon insertion sites in the S. pombe genome. From this data, functional elements of the genome were inferred. The tracks from this study can be loaded by a single click from the linked publication page above
Thanks Dan Jeffares for sending us the data.
For anyone new to JBrowse we have a quick start guide.
The vibrant fission yeast community now has a Slack channel. Slack provides a forum for the research community. Follow conversations you care about, message colleagues privately, or in groups, ask questions, post responses. All archived and searchable.
We have loaded data from: Segurado et al. (2003) “A+T-rich islands”, Hayashi et al. (2007) “Pre-replicative complex localization; early and late firing origins”, and Mickle et al. (2007) “Replication origins with functional classification”.
To view the tracks, either follow the hyperlinks above to the respective PomBase publication pages, and click on the “view” link after “Datasets from this publication are available in the PomBase JBrowse genome browser”, or go directly to the browser and click on the “select tracks” button to find the tracks manually.
For anyone new to JBrowse we have a quick start guide.
PomBase now uses InterPro Version 76.0, which integrates 277 new methods from the CATH-Gene3D (1), PANTHER (178) and CDD (98) databases. InterPro cites 59846 publications in PubMed. See the InterPro release notes for further information.
We are pleased to announce that the recent PomBase application for continued Wellcome Trust funding was successful. Although the grant was not fully funded, we are confident that we can cover the shortfall by small grants for stand-alone projects and collaborations. We would like to thank the pombe community for their support with the application, and the Wellcome Trust for their continued funding. We look forward to supporting your research until 2025 (and beyond).
Data tracks from datasets hosted in the PomBase genome browser can now be browsed and loaded from their respective publication pages. For an example, see Atkinson et al. (2018). Data tracks are now also downloadable from the publication pages.
All result pages from the Advanced search now have a unique permanent URL that can be bookmarked and shared with your colleagues.
To enable fission yeast researchers to manipulate S. pombe molecular biology reproducibly and easily, Aleks Vještica and Magdalena Marek in Sophie Martin’s lab have designed and constructed a series of simple, fully characterized plasmids.
The Stable Integration Vector (SIV) series provides a highly modular toolbox to introduce heterologous sequences more stably was possible with than previously available vectors. The toolkit includes antibiotic resistance markers, promoters, fluorescent tags, and terminators, as well as large set of ready-to-use fluorescent probes to mark organelles and visualize cellular processes.
The work is published in the Journal of Cell Science, and a PomBase publication page is available.
PomBase has been awarded Node Service status by the UK node of ELIXIR. ELIXIR-UK Node Services support the bioinformatics and broader biological research communities by providing training and resources that help researchers to find and share data, exchange expertise, and agree on best practices at national, European and international levels. The review panel describes PomBase as a “mature, leading model organism database which is popular, unique, well used, and has a strong user community.”
The 14th edition of the “Levures, Modèles et Outils” meeting (LMO14) will be held in July 9-11, 2020, at the University of Strasbourg in France. Registration is open February 3rd to June 30th, and abstracts can be submitted from February 3rd to April 10th. Authors will be notified in early May and the final program will be available in early June.
The sessions will be diverse and present the latest findings using yeast as a model organism on the following topics:
The PomBase advanced search Advanced search now supports using experimental conditions as search criteria for phenotype annotations. For example, you can now query for genes that show abnormal chromosome segregation mutant phenotypes specifically at high or low temperatures. The search uses the same condition descriptors as Canto and the PomBase web pages.
Note that phenotype queries that have condition constraints can be combined, but pay careful attention to the annotations for the results. Future work will add support for querying for multiple conditions on the same annotation, and for specifying conditions to exclude from results.
PomBase recently reached 250,000 annotations to controlled vocabularies and ontologies. The majority (over 90%) are assigned manually from fission yeast experimental data derived from 3776 publications, most of which report low-throughput, hypothesis-driven experiments.
You can query and combine any of these data types in the Advanced search.
Thank you to everyone who contributed to this significant achievement through community curation.
789/1587 publications assigned to community members for curation are finished. A big thank you to everyone who has participated so far. For more details, and all our curation metrics, see https://curation.pombase.org/pombe/stats/annotation
PomBase now uses InterPro Version 77.0, which integrates 145 new methods from the CATH-Gene3D (134), and SUPERFAMILY (11) databases. InterPro cites 59894 publications in PubMed. See the InterPro release notes for further information.
AnGeLi (developed by Danny Bitton) is a tool that allows you to perform enrichments over gene lists.
AnGeLi has recently been updated to provide 9320 lists, including ontology-based annotations from PomBase (as of 2020-03-04) as well as many additional datasets from the Bähler laboratory.
The PomBase Advanced search has added new options to the data you can download for your query results:
The first in the new series of online PombeTalks will take place on Wednesday 29 April 2020 at 17:00 Central European Time. Speakers:
Aleksandar Vjeṧtica, Sophie Martin’s lab, University of Lausanne: Cycling for reproductive fidelity: Coupling the cell cycle and re-fertilisation blocks ensures ploidy maintenance during sexual lifecycle
Haitong Hou, Julia Cooper’s lab, NCI & University of Colorado: Centromeres are dismantled by foundational meiotic proteins Spo11 and Rec8
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on May 13 and May 27, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
Midori Harris, ontology developer and curator at PomBase, has been awarded the 2020 Biocuration Career Award.
Congratulations to Midori and a huge thanks for all that you do for PomBase.
The mitochondrial genome sequence in PomBase has been updated to reflect corrections made in Tao et al. (2019) “Intraspecific Diversity of Fission Yeast Mitochondrial Genomes”.
PomBase now uses InterPro Version 79.0, which integrates:
InterPro cites 48466 publications in PubMed. See the InterPro release notes for further information.
PomBase curators have collaborated with the GO Consortium to improve the representation of chromatin silencing and the underlying heterochromatin organization processes in the GO biological process ontology and annotations.
Notably, “chromatin silencing” terms have been removed from GO on the grounds that they conflated various heterochromatin assembly, formation, and maintenance pathways with processes that affect chromatin-mediated repression more indirectly (e.g. tethering to the nuclear envelope). Chromatin silencing is a phenotype resulting from the cumulative effects of these processes, and the Fission Yeast Phenotype Ontology (FYPO) accordingly retains a full suite of “chromatin silencing” terms.
Annotations using the GO chromatin silencing terms were reviewed, and either removed or reannotated based on what could be inferred from the phenotypes, resulting in a substantially revised set of heterochromatin assembly annotations. Further work is required, so please send us any corrections.
The next online PombeTalks will take place on Wednesday 13 May 2020 at 17:00 Central European Time. Speakers:
Sarah Lambert, Institut Curie, Paris, France: Resolution of replication stress in space and time for maintaining genome stability
Cornelia Kilchert, Justus-Liebig-University, Giessen, Germany: RNA-binding proteins in fission yeast - a global perspective
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on May 27 and June 10, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
The PomBase team has published an overview of our experience with community curation for fission yeast. In the article, out this week in Database, we reflect on the factors that have made our community’s remarkable, standard-setting achievements possible, and on the benefits we and PomBase users derive from this effort. We highlight the collaboration between authors and professional curators that arises via community curation, and how annotation quality improves as a result.
Watch for invitations to curate your new papers, or see our community curation page for more information.
PomBase disease gene curation associates disease descriptors with fission yeast orthologs of human disease-causing genes. We have now increased coverage by adding new gene–disease term connections, with 3954 individual annotations to 1195 genes (up from 2588 and 905 respectively in January 2019). Disease associations now cover 24.5% of all fission yeast protein-coding genes, and over one third of those with human orthologs.
PomBase has switched from the Disease Ontology (DO) to the Monarch Initiative’s Mondo Disease Ontology (Mondo) for disease gene curation. Mondo covers the same set of disease descriptions as DO, but has a richer hierarchical structure that classifies more specific descriptions into broad categories (e.g. anemia, cancer, kidney disease) suitable for a disease “slim” term set.
PomBase curators are collaborating with Mondo to improve its disease classification, especially in areas that will support inferences that improve fission yeast disease annotation coverage in the new PomBase Mondo slim. The new disease slim is a work in progress, so if there is a particular disease grouping that you would find useful, please let us know.
The PomBase advanced search results panel now allows you to retrieve annotations to any of the fission yeast GO slims or the Mondo disease slim for genes in the results list. For example, you can query for all genes involved in a process and slim the resulting list by molecular function or disease association.
To complement the overview provided by the fission yeast GO biological process slim, we have created GO slims for the molecular function and cellular component branches of GO. Each slim page provides links to ontology term pages, annotated genes, and to download files containing the slim terms and IDs.
The next online PombeTalks will take place on Wednesday 27 May 2020 at 17:00 Central European Time. This time, in addition to the usual pair of research talks, our own Val Wood will show a few of PomBase’s lesser-known features.
Angad Garg, Stewart Schuman’s lab, Memorial Sloan Kettering Cancer Center: Long non-coding RNA control of phosphate homeostasis
José López Hernández, Sarah Zander’s lab, Stowers Institute for Medical Research: Diverse mating strategies in S. pombe affect the spread of wtf meiotic drivers
Val Wood, PomBase: Hidden corners of PomBase: Ten features you might not have seen
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on and June 10 and 24, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
Please note that the next online PombeTalks will take place one week later than originally planned, to support the STEM Strike for Black Lives on 10th June.
In the meantime, please complete this brief survey of the audience.
On Wednesday 17th June 2020 at 17:00 Central European Time, the speakers will be:
Gautam Dey, Baum lab, UCL / EMBL Heidelberg: Closed mitosis requires local disassembly of the nuclear envelope
Meredith Betterton, UC Boulder: Computational modeling of fission yeast mitosis: what we can learn about pombe from computer simulations
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. The next two sessions will b on June 27 and July 8. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
Entries in the PomBase advanced search query history now show brief, user-editable query descriptions, and a toggle to show or hide additional details.
The next online PombeTalks will take place on Wednesday 24th June 2020 at 17:00 Central European Time:
Sito Torres-Garcia, Allshire lab, University of Edinburgh: Epigenetic gene silencing by heterochromatin primes fungal resistance
Julie Rich-Robinson, Das lab, University of Tennessee: Cell-cycle-dependent cues temporally regulate Cdc42 activity at growth sites in fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up.
A schedule is now available for the rest of the summer, including the next talks on July 8th. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 8th July 2020 at 17:00 Central European Time:
Sahana Holla, Grewal lab, NIH: Positioning heterochromatin at the nuclear periphery promotes epigenetic inheritance
Nick Rhind, UMass Medical School: Cell size is controlled by size-dependent expression of mitotic activators
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on July 22nd, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 22nd July 2020 at 17:00 Central European Time:
Prof. Dr. Ann Ehrenhofer-Murray, Institut für Biologie, Humboldt-Universität zu Berlin: Queuosine and m5c modification of RNA: Nutritional control of translation in S. pombe homestasis
Dr. Sarah Sabatinos, Department of Chemistry and Biology, Ryerson University: Long-term effects of surviving replication instability
PomBase microPublications announcement (Midori Harris)
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on August 5, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
PomBase has recently joined microPublication.org, which “publishes brief, novel findings, negative and/or reproduced results, and results which may lack a broader scientific narrative”, as a Partner Database. Fission yeast researchers can thus now make any results available to the community, even those that don’t fit neatly into traditional publications.
Visit the microPublications website to learn more, to register and submit your data, or sign up to review. Send questions to the PomBase helpdesk.
The next online PombeTalks will take place on Wednesday 5th August 2020 at 17:00 Central European Time:
Feng Li, Levin Lab NICHD/NIH, USA: Identification of an integrase-independent pathway of retrotransposition
Ivan Surovtsev, King lab, Yale University, USA: Liquid-liquid phase separation, heterochromatin domains and nuclear mechanics
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on August 19, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 19th August 2020 at 17:00 Central European Time:
Joe Magliozzi, Moseley Lab, Dartmouth: Cell polarity kinases regulate RNA-binding protein Sts5 to control cell shape
Ramakanth Neeli, Minc Lab, Institute Jacques Monod: Mechanisms and Functions of Cell Wall Mechanosensing in Fission Yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 2, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
Due to the ongoing Covid-19 pandemic, the 11th International Fission Yeast Meeting, due to take place in Hiroshima, Japan, has been postponed.
The new dates will be 12th (Sun -17th (Fri) June, 2022.
Please see the conference website and pombelist for further announcements.
The next online PombeTalks will take place on Wednesday 2nd September 2020 at 17:00 Central European Time:
François Bachand, USherbrooke, Canada: Proximity-dependent biotinylation assays in fission yeast and a tale about slow RNA polymerase II transcription
Scott Curran, Nurse Lab, The Crick Institute, UK: A quantitative and spatial analysis of the cell cycle control network
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 16, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
In collaboration with the GO Consortium, the PomBase team has published a report on the Term Matrix approach to GO annotation quality control. The article, out this week in Open Biology, describes biological processes that do, or don’t, share annotated gene products, and how we use co-annotation patterns to build rules to detect, correct, and prevent errors.
We have updated our HTP data submission procedure to make it easier for you to contribute your datasets for PomBase JBrowse:
We now provide spreadsheet templates in Excel and Open Document formats that gather the metadata we need to load and display your data. You can download a template from the documentation page on HTP data submission. Send completed spreadsheets to the PomBase helpdesk.
Three new datasets in are now available in PomBase JBrowse (links go to PomBase publication pages, which in turn link to the browser with the tracks enabled):
Transcription start sites from
Li H, Hou J, Bai L, Hu C, Tong P, Kang Y, Zhao X, Shao Z. 2015.
Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE.
PMID:25747261 DOI:10.1080/15476286.2015.1022704
Transcript data from
Eser P, Wachutka L, Maier KC, Demel C, Boroni M, Iyer S, Cramer P, Gagneur J. 2016
Determinants of RNA metabolism in the Schizosaccharomyces pombe genome.
PMID:26883383 DOI:10.15252/msb.20156526
Transposon insertion sites from
Lee SY, Hung S, Esnault C, Pathak R, Johnson KR, Bankole O, Yamashita A, Zhang H Levin HL.
Dense Transposon Integration Reveals Essential Cleavage and Polyadenylation Factors Promote Heterochromatin Formation.
PMID:32101745 DOI:10.1016/j.celrep.2020.01.094
PomBase now hosts transposon integration data from Lee et al. 2020. Henry Levin explains the background and significance of the work:
“Transposon Integration Sequencing is a genome wide method of mapping sequences that contribute to growth. High throughput sequencing of transposon integration sites in haploid cells with single insertions reveals which genes are dispensable. Once propagated, cultures exhibit a pronounced lack of insertions in genes necessary for growth. This method, originally developed to study bacteria is now used to characterize the genomes of several yeasts including S. pombe. In earlier work we used the transposon Hermes to identify genes of S. pombe required for growth (Guo et al., 2013, Genetics, PMID:23893486). We have now applied Hermes and Transposon Integration Sequencing to identify genes important for the formation of heterochromatin (Lee et al., 2020, Cell Reports, PMID:32101745). Insertion sites from eight independent cultures can be visualized from PomBase as custom tracks on Jbrowse. Four cultures were of cells with ura4 silenced by cen1 heterochromatin. The other four cultures were of a strain without ura4. By passaging the cultures in 5-FOA we selected against cells with defects in heterochromatin. Genes that contributed to the formation of heterochromatin exhibited fewer insertions in cells with the cen1 copy of ura4 relative to the strain lacking ura4. To distinguish genes critical for heterochromatin from genes that contribute to a lesser extent we passaged cultures in 5-FOA for 5 generations and for 80 generations. While viewing these integration sites can indicate whether genes of interest contribute to heterochromatin formation you can also examine insertions in the cultures lacking ura4 to gage whether specific genes or noncoding sequences make significant contributions to growth.”
The next online PombeTalks will take place on Wednesday 16th September 2020 at 17:00 Central European Time:
Susan Forsburg, University of Southern California: Visualizing replication stress
Sigurd Braun, Ludwig-Maximilians-Universität, München: Gene repression at the nuclear membrane: Multifaceted roles of Lem2
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 30, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
Two new datasets in are now available in PomBase JBrowse (links go to PomBase publication pages, which in turn link to the browser with the tracks enabled):
and
More datasets are always welcome, so check out our instructions for submission.
The next online PombeTalks will take place on Wednesday 16th September 2020 at 17:00 Central European Time:
Alexander Lorenz, University of Aberdeen, UK: Meiotic recombination outcome in the face of genetic diversity
Veneta Gerganova, Martin Lab, UNIL, Switzerland: Patterning of membrane-associated proteins through membrane flows
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on October 14, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 14th October 2020 at 17:00 Central European Time:
Dimitrios Vavylonis, Lehigh University: Modeling fission yeast’s polarization pattern
Chloe Snider, Gould Lab, Vanderbilt University: Opposite surfaces of the Cdc15 F-BAR domain create a membrane platform that coordinates cytoskeletal and signaling components for cytokinesis
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on October 28, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 28th October 2020 at 17:00 Central European Time:
Omaya Dudin, EPFL, Switzerland: Cellularization of Ichthyosporean coenocytes
Bassem Al-Sady, UCSF, USA: Single cell analysis of the heterochromatin spreading reaction
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on November 11, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!
PomBase now includes over 3000 GO annotations made using Phylogenetic Annotation and INference Tool (PAINT), developed by the GO Consortium to infer protein function in a phylogenetic context, supporting precise assertions as to when functions were gained and lost during evolution. PAINT annotations use the evidence code “inferred from biological aspect of ancestor” (IBA). PAINT curation is described in more detail in Gaudet et al. 2011.
The next online PombeTalks will take place on Wednesday 11th November 2020 at 17:00 Central European Time:
Farnaz Mansouri, Mark Bayfield lab (York University, Toronto): The uncharacterized S. pombe La-related protein 1 functions in translation and affects RNA abundance
Saz Basu, Paul Nurse lab (Francis Crick Institute, London): Unmasking the mitotic potential of G1/S Cyclin-CDK
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on November 25. PombeTalks will then take a break, and return in early 2021. The schedule is available, and you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The last online PombeTalks for 2020 will take place on Wednesday 25th November 2020 at 17:00 Central European Time:
I-Ju Lee, David Pellman’s Lab, Dana-Farber Cancer Institute: Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway
Ulrike Endesfelder, Carnegie Mellon University: TBC
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
After these talks, PombeTalks will take a well-earned break, and return in early 2021. The schedule is available, and you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The first fission yeast microPublication has now been published:
Nafees Ahamad, Simmi Anjum, Shakil Ahmed\ Pyrogallol induces oxidative stress defects in the fission yeast S. pombe.
Congratulations to the authors, and thanks to the microPublication team!
PomBase now uses InterPro Version 83.0, which integrates:
InterPro cites 50487 publications in PubMed. See the InterPro release notes for further information.
We have developed an identifier mapper that retrieves S. pombe gene systematic IDs and standard names for a selection of different input ID types. You can now find S. pombe genes using UniProt accessions, and retrieve manually curated orthologs for S. cerevisiae using standard gene names or ORF names, and for human using standard gene names or HGNC identifiers.
Try the identifier mapper or check out the documentation.
The new season of online PombeTalks for 2021 will begin on Wednesday 3rd March 2021 at 17:00 Central European Time:
Maria Rodriguez Lopez, Bähler lab, UCL: Clr6 orchestrates transcriptional switches to regulate metabolism during oxidative stress
Olivia Muriel-Lopez, Martin lab, University of Lausanne: ’Ultrastructural plasma membrane asymmetries underlie cell-cell fusion in S. pombe*
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will resume its fortnightly schedule, so watch this space, pombelist, or PombeSlack for updates. As in the past, you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The new season of online PombeTalks for 2021 will begin on Wednesday 3rd March 2021, at a different time: 9:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yasuto Murayama, National Institute of Genetics, Shizuoka: Biochemical analysis of the fission yeast structural maintenance of chromosomes complex
Ken Ishikawa, Kurume University, Kurume: dCas9-mediated CRISPRi for S. pombe
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 31st March 2021, at 17:00 Central European Time:
Udo Onwubiko, Das lab, University of Tennessee: Cdc42 prevents early Rho1 activation during cytokinesis
Chunmin Shan, Jia lab, Columbia University: The INO80 complex regulates epigenetic inheritance of heterochromatin
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase has released a new, interactive display for protein features on gene pages. The new view is clearer, with details for each feature available via mouseover as well as in the accompanying table.
In addition, PomBase now uses InterPro Version 84.0, which includes 205 new entries and integrates 252 new methods from the Pfam, PANTHER, and CDD databases. See the InterPro release notes for further information.
A data track showing the fraction of G/C bases in a region is now available in PomBase JBrowse, listed under “Base composition”. The track is generated using the gccontent plugin, and uses a default window of 100 bp.
Canto, PomBase’s online curation tool, now supports qualitative gene expression annotation. Two new annotation types are available to represent observations about the levels of RNA or protein observed in wild-type cells, and how they change over the cell cycle or in response to a stimulus. See the Canto documentation for more information. We have also updated the display of qualitative gene expression on PomBase gene and publication pages.
The next online PombeTalks will take place on Wednesday 14th April 2021, at 17:00 Central European Time:
Pabitra Parua,�Fisher�lab,�Icahn School of Medicine at Mount Sinai: Control of the RNA polymerase II transcription cycle by CDK-phosphatase switches
Ye Dee Tay, Sawin Lab,�University of�Edinburgh: Gef1: the first aider of Cdc42 polarity module during stress
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase now uses InterPro Version 85.0, which integrates:
InterPro cites 51539 publications in PubMed. See the InterPro release notes for further information.
The next online PombeTalks will take place on Wednesday 28th April 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Tomoyuki Fukuda, Niigata University Graduate School of Medical and Dental Sciences: Atg43 serves as a selective autophagy receptor to promote mitophagy
Xiao-Ran Zhang, NIBS, Beijing, China: An improved auxin-inducible degron system for fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase now includes pages for curated diploid genotypes, and displays phenotypes annotated to them on gene and publication pages. For more details see the documentation for phenotype annotations and genotype pages.
The next online PombeTalks will take place on Wednesday 12th May 2021, at 17:00 Central European Time. Speakers:
Sierra Cullati, Gould lab, Vanderbilt University: Autophosphorylation of the CK1 Kinase Domain Regulates Enzyme Activity and Substrate Specificity
Stephen Huisman, Brunner Lab, University of Zurich: Vip1, a temperature-dependent filament forming protein involved in cell length regulation
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 26th May 2021, at 17:00 Central European Time. Speakers:
Mélina Vaurs (Vincent Géli & Stéphane Coulon labs - Cancer Research Center, Marseille): Shelterin-dependent telomerase regulation differs between quiescent and vegetative cells
Arthur Molines (Fred Chang lab – UCSF): Physical properties of the cytoplasm modulate microtubule dynamics
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The next online PombeTalks will take place on Wednesday 9th June 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yusuke Toyoda, Saitoh lab, Kurume University: Nitrogen-dependent persistence of S. pombe Ght5 glucose transporter on the cell surface is effected by TORC2 inhibition of α-arrestin Aly3
Anupa T. Anil, Mishra lab, IISER Mohali: How does spliceosome capture branchpoint-distant 3’ splice site?
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
The “Quantitative gene expression” section of PomBase gene pages now offers a display of violin plots to visualize where the gene appears in available expression datasets.
Violin plots are also available to visualize sets of up to 150 genes in the advanced search results.
At present data from Marguerat S et al. (2012) and Carpy A et al. (2014) are included.
The next online PombeTalks will take place on Wednesday 23rd June 2021, at 17:00 Central European Time. Speakers:
Yi Wei, Grewal lab, NCI CCR, Bethesda: TOR targets an RNA processing network to regulate cell proliferation and sexual development
Nicholas Ader, LusKing Lab, Yale School of Medicine: I open at the close(d mitosis): Investigating post-mitotic nuclear envelope sealing in fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase now uses InterPro Version 86.0, which integrates:
InterPro cites 52235 publications in PubMed. See the InterPro release notes for further information.
The next online PombeTalks will take place on Wednesday 7th July 2021, at 17:00 Central European Time. Speakers:
Debatrayee Sinha, Qian Chen lab, University of Toledo: Fission yeast polycystin Pkd2p promotes resumption of cell growth after cytokinesis
Joël Lemière, Fred Chang Lab, UCSF: The role of osmotic forces in nuclear size control
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase gene pages now have links to pathway entries in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, as well as links to gene lists for each linked pathway (example: 2-Oxocarboxylic acid metabolism). The KEGG pathway links are the first entry in a new gene page section, “Molecular pathway”, dedicated to connecting genes in PomBase to depictions of biochemical and signaling pathways.
The next online PombeTalks will take place on Wednesday 21st July 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yoko Otsubo, Yamashita lab, National Institute for Basic Biology: Novel links between TORC1 and traditional non-coding RNA, tRNA
Jie Su, Nakagawa lab, Osaka University: Rad8-dependent PCNA ubiquitination at lysine 107 causes gross chromosomal rearrangements
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
PomBase gene pages now have links to the AlphaFold Protein Structure Database, the collection of structures predicted by AI developed by DeepMind, hosted at EBI. Look in the “External references” section of your favorite gene page, or check out this example (pap1), or read more at the EBI AlphaFold home.
The next online PombeTalks will take place on Wednesday 4th August 2021, at 17:00 Central European Time. Speakers:
Tiffany Mak, Nurse lab, The Francis Crick Institute: The TOR-dependant phosphoproteome and regulation of cellular protein synthesis
Weifang Wu, Allshire lab, University of Edinburgh: Spatial organisation of the nucleus influences centromere identity
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
After these talks, PombeTalks will take a break for the rest of the summer, so watch this space, pombelist, or PombeSlack for updates. In the meantime, you can fill out this form at any time if you’re interested in speaking.
PomBase disease gene curation associates disease descriptors with fission yeast orthologs of human disease-causing genes. We have added new gene–disease term connections, to bring the total to 1401 S. pombe genes. Disease associations now cover 27.3% of all fission yeast protein-coding genes, and almost 40% with human orthologs.
We are delighted to announce the official release of PomBase’s new sister: JaponicusDB is a new, curated model organism database for the fission yeast Schizosaccharomyces japonicus. JaponicusDB highlights include revised gene structures, distant ortholog detection, improved GO annotation, community literature curation, and reciprocal gene page links with PomBase, providing a familiar environment for all fission yeast researchers.
The S. japonicus community will maintain JaponicusDB from now on. Join the new mailing list, and follow @japonicusdb on Twitter.
Papers describing PomBase and JaponicusDB will appear in an issue of GENETICS devoted to model organism database (MOD) reports. The MOD papers will highlight the journal’s new section on Computational Resources, Software & Databases.
Follow the links to the PomBase preprint and JaponicusDB preprint, and watch for the full-fledged publications to appear in March 2022.
The PomBase advanced search now allows you to find proteins that have coiled-coil regions, disordered regions, and low-complexity regions. The query-building interface also now organises query options more sensibly, and the documentation has been updated.
PomBase now uses InterPro Version 87.0, which integrates:
The Gene Ontology annotation filter for “during” specific cell cycle phases is now included on the “Summary” view in addition to the “Details” view. Available phases have been extended to cover all phases used, and to provide
useful grouping terms. This filter is “ontology aware” (i.e. a search on interphase will also display G1/S/G2 phase annotation). The phase filter is most useful on pages that display increasing volume of phase-specific curation (such as cdc2). The revised phase filter options are also available in the gene expression section.
The phase filters are located at the top right of GO and gene expression annotation sections:

Papers describing PomBase and JaponicusDB are now published (early online). These articles are part of a special issue of GENETICS devoted to model organism database (MOD) reports. The MOD papers will highlight the journal’s new section on Computational Resources, Software & Databases.
We have added an additional 5775 novel curated lncRNAs from Atkinson et al. to PomBase. We will refine the descriptions of these gene products to align with Sequence Ontology (SO) terms describing RNA features in the coming months.
Thanks to María Rodríguez-López for preparing the files.
We have loaded the TOR and nutritional phosphoproteome dataset described in Halova et al. (9424 annotations). Many thanks to Janni Petersen for preparing the files.
PomBase now uses InterPro Version 88.0.
Features include:
We continue to identify distant human orthologs. Four new 1:1 human ortholog connections have been added to PomBase this week:
Human NEPRO is a poorly characterised protein linked to the disease Anauxetic dysplasia 3, and GATC is the causal gene for “combined oxidative phosphorylation deficiency 42”
We would like to extend a huge “thank you” to the fission yeast community for curation contributions. The community have now curated 1008 publications providing 19,156 independent annotations, representing 25% of the curation from small-scale publications. In addition, another 80,000 annotations have been provided via the submission of HTP datasets.
Please contact us via the helpdesk if you would like to provide curation for your manuscript but don’t know how.
Links:
A GENETICS special issue featuring model organism database updates is published today. This issue features the recent PomBase and JaponicusDB publications and is accompanied by an editorial “Making biological knowledge useful for humans and machines” co-authored by Val Wood, Paul Sternberg and Howard Lipshitz.
We have added a phenotype slim overview to complement those provided for disease association, biological process, molecular function and cellular component annotation. The purpose of the phenotype slim is to provide subsets of commonly used ‘broad’ phenotypic classes or annotation subsets that can provide a useful starting point for accessing phenotype lists. The phenotype slim page provides links to ontology term pages, annotated genes, and to download files containing the slim terms and IDs.
The phenotype slim has also been added to the PomBase advanced search results panel “Slim with” menu. For example, you can query for all genes involved in a GO process, another phenotype, or any other list, and “slim” the results using the “Phenotype slim” option to view categories of phenotypes assigned to the list.
The next online pombeTalks will take place on May 18th. These are virtual seminars by and for the fission yeast community and friends.
08:00 San Francisco / 11:00 New York / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / 00:00 Tokyo
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next online pombeTalks will take place on Wednesday June 15th. These are virtual seminars by and for the fission yeast community and friends.
08:00 San Francisco / 11:00 New York / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / 00:00 Tokyo
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and pombeSlack one day in advance, so make sure you’ve signed up.
As before, questions will be posted to #pombetalks-qna on pombeSlack channel and recordings uploaded.
The next online pombeTalks will take place on Wednesday, July 20th. These talks are virtual seminars by and for the fission yeast community and friends.
0:00 San Francisco / 3:00 New York / 8:00 London / 9:00 Paris / 12:30 Delhi / 15:00 Beijing / 16:00 Tokyo.
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and pombeSlack one day in advance, so make sure you’ve signed up.
The next online pombeTalks will take place on Wednesday, August 17th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
As always, connection details will be sent the day of the talk. For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.
78 protein have been shortened (at the N-term). This set includes 34 published proteins (Apl4, Brc1, Cdc48, Cdt1, Cho1, Cmb1, Cut2, Cut6, Cwf26, Dbr1, Dri1, Elo2, Eri1, Lsd2, Lys2, Med13, Naa38, Nup107, Nup82, Orc2, Pof10, Ppt1, Rec24, Rga2, Rmt3, Rns1, RRpn7, Sap145, Skb1, Snf5, Snt2, Spn3, Tpp2, Trm1, and Tup12). Allele description changes and modification position changes are pending.
The next online pombeTalks will take place on Wednesday, September 21st. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
Manuel Lera Ramirez, PomBase / Tran Lab, Institute Curie “Microtubule rescue at midzone edges promotes overlap stability and prevents spindle collapse during anaphase B”
Hannah Opalko, Moseley lab, Dartmouth College “Mechanisms of spatial patterning of cell cycle regulator Cdr2”
Topic: PombeTalks S03E05 Zoom Meeting
Time: Sep 21, 2022 05:00 PM Paris
Meeting ID: 985 8572 1420
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.
We have added 77 new disease-gene associations for 71 fission yeast human gene orthologs. These were identified using “PombeMine” to identify the disease genes curated by OMIM not annotated with an existing MONDO mapping. The number of human disease gene associations is currently 1471. Disease genes can be browsed via the disease slim set or from the MONDO root node term.
As part of an Elixir funded collaboration with the InterMine team we have created PombeMine. Gene lists can be sent directly from PomBase query results pages directly to Intermine (under the “export” tab), providing direct (2 click) access to GO and phenotype enrichment tools.
We have added a new page providing useful information for new fission yeast researchers:
Getting started with S.pombe and PomBase
Includes details of how to join the community mailing list and the Slack channel, links to useful tools and resources, information about fission yeast as a model organism, an overview of PomBase and more.
The next online pombeTalks will take place on Wednesday, October 19th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
Cecilia D’Alessio, University of Buenos Aires and CONICET
“N-Glycosylation and glycoprotein folding in fission yeasts, a model to study human congenital disorders of glycosylation”
Jason Tanny, McGill University, Montreal
“A novel transcriptional mechanism regulating the cellular response to replication stress”
Topic: PombeTalks S03E06 Zoom Meeting
Time: Oct 19, 2022 05:00 PM Paris
Meeting ID: 933 7072 6178
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.
We collaborated with the Pfam group at the EBI to evaluate predictions generated from AlphaFold reciprocal best structure hits to identify potential distant orthologs. The Reciprocal Best Structure Hits (RBSH) approach provided 11 novel human homologues, including Pho86 -> NAT8 (ER acetyltransferase), Mug174 -> COIL (Coilin), Ach1 -> OXCT1 (succinyl-CoA:3-ketoacid coenzyme A transferase), SPAC1952.08c -> CREG1, imt1 -> A4GALT (Lactosylceramide 4-alpha-galactosyltransferase), Rtc5 -> MEAK7 (MTOR associated protein). A further 41 novel orthologs were predicted between S. pombe and S. cerevisiae which had fallen under the radar for all other methods used at PomBase. Most of the novel connections provided additional functional information, or supported existing knowledge for poorly characterised proteins. See supporting data tables S4 and S5 for the complete list of predictions included in PomBase. Article.
The next online pombeTalks will take place on Wednesday, November 16th. These talks are virtual seminars by and for the fission yeast community and friends.
Note that this session will happen earlier at:
midnight San Francisco; 03:00 NY; 08:00 London; 09:00 Paris; 13:30 Delhi, 16:00 Beijing; 17:00 Tokyo
Talks this session:
Wenfan Wei, University of Science and Technology of China
“The Cdc42 GAP Rga6 promotes monopolar outgrowth of spores”
Gaowen Liu, Shenzhen Institute of Synthetic Biology
“Fusion eciency evolution to the deletion of an essential mating gene Prm1”
Topic: PombeTalks S03E07 Zoom Meeting
Date: Nov 16, 2022
Time: midnight San Francisco; 03:00 NY; 08:00 London; 09:00 Paris; 13:30 Delhi, 16:00 Beijing; 17:00 Tokyo
Meeting ID: 932 8857 4852
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.
We have recently implemented an improved way to annotate and display genetic interactions so they are linked to phenotype annotations and alleles.
Previously, our Genetic Interaction annotations only mentioned the interacting genes and the type of genetic interaction. For example, if a strain with genotype asp1-H397A has the phenotype decreased acid phosphatase activity affecting activity of pho1, but this phenotype is suppressed when rhn1 is deleted in that strain, we would annotate that the genes asp1 and rhn1 are part of a Phenotypic Suppression interaction.
We continue to display interactions in this format by default (showing only genes and interaction type), but if you expand the annotation, you can view the associated genotypes and phenotypes.
In the revised Canto interface, you can only annotate a genetic interaction from the double mutant phenotype annotation (by clicking on add.., as shown below).
Of course, genetic interactions predating this update are not linked to phenotypes or genotypes, but we are hoping to auto-annotate several of those. We will also prioritise for update any interactions where community curators have provided these details in an annotation comment. Finally, a big shoutout to Ana Sanchez and Angad Garg from the Shuman lab, for testing the new interface in numerous recently curated publications. The examples provided here are from Sanchez et al. 2019. Go read it and see the annotations in PomBase.
Best, The PomBase team
You can now query the RNA length of genes (spliced or unspliced) under the “Transcripts and exons” query grouping in the Advanced search.
You can also add RNA sequence length as a field in tables downloaded from the query builder.
The next online PombeTalks will take place on Wednesday, December 14th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco; 11:00 NY; 16:00 London; 17:00 Paris; 20:30 Delhi, 23:00 Beijing; midnight Tokyo
This will be our last PombeTalks of 2022 before taking a winter break. The speaker will be:
It will be followed by some sum up/ feedback about PombeTalks from the organizing committee.
Please help us improve PombeTalks even more by taking this quick survey
Topic: PombeTalksS308 Zoom Meeting
Date: Dec 14th
Meeting ID: 975 0331 6190
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.
We are very pleased to announce that PomBase has been selected as one of the first Global Core Biodata Resource (GCBR) — a collection of 37 resources whose long term funding and sustainability is critical to life science and biomedical research worldwide. This accreditation recognizes PomBase as a primary knowledge base (adding value to data through expert curation) and as a crucial component of the research ecosystem. The candidate biodata resources were assessed against a series of rigorous criteria that included their scientific focus, the size and reach of their user communities, their quality of service, their governance, and their impact on global research.
Thank you to the entire community, especially the community curators who contribute regularly to our content, and our Scientific Advisory Board for their help and support.
For more information about the Global Biodata Coalition and PomBase’s new status, see the full press release.
We have revised the curated 5’UTRs using Transcription Start Sites (TSS) data (in vegetative growth/ minimal media) from the Cap Analysis of Gene Expression (CAGE) data provided by Thodberg et al. All new gene structures were manually reviewed, around ~80 protein features had N-terminal coordinate revisions to align with TSS data.
AlphaFold protein structure are now embedded on the PomBase gene pages. We hope to embed the experimental structures from PDB in the near future.
The experimental protein structures from PDB are now embedded on the PomBase gene pages using Mol*. For example: lsm7/SPCC285.12 gene page
If you select the “PDB structures” view on a gene page, experimental structures will set as your default. AlphaFold predictions will be shown for genes where an experimental structure are not available.
We now also display the structures on the associated publication page. For example: PMID:31010807 Garg et al.
To help locate proteins with experimental protein structures (currently 375), we have added a new query option to the “Advanced search”, currently under “commonly used queries”: “Proteins with PDB structures”
We have decided to merge the allele type “nonsense mutation” into “partial amino acid deletion”. This has mainly been driven by the fact that allele types that combine different variants require new types, such as “amino_acid_deletion_and_mutation”, “amino_acid_insertion_and_deletion”, etc. Otherwise, we would have ended up with many more types, and at the gene product level (which is what we describe in PomBase in phenotype interactions), both truncations are equivalent. In the next update, this allele type will not be available in Canto.
In any case, even if two alleles produce the same truncation, such as ase1-D13* or ase1Δ(13-731), they would still have separate entries in PomBase, and they may have different phenotypes. We are only assigning them the same allele type.
If for your analysis you need to make a distinction between the two using our allele dataset allele dataset, you can always check the “Allele description” field for the presence of the “*” character to tell whether an allele includes a nonsense mutation.

2023-04-26
We have decided to merge the allele type “nonsense mutation” into “partial amino acid deletion”. This has mainly been driven by the fact that allele types that combine different variants require new types, such as “amino_acid_deletion_and_mutation”, “amino_acid_insertion_and_deletion”, etc. Otherwise, we would have ended up with many more types, and at the gene product level (which is what we describe in PomBase in phenotype interactions), both truncations are equivalent. In the next update, this allele type will not be available in Canto.
In any case, even if two alleles produce the same truncation, such as ase1-D13* or ase1Δ(13-731), they would still have separate entries in PomBase, and they may have different phenotypes. We are only assigning them the same allele type.
If for your analysis you need to make a distinction between the two using our allele dataset allele dataset, you can always check the “Allele description” field for the presence of the “*” character to tell whether an allele includes a nonsense mutation.

2023-02-22
The experimental protein structures from PDB are now embedded on the PomBase gene pages using Mol*. For example: lsm7/SPCC285.12 gene page
If you select the “PDB structures” view on a gene page, experimental structures will set as your default. AlphaFold predictions will be shown for genes where an experimental structure are not available.
We now also display the structures on the associated publication page. For example: PMID:31010807 Garg et al.
To help locate proteins with experimental protein structures (currently 375), we have added a new query option to the “Advanced search”, currently under “commonly used queries”: “Proteins with PDB structures”

2023-02-02
AlphaFold protein structure are now embedded on the PomBase gene pages. We hope to embed the experimental structures from PDB in the near future.

2023-01-24
We have revised the curated 5’UTRs using Transcription Start Sites (TSS) data (in vegetative growth/ minimal media) from the Cap Analysis of Gene Expression (CAGE) data provided by Thodberg et al. All new gene structures were manually reviewed, around ~80 protein features had N-terminal coordinate revisions to align with TSS data.
![]()
2022-12-15
We are very pleased to announce that PomBase has been selected as one of the first Global Core Biodata Resource (GCBR) — a collection of 37 resources whose long term funding and sustainability is critical to life science and biomedical research worldwide. This accreditation recognizes PomBase as a primary knowledge base (adding value to data through expert curation) and as a crucial component of the research ecosystem. The candidate biodata resources were assessed against a series of rigorous criteria that included their scientific focus, the size and reach of their user communities, their quality of service, their governance, and their impact on global research.
Thank you to the entire community, especially the community curators who contribute regularly to our content, and our Scientific Advisory Board for their help and support.
For more information about the Global Biodata Coalition and PomBase’s new status, see the full press release.

2022-12-08
The next online PombeTalks will take place on Wednesday, December 14th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco; 11:00 NY; 16:00 London; 17:00 Paris; 20:30 Delhi, 23:00 Beijing; midnight Tokyo
This will be our last PombeTalks of 2022 before taking a winter break. The speaker will be:
It will be followed by some sum up/ feedback about PombeTalks from the organizing committee.
Please help us improve PombeTalks even more by taking this quick survey
Topic: PombeTalksS308 Zoom Meeting
Date: Dec 14th
Meeting ID: 975 0331 6190
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.

2022-12-07
You can now query the RNA length of genes (spliced or unspliced) under the “Transcripts and exons” query grouping in the Advanced search.
You can also add RNA sequence length as a field in tables downloaded from the query builder.

2022-11-29
We have recently implemented an improved way to annotate and display genetic interactions so they are linked to phenotype annotations and alleles.
Previously, our Genetic Interaction annotations only mentioned the interacting genes and the type of genetic interaction. For example, if a strain with genotype asp1-H397A has the phenotype decreased acid phosphatase activity affecting activity of pho1, but this phenotype is suppressed when rhn1 is deleted in that strain, we would annotate that the genes asp1 and rhn1 are part of a Phenotypic Suppression interaction.
We continue to display interactions in this format by default (showing only genes and interaction type), but if you expand the annotation, you can view the associated genotypes and phenotypes.
In the revised Canto interface, you can only annotate a genetic interaction from the double mutant phenotype annotation (by clicking on add.., as shown below).
Of course, genetic interactions predating this update are not linked to phenotypes or genotypes, but we are hoping to auto-annotate several of those. We will also prioritise for update any interactions where community curators have provided these details in an annotation comment. Finally, a big shoutout to Ana Sanchez and Angad Garg from the Shuman lab, for testing the new interface in numerous recently curated publications. The examples provided here are from Sanchez et al. 2019. Go read it and see the annotations in PomBase.
Best, The PomBase team

2022-11-11
The next online pombeTalks will take place on Wednesday, November 16th. These talks are virtual seminars by and for the fission yeast community and friends.
Note that this session will happen earlier at:
midnight San Francisco; 03:00 NY; 08:00 London; 09:00 Paris; 13:30 Delhi, 16:00 Beijing; 17:00 Tokyo
Talks this session:
Wenfan Wei, University of Science and Technology of China
“The Cdc42 GAP Rga6 promotes monopolar outgrowth of spores”
Gaowen Liu, Shenzhen Institute of Synthetic Biology
“Fusion eciency evolution to the deletion of an essential mating gene Prm1”
Topic: PombeTalks S03E07 Zoom Meeting
Date: Nov 16, 2022
Time: midnight San Francisco; 03:00 NY; 08:00 London; 09:00 Paris; 13:30 Delhi, 16:00 Beijing; 17:00 Tokyo
Meeting ID: 932 8857 4852
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.

2022-10-14
We collaborated with the Pfam group at the EBI to evaluate predictions generated from AlphaFold reciprocal best structure hits to identify potential distant orthologs. The Reciprocal Best Structure Hits (RBSH) approach provided 11 novel human homologues, including Pho86 -> NAT8 (ER acetyltransferase), Mug174 -> COIL (Coilin), Ach1 -> OXCT1 (succinyl-CoA:3-ketoacid coenzyme A transferase), SPAC1952.08c -> CREG1, imt1 -> A4GALT (Lactosylceramide 4-alpha-galactosyltransferase), Rtc5 -> MEAK7 (MTOR associated protein). A further 41 novel orthologs were predicted between S. pombe and S. cerevisiae which had fallen under the radar for all other methods used at PomBase. Most of the novel connections provided additional functional information, or supported existing knowledge for poorly characterised proteins. See supporting data tables S4 and S5 for the complete list of predictions included in PomBase. Article.

2022-10-13
The next online pombeTalks will take place on Wednesday, October 19th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
Cecilia D’Alessio, University of Buenos Aires and CONICET
“N-Glycosylation and glycoprotein folding in fission yeasts, a model to study human congenital disorders of glycosylation”
Jason Tanny, McGill University, Montreal
“A novel transcriptional mechanism regulating the cellular response to replication stress”
Topic: PombeTalks S03E06 Zoom Meeting
Time: Oct 19, 2022 05:00 PM Paris
Meeting ID: 933 7072 6178
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.

2022-10-13
We have added a new page providing useful information for new fission yeast researchers:
Getting started with S.pombe and PomBase
Includes details of how to join the community mailing list and the Slack channel, links to useful tools and resources, information about fission yeast as a model organism, an overview of PomBase and more.

2022-09-16
We have added 77 new disease-gene associations for 71 fission yeast human gene orthologs. These were identified using “PombeMine” to identify the disease genes curated by OMIM not annotated with an existing MONDO mapping. The number of human disease gene associations is currently 1471. Disease genes can be browsed via the disease slim set or from the MONDO root node term.

2022-09-16
As part of an Elixir funded collaboration with the InterMine team we have created PombeMine. Gene lists can be sent directly from PomBase query results pages directly to Intermine (under the “export” tab), providing direct (2 click) access to GO and phenotype enrichment tools.

2022-09-15
The next online pombeTalks will take place on Wednesday, September 21st. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
Manuel Lera Ramirez, PomBase / Tran Lab, Institute Curie “Microtubule rescue at midzone edges promotes overlap stability and prevents spindle collapse during anaphase B”
Hannah Opalko, Moseley lab, Dartmouth College “Mechanisms of spatial patterning of cell cycle regulator Cdr2”
Topic: PombeTalks S03E05 Zoom Meeting
Time: Sep 21, 2022 05:00 PM Paris
Meeting ID: 985 8572 1420
Password: will be sent the day of the meeting
For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.

2022-09-06
78 protein have been shortened (at the N-term). This set includes 34 published proteins (Apl4, Brc1, Cdc48, Cdt1, Cho1, Cmb1, Cut2, Cut6, Cwf26, Dbr1, Dri1, Elo2, Eri1, Lsd2, Lys2, Med13, Naa38, Nup107, Nup82, Orc2, Pof10, Ppt1, Rec24, Rga2, Rmt3, Rns1, RRpn7, Sap145, Skb1, Snf5, Snt2, Spn3, Tpp2, Trm1, and Tup12). Allele description changes and modification position changes are pending.

2022-08-13
The next online pombeTalks will take place on Wednesday, August 17th. These talks are virtual seminars by and for the fission yeast community and friends.
8:00 San Francisco / 11:00 NY / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / midnight Tokyo
Talks this session:
As always, connection details will be sent the day of the talk. For more fission yeast related topics and recordings of the talks, join pombeSlack, where additional questions can also be posted on the #pombetalks-qna channel.

2022-07-12
The next online pombeTalks will take place on Wednesday, July 20th. These talks are virtual seminars by and for the fission yeast community and friends.
0:00 San Francisco / 3:00 New York / 8:00 London / 9:00 Paris / 12:30 Delhi / 15:00 Beijing / 16:00 Tokyo.
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and pombeSlack one day in advance, so make sure you’ve signed up.

2022-06-14
The next online pombeTalks will take place on Wednesday June 15th. These are virtual seminars by and for the fission yeast community and friends.
08:00 San Francisco / 11:00 New York / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / 00:00 Tokyo
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and pombeSlack one day in advance, so make sure you’ve signed up.
As before, questions will be posted to #pombetalks-qna on pombeSlack channel and recordings uploaded.

2022-05-05
The next online pombeTalks will take place on May 18th. These are virtual seminars by and for the fission yeast community and friends.
08:00 San Francisco / 11:00 New York / 16:00 London / 17:00 Paris / 20:30 Delhi / 23:00 Beijing / 00:00 Tokyo
Talks this session:
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.

2022-04-13
We have added a phenotype slim overview to complement those provided for disease association, biological process, molecular function and cellular component annotation. The purpose of the phenotype slim is to provide subsets of commonly used ‘broad’ phenotypic classes or annotation subsets that can provide a useful starting point for accessing phenotype lists. The phenotype slim page provides links to ontology term pages, annotated genes, and to download files containing the slim terms and IDs.
The phenotype slim has also been added to the PomBase advanced search results panel “Slim with” menu. For example, you can query for all genes involved in a GO process, another phenotype, or any other list, and “slim” the results using the “Phenotype slim” option to view categories of phenotypes assigned to the list.

2022-04-04
A GENETICS special issue featuring model organism database updates is published today. This issue features the recent PomBase and JaponicusDB publications and is accompanied by an editorial “Making biological knowledge useful for humans and machines” co-authored by Val Wood, Paul Sternberg and Howard Lipshitz.

2022-03-26
We would like to extend a huge “thank you” to the fission yeast community for curation contributions. The community have now curated 1008 publications providing 19,156 independent annotations, representing 25% of the curation from small-scale publications. In addition, another 80,000 annotations have been provided via the submission of HTP datasets.
Please contact us via the helpdesk if you would like to provide curation for your manuscript but don’t know how.
Links:

2022-03-23
We continue to identify distant human orthologs. Four new 1:1 human ortholog connections have been added to PomBase this week:
Human NEPRO is a poorly characterised protein linked to the disease Anauxetic dysplasia 3, and GATC is the causal gene for “combined oxidative phosphorylation deficiency 42”

2022-03-12
PomBase now uses InterPro Version 88.0.
Features include:

2022-03-11
We have loaded the TOR and nutritional phosphoproteome dataset described in Halova et al. (9424 annotations). Many thanks to Janni Petersen for preparing the files.

2022-03-10
We have added an additional 5775 novel curated lncRNAs from Atkinson et al. to PomBase. We will refine the descriptions of these gene products to align with Sequence Ontology (SO) terms describing RNA features in the coming months.
Thanks to María Rodríguez-López for preparing the files.

2022-02-02
Papers describing PomBase and JaponicusDB are now published (early online). These articles are part of a special issue of GENETICS devoted to model organism database (MOD) reports. The MOD papers will highlight the journal’s new section on Computational Resources, Software & Databases.

2021-12-19
The Gene Ontology annotation filter for “during” specific cell cycle phases is now included on the “Summary” view in addition to the “Details” view. Available phases have been extended to cover all phases used, and to provide
useful grouping terms. This filter is “ontology aware” (i.e. a search on interphase will also display G1/S/G2 phase annotation). The phase filter is most useful on pages that display increasing volume of phase-specific curation (such as cdc2). The revised phase filter options are also available in the gene expression section.
The phase filters are located at the top right of GO and gene expression annotation sections:


2021-11-23
PomBase now uses InterPro Version 87.0, which integrates:

2021-10-18
The PomBase advanced search now allows you to find proteins that have coiled-coil regions, disordered regions, and low-complexity regions. The query-building interface also now organises query options more sensibly, and the documentation has been updated.

2021-09-27
Papers describing PomBase and JaponicusDB will appear in an issue of GENETICS devoted to model organism database (MOD) reports. The MOD papers will highlight the journal’s new section on Computational Resources, Software & Databases.
Follow the links to the PomBase preprint and JaponicusDB preprint, and watch for the full-fledged publications to appear in March 2022.

2021-09-01
We are delighted to announce the official release of PomBase’s new sister: JaponicusDB is a new, curated model organism database for the fission yeast Schizosaccharomyces japonicus. JaponicusDB highlights include revised gene structures, distant ortholog detection, improved GO annotation, community literature curation, and reciprocal gene page links with PomBase, providing a familiar environment for all fission yeast researchers.
The S. japonicus community will maintain JaponicusDB from now on. Join the new mailing list, and follow @japonicusdb on Twitter.

2021-08-06
PomBase disease gene curation associates disease descriptors with fission yeast orthologs of human disease-causing genes. We have added new gene–disease term connections, to bring the total to 1401 S. pombe genes. Disease associations now cover 27.3% of all fission yeast protein-coding genes, and almost 40% with human orthologs.

2021-07-28
The next online PombeTalks will take place on Wednesday 4th August 2021, at 17:00 Central European Time. Speakers:
Tiffany Mak, Nurse lab, The Francis Crick Institute: The TOR-dependant phosphoproteome and regulation of cellular protein synthesis
Weifang Wu, Allshire lab, University of Edinburgh: Spatial organisation of the nucleus influences centromere identity
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
After these talks, PombeTalks will take a break for the rest of the summer, so watch this space, pombelist, or PombeSlack for updates. In the meantime, you can fill out this form at any time if you’re interested in speaking.

2021-07-28
PomBase gene pages now have links to the AlphaFold Protein Structure Database, the collection of structures predicted by AI developed by DeepMind, hosted at EBI. Look in the “External references” section of your favorite gene page, or check out this example (pap1), or read more at the EBI AlphaFold home.

2021-07-14
The next online PombeTalks will take place on Wednesday 21st July 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yoko Otsubo, Yamashita lab, National Institute for Basic Biology: Novel links between TORC1 and traditional non-coding RNA, tRNA
Jie Su, Nakagawa lab, Osaka University: Rad8-dependent PCNA ubiquitination at lysine 107 causes gross chromosomal rearrangements
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-07-06
PomBase gene pages now have links to pathway entries in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, as well as links to gene lists for each linked pathway (example: 2-Oxocarboxylic acid metabolism). The KEGG pathway links are the first entry in a new gene page section, “Molecular pathway”, dedicated to connecting genes in PomBase to depictions of biochemical and signaling pathways.

2021-06-30
PomBase now uses InterPro Version 86.0, which integrates:
InterPro cites 52235 publications in PubMed. See the InterPro release notes for further information.

2021-06-30
The next online PombeTalks will take place on Wednesday 7th July 2021, at 17:00 Central European Time. Speakers:
Debatrayee Sinha, Qian Chen lab, University of Toledo: Fission yeast polycystin Pkd2p promotes resumption of cell growth after cytokinesis
Joël Lemière, Fred Chang Lab, UCSF: The role of osmotic forces in nuclear size control
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-06-17
The next online PombeTalks will take place on Wednesday 23rd June 2021, at 17:00 Central European Time. Speakers:
Yi Wei, Grewal lab, NCI CCR, Bethesda: TOR targets an RNA processing network to regulate cell proliferation and sexual development
Nicholas Ader, LusKing Lab, Yale School of Medicine: I open at the close(d mitosis): Investigating post-mitotic nuclear envelope sealing in fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-06-15
The “Quantitative gene expression” section of PomBase gene pages now offers a display of violin plots to visualize where the gene appears in available expression datasets.
Violin plots are also available to visualize sets of up to 150 genes in the advanced search results.
At present data from Marguerat S et al. (2012) and Carpy A et al. (2014) are included.

2021-06-02
The next online PombeTalks will take place on Wednesday 9th June 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yusuke Toyoda, Saitoh lab, Kurume University: Nitrogen-dependent persistence of S. pombe Ght5 glucose transporter on the cell surface is effected by TORC2 inhibition of α-arrestin Aly3
Anupa T. Anil, Mishra lab, IISER Mohali: How does spliceosome capture branchpoint-distant 3’ splice site?
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-05-20
The next online PombeTalks will take place on Wednesday 26th May 2021, at 17:00 Central European Time. Speakers:
Mélina Vaurs (Vincent Géli & Stéphane Coulon labs - Cancer Research Center, Marseille): Shelterin-dependent telomerase regulation differs between quiescent and vegetative cells
Arthur Molines (Fred Chang lab – UCSF): Physical properties of the cytoplasm modulate microtubule dynamics
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-05-05
The next online PombeTalks will take place on Wednesday 12th May 2021, at 17:00 Central European Time. Speakers:
Sierra Cullati, Gould lab, Vanderbilt University: Autophosphorylation of the CK1 Kinase Domain Regulates Enzyme Activity and Substrate Specificity
Stephen Huisman, Brunner Lab, University of Zurich: Vip1, a temperature-dependent filament forming protein involved in cell length regulation
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-04-29
PomBase now includes pages for curated diploid genotypes, and displays phenotypes annotated to them on gene and publication pages. For more details see the documentation for phenotype annotations and genotype pages.

2021-04-22
The next online PombeTalks will take place on Wednesday 28th April 2021, at 10:00 Central European Time / 17:00 Japan & Korea. Speakers:
Tomoyuki Fukuda, Niigata University Graduate School of Medical and Dental Sciences: Atg43 serves as a selective autophagy receptor to promote mitophagy
Xiao-Ran Zhang, NIBS, Beijing, China: An improved auxin-inducible degron system for fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-04-15
PomBase now uses InterPro Version 85.0, which integrates:
InterPro cites 51539 publications in PubMed. See the InterPro release notes for further information.

2021-04-08
The next online PombeTalks will take place on Wednesday 14th April 2021, at 17:00 Central European Time:
Pabitra Parua,�Fisher�lab,�Icahn School of Medicine at Mount Sinai: Control of the RNA polymerase II transcription cycle by CDK-phosphatase switches
Ye Dee Tay, Sawin Lab,�University of�Edinburgh: Gef1: the first aider of Cdc42 polarity module during stress
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-03-31
A data track showing the fraction of G/C bases in a region is now available in PomBase JBrowse, listed under “Base composition”. The track is generated using the gccontent plugin, and uses a default window of 100 bp.

2021-03-31
Canto, PomBase’s online curation tool, now supports qualitative gene expression annotation. Two new annotation types are available to represent observations about the levels of RNA or protein observed in wild-type cells, and how they change over the cell cycle or in response to a stimulus. See the Canto documentation for more information. We have also updated the display of qualitative gene expression on PomBase gene and publication pages.

2021-03-30
PomBase has released a new, interactive display for protein features on gene pages. The new view is clearer, with details for each feature available via mouseover as well as in the accompanying table.
In addition, PomBase now uses InterPro Version 84.0, which includes 205 new entries and integrates 252 new methods from the Pfam, PANTHER, and CDD databases. See the InterPro release notes for further information.

2021-03-27
The next online PombeTalks will take place on Wednesday 31st March 2021, at 17:00 Central European Time:
Udo Onwubiko, Das lab, University of Tennessee: Cdc42 prevents early Rho1 activation during cytokinesis
Chunmin Shan, Jia lab, Columbia University: The INO80 complex regulates epigenetic inheritance of heterochromatin
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-03-10
The new season of online PombeTalks for 2021 will begin on Wednesday 3rd March 2021, at a different time: 9:00 Central European Time / 17:00 Japan & Korea. Speakers:
Yasuto Murayama, National Institute of Genetics, Shizuoka: Biochemical analysis of the fission yeast structural maintenance of chromosomes complex
Ken Ishikawa, Kurume University, Kurume: dCas9-mediated CRISPRi for S. pombe
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will continue with its fortnightly schedule, and every third session will take place at the new Asia-friendly time. Watch this space, pombelist, or PombeSlack for updates, and please fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-02-24
The new season of online PombeTalks for 2021 will begin on Wednesday 3rd March 2021 at 17:00 Central European Time:
Maria Rodriguez Lopez, Bähler lab, UCL: Clr6 orchestrates transcriptional switches to regulate metabolism during oxidative stress
Olivia Muriel-Lopez, Martin lab, University of Lausanne: ’Ultrastructural plasma membrane asymmetries underlie cell-cell fusion in S. pombe*
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
PombeTalks will resume its fortnightly schedule, so watch this space, pombelist, or PombeSlack for updates. As in the past, you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2021-02-04
We have developed an identifier mapper that retrieves S. pombe gene systematic IDs and standard names for a selection of different input ID types. You can now find S. pombe genes using UniProt accessions, and retrieve manually curated orthologs for S. cerevisiae using standard gene names or ORF names, and for human using standard gene names or HGNC identifiers.
Try the identifier mapper or check out the documentation.

2021-01-25
PomBase now uses InterPro Version 83.0, which integrates:
InterPro cites 50487 publications in PubMed. See the InterPro release notes for further information.

2021-01-07
The first fission yeast microPublication has now been published:
Nafees Ahamad, Simmi Anjum, Shakil Ahmed\ Pyrogallol induces oxidative stress defects in the fission yeast S. pombe.
Congratulations to the authors, and thanks to the microPublication team!

2020-11-18
The last online PombeTalks for 2020 will take place on Wednesday 25th November 2020 at 17:00 Central European Time:
I-Ju Lee, David Pellman’s Lab, Dana-Farber Cancer Institute: Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway
Ulrike Endesfelder, Carnegie Mellon University: TBC
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
After these talks, PombeTalks will take a well-earned break, and return in early 2021. The schedule is available, and you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!

2020-11-04
The next online PombeTalks will take place on Wednesday 11th November 2020 at 17:00 Central European Time:
Farnaz Mansouri, Mark Bayfield lab (York University, Toronto): The uncharacterized S. pombe La-related protein 1 functions in translation and affects RNA abundance
Saz Basu, Paul Nurse lab (Francis Crick Institute, London): Unmasking the mitotic potential of G1/S Cyclin-CDK
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on November 25. PombeTalks will then take a break, and return in early 2021. The schedule is available, and you are always welcome to fill out this form if you’re interested in speaking.
Thanks to the PombeTalks team for organizing. See you online!
![]()
2020-11-01
PomBase now includes over 3000 GO annotations made using Phylogenetic Annotation and INference Tool (PAINT), developed by the GO Consortium to infer protein function in a phylogenetic context, supporting precise assertions as to when functions were gained and lost during evolution. PAINT annotations use the evidence code “inferred from biological aspect of ancestor” (IBA). PAINT curation is described in more detail in Gaudet et al. 2011.

2020-10-24
The next online PombeTalks will take place on Wednesday 28th October 2020 at 17:00 Central European Time:
Omaya Dudin, EPFL, Switzerland: Cellularization of Ichthyosporean coenocytes
Bassem Al-Sady, UCSF, USA: Single cell analysis of the heterochromatin spreading reaction
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on November 11, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-10-08
The next online PombeTalks will take place on Wednesday 14th October 2020 at 17:00 Central European Time:
Dimitrios Vavylonis, Lehigh University: Modeling fission yeast’s polarization pattern
Chloe Snider, Gould Lab, Vanderbilt University: Opposite surfaces of the Cdc15 F-BAR domain create a membrane platform that coordinates cytoskeletal and signaling components for cytokinesis
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on October 28, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-09-23
The next online PombeTalks will take place on Wednesday 16th September 2020 at 17:00 Central European Time:
Alexander Lorenz, University of Aberdeen, UK: Meiotic recombination outcome in the face of genetic diversity
Veneta Gerganova, Martin Lab, UNIL, Switzerland: Patterning of membrane-associated proteins through membrane flows
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on October 14, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-09-17
Two new datasets in are now available in PomBase JBrowse (links go to PomBase publication pages, which in turn link to the browser with the tracks enabled):
and
More datasets are always welcome, so check out our instructions for submission.

2020-09-14
The next online PombeTalks will take place on Wednesday 16th September 2020 at 17:00 Central European Time:
Susan Forsburg, University of Southern California: Visualizing replication stress
Sigurd Braun, Ludwig-Maximilians-Universität, München: Gene repression at the nuclear membrane: Multifaceted roles of Lem2
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 30, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-09-11
PomBase now hosts transposon integration data from Lee et al. 2020. Henry Levin explains the background and significance of the work:
“Transposon Integration Sequencing is a genome wide method of mapping sequences that contribute to growth. High throughput sequencing of transposon integration sites in haploid cells with single insertions reveals which genes are dispensable. Once propagated, cultures exhibit a pronounced lack of insertions in genes necessary for growth. This method, originally developed to study bacteria is now used to characterize the genomes of several yeasts including S. pombe. In earlier work we used the transposon Hermes to identify genes of S. pombe required for growth (Guo et al., 2013, Genetics, PMID:23893486). We have now applied Hermes and Transposon Integration Sequencing to identify genes important for the formation of heterochromatin (Lee et al., 2020, Cell Reports, PMID:32101745). Insertion sites from eight independent cultures can be visualized from PomBase as custom tracks on Jbrowse. Four cultures were of cells with ura4 silenced by cen1 heterochromatin. The other four cultures were of a strain without ura4. By passaging the cultures in 5-FOA we selected against cells with defects in heterochromatin. Genes that contributed to the formation of heterochromatin exhibited fewer insertions in cells with the cen1 copy of ura4 relative to the strain lacking ura4. To distinguish genes critical for heterochromatin from genes that contribute to a lesser extent we passaged cultures in 5-FOA for 5 generations and for 80 generations. While viewing these integration sites can indicate whether genes of interest contribute to heterochromatin formation you can also examine insertions in the cultures lacking ura4 to gage whether specific genes or noncoding sequences make significant contributions to growth.”

2020-09-08
Three new datasets in are now available in PomBase JBrowse (links go to PomBase publication pages, which in turn link to the browser with the tracks enabled):
Transcription start sites from
Li H, Hou J, Bai L, Hu C, Tong P, Kang Y, Zhao X, Shao Z. 2015.
Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE.
PMID:25747261 DOI:10.1080/15476286.2015.1022704
Transcript data from
Eser P, Wachutka L, Maier KC, Demel C, Boroni M, Iyer S, Cramer P, Gagneur J. 2016
Determinants of RNA metabolism in the Schizosaccharomyces pombe genome.
PMID:26883383 DOI:10.15252/msb.20156526
Transposon insertion sites from
Lee SY, Hung S, Esnault C, Pathak R, Johnson KR, Bankole O, Yamashita A, Zhang H Levin HL.
Dense Transposon Integration Reveals Essential Cleavage and Polyadenylation Factors Promote Heterochromatin Formation.
PMID:32101745 DOI:10.1016/j.celrep.2020.01.094

2020-09-08
We have updated our HTP data submission procedure to make it easier for you to contribute your datasets for PomBase JBrowse:
We now provide spreadsheet templates in Excel and Open Document formats that gather the metadata we need to load and display your data. You can download a template from the documentation page on HTP data submission. Send completed spreadsheets to the PomBase helpdesk.

2020-09-02
In collaboration with the GO Consortium, the PomBase team has published a report on the Term Matrix approach to GO annotation quality control. The article, out this week in Open Biology, describes biological processes that do, or don’t, share annotated gene products, and how we use co-annotation patterns to build rules to detect, correct, and prevent errors.

2020-09-01
The next online PombeTalks will take place on Wednesday 2nd September 2020 at 17:00 Central European Time:
François Bachand, USherbrooke, Canada: Proximity-dependent biotinylation assays in fission yeast and a tale about slow RNA polymerase II transcription
Scott Curran, Nurse Lab, The Crick Institute, UK: A quantitative and spatial analysis of the cell cycle control network
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 16, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-08-19
Due to the ongoing Covid-19 pandemic, the 11th International Fission Yeast Meeting, due to take place in Hiroshima, Japan, has been postponed.
The new dates will be 12th (Sun -17th (Fri) June, 2022.
Please see the conference website and pombelist for further announcements.

2020-08-12
The next online PombeTalks will take place on Wednesday 19th August 2020 at 17:00 Central European Time:
Joe Magliozzi, Moseley Lab, Dartmouth: Cell polarity kinases regulate RNA-binding protein Sts5 to control cell shape
Ramakanth Neeli, Minc Lab, Institute Jacques Monod: Mechanisms and Functions of Cell Wall Mechanosensing in Fission Yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on September 2, and the schedule is available for the next few weeks. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-07-31
The next online PombeTalks will take place on Wednesday 5th August 2020 at 17:00 Central European Time:
Feng Li, Levin Lab NICHD/NIH, USA: Identification of an integrase-independent pathway of retrotransposition
Ivan Surovtsev, King lab, Yale University, USA: Liquid-liquid phase separation, heterochromatin domains and nuclear mechanics
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on August 19, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-07-22
PomBase has recently joined microPublication.org, which “publishes brief, novel findings, negative and/or reproduced results, and results which may lack a broader scientific narrative”, as a Partner Database. Fission yeast researchers can thus now make any results available to the community, even those that don’t fit neatly into traditional publications.
Visit the microPublications website to learn more, to register and submit your data, or sign up to review. Send questions to the PomBase helpdesk.

2020-07-21
The next online PombeTalks will take place on Wednesday 22nd July 2020 at 17:00 Central European Time:
Prof. Dr. Ann Ehrenhofer-Murray, Institut für Biologie, Humboldt-Universität zu Berlin: Queuosine and m5c modification of RNA: Nutritional control of translation in S. pombe homestasis
Dr. Sarah Sabatinos, Department of Chemistry and Biology, Ryerson University: Long-term effects of surviving replication instability
PomBase microPublications announcement (Midori Harris)
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on August 5, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to the PombeTalks team for organizing. See you online!

2020-07-02
The next online PombeTalks will take place on Wednesday 8th July 2020 at 17:00 Central European Time:
Sahana Holla, Grewal lab, NIH: Positioning heterochromatin at the nuclear periphery promotes epigenetic inheritance
Nick Rhind, UMass Medical School: Cell size is controlled by size-dependent expression of mitotic activators
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also see PombeSlack for Q&A after the talks, and for recordings of previous sessions.
The next talks are on July 22nd, and the summer schedule is available. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-06-19
The next online PombeTalks will take place on Wednesday 24th June 2020 at 17:00 Central European Time:
Sito Torres-Garcia, Allshire lab, University of Edinburgh: Epigenetic gene silencing by heterochromatin primes fungal resistance
Julie Rich-Robinson, Das lab, University of Tennessee: Cell-cycle-dependent cues temporally regulate Cdc42 activity at growth sites in fission yeast
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up.
A schedule is now available for the rest of the summer, including the next talks on July 8th. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-06-11
Entries in the PomBase advanced search query history now show brief, user-editable query descriptions, and a toggle to show or hide additional details.

2020-06-05
Please note that the next online PombeTalks will take place one week later than originally planned, to support the STEM Strike for Black Lives on 10th June.
In the meantime, please complete this brief survey of the audience.
On Wednesday 17th June 2020 at 17:00 Central European Time, the speakers will be:
Gautam Dey, Baum lab, UCL / EMBL Heidelberg: Closed mitosis requires local disassembly of the nuclear envelope
Meredith Betterton, UC Boulder: Computational modeling of fission yeast mitosis: what we can learn about pombe from computer simulations
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. The next two sessions will b on June 27 and July 8. If you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-05-21
The next online PombeTalks will take place on Wednesday 27 May 2020 at 17:00 Central European Time. This time, in addition to the usual pair of research talks, our own Val Wood will show a few of PomBase’s lesser-known features.
Angad Garg, Stewart Schuman’s lab, Memorial Sloan Kettering Cancer Center: Long non-coding RNA control of phosphate homeostasis
José López Hernández, Sarah Zander’s lab, Stowers Institute for Medical Research: Diverse mating strategies in S. pombe affect the spread of wtf meiotic drivers
Val Wood, PomBase: Hidden corners of PomBase: Ten features you might not have seen
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on and June 10 and 24, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-05-20
To complement the overview provided by the fission yeast GO biological process slim, we have created GO slims for the molecular function and cellular component branches of GO. Each slim page provides links to ontology term pages, annotated genes, and to download files containing the slim terms and IDs.

2020-05-20
The PomBase advanced search results panel now allows you to retrieve annotations to any of the fission yeast GO slims or the Mondo disease slim for genes in the results list. For example, you can query for all genes involved in a process and slim the resulting list by molecular function or disease association.

2020-05-18
PomBase has switched from the Disease Ontology (DO) to the Monarch Initiative’s Mondo Disease Ontology (Mondo) for disease gene curation. Mondo covers the same set of disease descriptions as DO, but has a richer hierarchical structure that classifies more specific descriptions into broad categories (e.g. anemia, cancer, kidney disease) suitable for a disease “slim” term set.
PomBase curators are collaborating with Mondo to improve its disease classification, especially in areas that will support inferences that improve fission yeast disease annotation coverage in the new PomBase Mondo slim. The new disease slim is a work in progress, so if there is a particular disease grouping that you would find useful, please let us know.

2020-05-18
PomBase disease gene curation associates disease descriptors with fission yeast orthologs of human disease-causing genes. We have now increased coverage by adding new gene–disease term connections, with 3954 individual annotations to 1195 genes (up from 2588 and 905 respectively in January 2019). Disease associations now cover 24.5% of all fission yeast protein-coding genes, and over one third of those with human orthologs.

2020-05-11
The PomBase team has published an overview of our experience with community curation for fission yeast. In the article, out this week in Database, we reflect on the factors that have made our community’s remarkable, standard-setting achievements possible, and on the benefits we and PomBase users derive from this effort. We highlight the collaboration between authors and professional curators that arises via community curation, and how annotation quality improves as a result.
Watch for invitations to curate your new papers, or see our community curation page for more information.

2020-05-07
The next online PombeTalks will take place on Wednesday 13 May 2020 at 17:00 Central European Time. Speakers:
Sarah Lambert, Institut Curie, Paris, France: Resolution of replication stress in space and time for maintaining genome stability
Cornelia Kilchert, Justus-Liebig-University, Giessen, Germany: RNA-binding proteins in fission yeast - a global perspective
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on May 27 and June 10, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-05-07
PomBase curators have collaborated with the GO Consortium to improve the representation of chromatin silencing and the underlying heterochromatin organization processes in the GO biological process ontology and annotations.
Notably, “chromatin silencing” terms have been removed from GO on the grounds that they conflated various heterochromatin assembly, formation, and maintenance pathways with processes that affect chromatin-mediated repression more indirectly (e.g. tethering to the nuclear envelope). Chromatin silencing is a phenotype resulting from the cumulative effects of these processes, and the Fission Yeast Phenotype Ontology (FYPO) accordingly retains a full suite of “chromatin silencing” terms.
Annotations using the GO chromatin silencing terms were reviewed, and either removed or reannotated based on what could be inferred from the phenotypes, resulting in a substantially revised set of heterochromatin assembly annotations. Further work is required, so please send us any corrections.

2020-05-05
PomBase now uses InterPro Version 79.0, which integrates:
InterPro cites 48466 publications in PubMed. See the InterPro release notes for further information.

2020-05-01
The mitochondrial genome sequence in PomBase has been updated to reflect corrections made in Tao et al. (2019) “Intraspecific Diversity of Fission Yeast Mitochondrial Genomes”.

2020-04-28
Midori Harris, ontology developer and curator at PomBase, has been awarded the 2020 Biocuration Career Award.
Congratulations to Midori and a huge thanks for all that you do for PomBase.

2020-04-22
The first in the new series of online PombeTalks will take place on Wednesday 29 April 2020 at 17:00 Central European Time. Speakers:
Aleksandar Vjeṧtica, Sophie Martin’s lab, University of Lausanne: Cycling for reproductive fidelity: Coupling the cell cycle and re-fertilisation blocks ensures ploidy maintenance during sexual lifecycle
Haitong Hou, Julia Cooper’s lab, NCI & University of Colorado: Centromeres are dismantled by foundational meiotic proteins Spo11 and Rec8
Talks will be streamed live via Zoom. The link will be circulated via pombelist and PombeSlack one day in advance, so make sure you’ve signed up. Also mark your calendars for the next two sessions on May 13 and May 27, and if you’re interested in speaking, please fill out this form.
Thanks to Gautam Dey and the rest of the PombeTalks team for organizing. See you online!

2020-03-23
AnGeLi (developed by Danny Bitton) is a tool that allows you to perform enrichments over gene lists.
AnGeLi has recently been updated to provide 9320 lists, including ontology-based annotations from PomBase (as of 2020-03-04) as well as many additional datasets from the Bähler laboratory.

2020-03-23
The PomBase Advanced search has added new options to the data you can download for your query results:

2020-03-01
PomBase now uses InterPro Version 77.0, which integrates 145 new methods from the CATH-Gene3D (134), and SUPERFAMILY (11) databases. InterPro cites 59894 publications in PubMed. See the InterPro release notes for further information.

2020-02-28
789/1587 publications assigned to community members for curation are finished. A big thank you to everyone who has participated so far. For more details, and all our curation metrics, see https://curation.pombase.org/pombe/stats/annotation

2020-02-20
PomBase recently reached 250,000 annotations to controlled vocabularies and ontologies. The majority (over 90%) are assigned manually from fission yeast experimental data derived from 3776 publications, most of which report low-throughput, hypothesis-driven experiments.
You can query and combine any of these data types in the Advanced search.
Thank you to everyone who contributed to this significant achievement through community curation.

2020-02-05
The PomBase advanced search Advanced search now supports using experimental conditions as search criteria for phenotype annotations. For example, you can now query for genes that show abnormal chromosome segregation mutant phenotypes specifically at high or low temperatures. The search uses the same condition descriptors as Canto and the PomBase web pages.
Note that phenotype queries that have condition constraints can be combined, but pay careful attention to the annotations for the results. Future work will add support for querying for multiple conditions on the same annotation, and for specifying conditions to exclude from results.

2020-02-04
The 14th edition of the “Levures, Modèles et Outils” meeting (LMO14) will be held in July 9-11, 2020, at the University of Strasbourg in France. Registration is open February 3rd to June 30th, and abstracts can be submitted from February 3rd to April 10th. Authors will be notified in early May and the final program will be available in early June.
The sessions will be diverse and present the latest findings using yeast as a model organism on the following topics:
![]()
2020-01-17
PomBase has been awarded Node Service status by the UK node of ELIXIR. ELIXIR-UK Node Services support the bioinformatics and broader biological research communities by providing training and resources that help researchers to find and share data, exchange expertise, and agree on best practices at national, European and international levels. The review panel describes PomBase as a “mature, leading model organism database which is popular, unique, well used, and has a strong user community.”

2020-01-07
To enable fission yeast researchers to manipulate S. pombe molecular biology reproducibly and easily, Aleks Vještica and Magdalena Marek in Sophie Martin’s lab have designed and constructed a series of simple, fully characterized plasmids.
The Stable Integration Vector (SIV) series provides a highly modular toolbox to introduce heterologous sequences more stably was possible with than previously available vectors. The toolkit includes antibiotic resistance markers, promoters, fluorescent tags, and terminators, as well as large set of ready-to-use fluorescent probes to mark organelles and visualize cellular processes.
The work is published in the Journal of Cell Science, and a PomBase publication page is available.

2019-10-16
Data tracks from datasets hosted in the PomBase genome browser can now be browsed and loaded from their respective publication pages. For an example, see Atkinson et al. (2018). Data tracks are now also downloadable from the publication pages.

2019-10-07
We are pleased to announce that the recent PomBase application for continued Wellcome Trust funding was successful. Although the grant was not fully funded, we are confident that we can cover the shortfall by small grants for stand-alone projects and collaborations. We would like to thank the pombe community for their support with the application, and the Wellcome Trust for their continued funding. We look forward to supporting your research until 2025 (and beyond).

2019-10-06
PomBase now uses InterPro Version 76.0, which integrates 277 new methods from the CATH-Gene3D (1), PANTHER (178) and CDD (98) databases. InterPro cites 59846 publications in PubMed. See the InterPro release notes for further information.

2019-08-30
We have loaded data from: Segurado et al. (2003) “A+T-rich islands”, Hayashi et al. (2007) “Pre-replicative complex localization; early and late firing origins”, and Mickle et al. (2007) “Replication origins with functional classification”.
To view the tracks, either follow the hyperlinks above to the respective PomBase publication pages, and click on the “view” link after “Datasets from this publication are available in the PomBase JBrowse genome browser”, or go directly to the browser and click on the “select tracks” button to find the tracks manually.
For anyone new to JBrowse we have a quick start guide.
![]()
2019-07-19
The vibrant fission yeast community now has a Slack channel. Slack provides a forum for the research community. Follow conversations you care about, message colleagues privately, or in groups, ask questions, post responses. All archived and searchable.

2019-07-11
We have loaded the Grech et al. (2019) “Fitness Landscape of the Fission Yeast Genome” dataset into JBrowse. In this study, transposon mutagenesis libraries were created to map transposon insertion sites in the S. pombe genome. From this data, functional elements of the genome were inferred. The tracks from this study can be loaded by a single click from the linked publication page above
Thanks Dan Jeffares for sending us the data.
For anyone new to JBrowse we have a quick start guide.

2019-05-19
The process of tRNA metabolism, and the associated molecular functions have recently been reviewed.
Please let us know if the annotation can be further improved.

2019-04-18
You can now download nucleotide or peptide sequences for genes in Advanced search results in FASTA format, and customise what is included in the FASTA headers (e.g. gene names, product descriptions, sequence coordinates, or various IDs can be included).

2019-04-18
We have added new external links to PomBase gene pages for structure and ortholog predictions:
Protein-specific links to SWISS-MODEL, a fully automated protein structure homology-modelling server, accessible via the ExPASy web server, lead to a SWISS-MODEL Repository page for each sequence and present results. If no structure or model is available, you can either trigger adding an entry to the repository with a single click or easily interactively search for templates and build models in your own SWISS-MODEL workspace.
Ensembl Fungi Compara and Ensembl Pan-taxonomic Compara links lead to orthology predictions from the Ensembl Compara pipeline for fungi and all species, respectively.
PANTHER links retrieve gene information, classification, and predicted orthologs.

2019-04-17
PomBase now uses InterPro Version 73.0, which integrates 1,531 new methods from the CATH-Gene3D (122), CDD (330), PANTHER (1075), Pfam (2), PROSITE profiles (1) and TIGRFAMs (1) databases, and covers 81.2% of UniProt Knowledgebase release 2019_02.
See the news item at InterPro for additional information, including release notes.
![]()
2019-04-16
S. pombe gene information is now included in the Gene Info extension (GIX) for the Chrome and Firefox web browsers. GIX allows you to retrieve information about a gene product directly on any webpage simply by double clicking an official gene name, synonym or supported accession. Searching or double-clicking on text terms retrieves gene function annotation, GO terms, external database links, and interaction data drawn from BioGRID and IntAct. Retrieved gene names are automatically hyperlinked for rapid recursive searches.
GeneInfo is fully open source, available online at GitHub. Tutorial videos, a step-by-step guide, and download links for Firefox Add-ons and the Chrome web storeare available online. GeneInfo was developed by James Knight in the Gingras Lab at the Lunenfeld-Tanenbaum Research Institute in Toronto, Canada.

2019-03-19
The PomBase motif search has been fully integrated into the website, and allows users to find protein motifs and send them directly to the PomBase advanced search.

2019-03-13
Registration is now open for the 29th International Conference on Yeast Genetics and Molecular Biology (ICYGMB), which returns to Gothenburg, Sweden, August 18-22, 2019.
Yeast2019 is the meeting of the international yeast research community where the latest, and even unpublished results are exchanged, and new projects, alliances, and collaborations are founded. Featuring 55 confirmed speakers including keynote lectures by Susan Gasser, Roger Kornberg and Frederick Roth, this conference will contain important news and information for all yeast researchers. A do-not-miss-event.

2019-03-05
PomBase’s advanced search now allows you to retrieve GO slim annotations for any set of search results. To find GO slim annotations for your own list of S. pombe genes, use the advanced search “Gene names and IDs” option, and then use the “Slim” button on the search results page.
See the fission yeast GO slim page and the advanced search documentation for more information.

2019-03-04
Registration is now open for the 26th annual South Eastern Regional Yeast Meeting (SERYM), which will be held April 12-14, 2019, in Atlanta, GA, USA.
Fission yeast’s own Susan Forsburg is the keynote speaker. The meeting brings together researchers who use any type of yeast as a model system, covering diverse, interdisciplinary topics from strategies for treatment of fungal disease to modeling human disease in yeast.
Icon: SERYM 2019

2019-02-27
Registration is now open for the Inaugural Trieste Cell Cycle Meeting, which will be held June 3-6, 2019, in Trieste, Italy.
This is the first of a planned series of biennial cell cycle meetings that will take place in Europe, and will alternate with the Salk Cell Cycle meetings held on the US west coast.
Organisers Rob de Bruin, Snezhana Oliferenko, Rosella Visintin and Peter Thorpe hope to see you there!
Icon derived from meeting image; credit: Chantal Roubinet, Baum lab

2019-02-20
Our analysis of conserved unknown proteins has now been published in Open Biology. In it, PomBase curators consider the challenges and opportunities that conserved, but persistently unstudied, proteins pose for diverse areas of basic and applied biology. We develop metrics to define unknown lists, provide unknown inventories for human and yeast, and classify S. pombe unknowns by numerous orthogonal attributes, all with a view to drawing attention to the unknowns to alleviate their neglect.

2019-02-15
Registration for the 10th International Fission Yeast Meeting is now open!
The conference will take place July 14-19, 2019, in Barcelona, Spain. Early registration closes on April 15th — or when capacity is reached. Please see the conference website for more information, including registration final deadline and costs (some travel grants are available), abstract submission, programme, accommodation, and logistics.

2019-02-12
Congratulations to PomBase project leader Val Wood, who has received the 2019 Exceptional Contributions to Biocuration Award from the International Society for Biocuration. Read more at the ISB site

2019-01-09
We are pleased to announce the release of our improved human disease mappings dataset. This dataset connects human disease causing genes to their S. pombe orthologs.
Diseases are now mapped to the Disease Ontology (DO) and the dataset has been extended by data from Malacards. All disease associations can be accessed from the top level disease page. A disease slim has been created to facilitate browsing of disease categories. Currently, 907 S. pombe genes are associated with disease (up from 610 in the original dataset). This number is due to increase as mappings are still in progress.
Many thanks to DO and Malacards for help in improving this annotation set. Icon courtesy of Julie McMurry.

2018-12-17
Responding to increasing interest in mitochondrial biology, especially relating to ageing, neurogenerative diseases, and processes at the ER-mitochondrion interface, we have reviewed S. pombe mitochondrial GO annotations. Although there is still relatively little fission yeast-derived experimental data in this area, we have refined many inferred annotations for mitochondrial complexes and sub-components as well as some for processes.
You can see all 753 S. pombe mitochondrial annotations on the ontology term page for mitochondrion (GO:0005739).
Icon courtesy of Reactome.

2018-12-03
We have loaded the nucleosome occupancy maps as described in González et al. (2016) PMID: 27662899. This dataset was generated using the paired-end sequencing protocol of Illumina and thus those maps are of higher resolution than those made with single-end (SE) sequencing hosted in the browser since before.
Here is a link that loads the tracks in PomBase JBrowse. And here is a link to our JBrowse quickstart guide.
Many thanks to Paco Antequera for sending us the bigwig files! If you would like us to load any datasets then please get in touch.

2018-11-21
PomBase now offers a new way to display gene lists graphically based on multiple orthogonal annotation types — the Quick Little Tool (QuiLT) for visualisation.
Inspired by our recent analysis of conserved unstudied proteins (see figures 4 and S1 in the manuscript at bioRxiv), QuiLT allows you to create a similar figure for any gene list you create or import using the advanced search. To use QuiLT, follow the link to your search results, then click the “Visualise” button. QuiLT visualisation is also available from the PomBase pages that list genes annotated to an ontology term, and on the Priority unstudied genes page.
To see the Unknowns dataset in QuiLT, visit the unknowns results page and click “Visualise”.
The QuiLT display is interactive, and you can:
See the QuiLT documentation for more information, and contact the curators if you have comments, questions or suggestions.
Many thanks to our star (and only) programmer, Kim Rutherford, for developing QuiLT.

2018-11-20
The Gene Ontology “transmembrane transport” branch has recently been substantially revised. In line with these revisions, PomBase has standardised gene product descriptions for transporters, and overhauled GO annotations to be as complete and comprehensive as possible based on current knowledge.
Icon courtesy of Reactome.

2018-11-17
In a new publication, PomBase curators consider the challenges and opportunities that conserved, but persistently unstudied, proteins pose for diverse areas of basic and applied biology. To draw attention to these proteins, we develop metrics to define unknown lists, provide unknown inventories for human and yeast, classify S. pombe unknowns by numerous orthogonal attributes, and speculate about reasons for their neglect.
A pre-publication manuscript is available at bioRxiv.
![]()
2018-11-14
Our usage statistics informed us that over 20% of devices accessing PomBase are smartphones or tablets. We therefore spent some time optimizing the display for small screens. We hope that you will continue to enjoy PomBase on the go!
![]()
2018-11-08
PomBase curators are major contributors to the Gene Ontology (GO) project — ontology content, annotations, and QC procedures — and co-authors on the new GO NAR Database Issue paper.
We recommend citing the GO and PomBase NAR papers when you use GO data in your analyses.
![]()
2018-11-06
RNAcentral is a comprehensive database of non-coding RNA sequences. PomBase is an RNAcentral Consortium member, and all of the curated non-coding RNAs from PomBase will be available in RNAcentral soon. For more information, see their recent NAR Database Issue paper, as well as current search results for S. pombe RNAs.

2018-10-23
PomBase gene pages now use interactive graphics from PomBase JBrowse to depict the genomic region around the gene. Drag to scroll left and right, double-click to zoom in, shift-double-click to zoom out, and click a feature to see details in a popup. The “Full-screen view” link in the corner opens the fully functional JBrowse in a new tab or window. Reloading a gene page restores the display to the default location and zoom level.

2018-10-15
Our NAR database update “PomBase 2018: user-driven reimplementation of the fission yeast database provides rapid and intuitive access to diverse, interconnected information” is now available. We have updated the Citing PomBase to recommend citing this new paper. Thank you all for guiding the development of the new, improved PomBase, and for your continued usage, curation contributions, and suggestions!

2018-10-10
Registration for the 2019 Fungal Pathogen Genomics Course is now open. The course is hosted by Wellcome Genome Advanced Courses and Scientific Conferences, and will take place May 7-12, 2019, at the Wellcome Genome Campus, Hinxton, UK. Course content provides hands-on training on how to: - Take advantage of unique tools offered by FungiDB, EnsemblFungi, PomBase, SGD/CGD, and MycoCosm/JGI; - Develop testable hypotheses; - Investigate transcriptomics, proteomics and genomics datasets across multiple databases and different user interfaces. Please see the course website for more information, including how to apply, costs (limited bursaries are available), programme, and logistics.

2018-10-06
We are very pleased to announce that we have loaded the transcript tracks from Atkinson et al. (2018) into the PomBase JBrowse genome browser. For a brief introduction to getting started with PomBase JBrowse, please see our documentation page. If you have published data that you would like to see hosted, please get in touch.

2018-08-31
The pombe community mailing list, “pombelist”, is now hosted by the University of Cambridge. The new address for posting messages is pombelist@pombase.org. The link to subscribe has also changed.

2018-05-28
We are very pleased to announce that we have loaded a number of new datasets into the PomBase [JBrowse genome browser (https://www.pombase.org/jbrowse/). These include:
For anyone wanting a quick introduction to our genome browser, Antonia Lock has written “Getting started with PomBase JBrowse”, a basic guide that covers loading tracks, navigating the browser, what metadata we provide, and more.

2018-05-22
PomBase has a new book chapter in Eukaryotic Genomic Databases (Methods and Protocols). This chapter provides insight into the curation philosophy and data organization at PomBase, and provides a guide to using PomBase tailored for infrequent visitors and anyone considering extending their research to include S. pombe. The chapter is free to download courtesy of the Wellcome Trust.

2018-04-16
PomBase has now implemented JBrowse, from the GMOD project, as its genome browser. The new browser offers a number of improvements over the old:
2018-04-05
Sadly, PomBase staff and the fission yeast community note the death of André Goffeau on April 2, 2018. In addition to initiating and coordinating the sequencing of the budding yeast genome, Prof. Goffeau will be remembered for his contributions to the fission yeast genome project and for his knowledge, leadership, and friendship.
2017-11-24
The Genetics Society of America (GSA) has announced two award winners familiar to the model organism database world:
The awards will be presented at the next Yeast Genetics Meeting, at Stanford University in August 2018. Congratulations and thanks to Mike and Steve!
2017-10-24
The new PomBase web site, which has been under development during 2017, has been released. The new site features:
We thank the members of the fission yeast research community who have followed its progress via the preview site, and welcome feedback from all users.
2016-12-11
Reminder: early registration for the 9th International Fission Yeast Meeting in Banff closes Dec. 31, 2016. Please see the conference website at www.pombe2017.com for details.
2016-10-31
Registration for the 9th International Fission Yeast Meeting is now open. The meeting will be held in Banff, Canada from May 14-19, 2017. Early registration closes Dec 1, 2016! Please see our website at www.pombe2017.com for details. We look forward to seeing you in Banff!
- Conference Organizers: Dallan Young, Gordon Chua, Paul Young
2016-10-19
We have updated the data available on the PomBase web site to include manual curation through September 11, 2016.
2016-06-27
In response to planned cuts to database funding, leading model organism researchers have prepared an open letter to NIH Director Dr. Francis Collins to demonstrate support for the independent community-focused databases that are essential to their work. Although PomBase is not directly funded by NIH, we collaborate extensively with those that are, including the GO Consortium and several model organism databases.
The Genetics Society of America website where the letter can be viewed and signed is at http://www.genetics-gsa.org/MODsupport
Please sign the letter to add your voice in support of the databases that help make your research possible. For more information, we recommend an email that Mike Cherry sent to the GO-Friends mailing list, archived at https://mailman.stanford.edu/pipermail/go-friends/2016-June/002355.html
2016-06-15
Several of the PomBase staff, joined by our advisor Sir Paul Nurse, have published a Comment in BMC Biology briefly describing the importance of model organism databases to the success of modern biomedical research:
Oliver SG, Lock A, Harris MA, Nurse P, Wood V. 2016. Model organism databases: essential resources that need the support of both funders and users.
BMC Biol. 2016 14(1): 49. doi: 10.1186/s12915-016-0276-z. PMID:27334346
2016-05-31
We have updated the data available on the PomBase web site to include manual curation through May 12, 2016.
2016-05-09
We have updated the data available on the PomBase web site to include manual curation through April 8, 2016.
2016-04-11
We have updated the data available on the PomBase web site to include manual curation through March 9, 2016.
Important: We have corrected a problem that made erroneous interaction data and literature appear on some gene pages.
The gene pages now include interaction data from the Vo et al. proteome-wide study (curated by BioGRID and imported into PomBase):
Vo TV et al. 2016. A Proteome-wide Fission Yeast Interactome Reveals Network Evolution Principles from Yeasts to Human. Cell 164(1-2): 310-23. doi: 10.1016/j.cell.2015.11.037 PMID:26771498.
The genome browser now includes transcriptome data published in:
Eser P, Wachutka L, Maier KC, Demel C, Boroni M, Iyer S, Cramer P, Gagneur J. 2016. Determinants of RNA metabolism in the Schizosaccharomyces pombe genome. Mol Syst Biol. 12(2): 857. doi: 10.15252/msb.20156526 PMID:26883383.
2016-02-11
We have updated the data available on the PomBase web site to include manual curation through January 25, 2016.
The genome browser includes variation data, in tracks under “Variation”, from natural S. pombe isolates, published in:
Jeffares DC et al. 2015. The genomic and phenotypic diversity of Schizosaccharomyces pombe. Nat Genet. 47(3): 235-241. doi:10.1038/ng.3215 PMID:25665008
New files are now available from the PomBase FTP site, and are linked from pages in the Download Datasets area:
The New and Removed Genes page has been updated to reflect recent deletions and merges.
Note: Ontology graph views are no longer available in the genome browser, so links have been removed from the GO, FYPO, and modification tables on the gene pages. For GO and FYPO, links to external ontology browsers that offer graphical views are available on the Ontology Term pages.
2015-12-02
We have updated the data available on the PomBase web site to include manual curation through November 9, 2015, including 340 community-curated publications.
2015-12-02
We have introduced new features to the Advanced Search:
2015-10-19
A new genetics primer, aimed at researchers interested in using fission yeast as a model system, has recently been published. The primer includes a brief history of fission yeast research, an introduction to available genetic tools, and the use of PomBase for data analysis
Hoffman CS, Wood V, Fantes PA. (2015) An Ancient Yeast for Young Geneticists: A Primer on the Schizosaccharomyces pombe Model System. Genetics 201:403-423. PMID:26447128 DOI:10.1534/genetics.115.181503
2015-09-28
We have updated the data available on the PomBase web site to include manual curation through September 6, 2015.
Errors in the previous FYPOviability.tsv file have been corrected, and we recommend that all users update this file, especially those who downloaded it earlier in September 2015.
2015-09-03
We have updated the data available on the PomBase web site to include manual curation through August 13, 2015, including 300 community-curated publications.
PomBase gene pages now include multi-allele phenotype annotations (i.e. phenotypes of double mutants, triple mutants, etc.). New sub-sections of the gene pages display multi-allele phenotypes at the population and individual cell level, paralleling the organisation of the single allele phenotype display. Compact and full views are available; both show phenotypes with the relevant genotypes and the alleles that make them up, and the full view adds details for evidence, expression, conditions, and references.
The genome browser now includes data tracks for two more publications:
DNA polymerase usage from:
Daigaku Y, Keszthelyi A, Müller CA, Miyabe I, Brooks T, Retkute R, Hubank M, Nieduszynski CA, Carr AM. 2015. A global profile of replicative polymerase usage. Nat Struct Mol Biol. 2015 Mar;22(3):192-8. doi: 10.1038/nsmb.2962 PMID:25664722
Promoters and transcription start sites from:
Li H, Hou J, Bai L, Hu C, Tong P, Kang Y, Zhao X, Shao Z. 2015. Genome-wide analysis of core promoter structures in Schizosaccharomyces pombe with DeepCAGE. RNA Biol. 2015;12(5):525-37. doi: 10.1080/15476286.2015.1022704 PMID:25747261
Codon adaptation index (CAI) values are now included in the Protein Properties section of the gene pages and in the downloadable PeptideStats.tsv file. A file of amino acid composition data is also available from the FTP site and the Protein Datasets page.
The gene page section that was formerly misnamed “species distribution” is now called “taxonomic conservation”.
2015-06-16
We have updated the data available on the PomBase web site to include manual curation through May 26, 2015, including 270 community-curated publications. See you at Pombe 2015 in Kobe!
2015-05-26
Canto, PomBase’s literature curation tool, will be unavailable for approximately 3 weeks starting at 12:00 midnight UK time (BST) tonight, 27 May 2015, while we deploy an upgraded version.
The upgraded Canto will feature an entirely new interface for annotating multi-allele phenotypes and the corresponding genotypes, as well as improved workflows for single-allele phenotypes, GO, etc. All existing annotations will be retained, and users can resume curation using the new and improved features in any unfinished sessions when Canto is back online.
We will announce when the new version of Canto is released to the public.
2015-05-26
We have updated the data available on the PomBase web site to include manual curation through May 8, 2015, including 265 community-curated publications.
2015-04-23
Applications are now being accepted for fellowships to provide financial support for students and postdocs attending the 8th International Fission Yeast Meeting in Kobe, Japan. To apply, follow the instructions sent to the pombase mailing list. The deadline is may 17, 2015 (same as the registration deadline).
2015-04-19
We have updated the data available on the PomBase web site to include manual curation through April 7, 2015, including 260 community-curated publications.The Advanced Search now supports queries for proteins with a specified number of transmembrane domains.
2015-04-19
The abstract submission deadline for the 8th International Fission Yeast Meeting in Kobe, Japan has been extended until midnight Friday, April 24 for posters only. Registration is open until May 17.
2015-04-09
Abstracts are due on Sunday, April 19, 2015 for the 8th International Fission Yeast Meeting in Kobe, Japan. Registration will remain open until May 17, but the abstract submission deadline cannot be extended.
2015-03-23
We have updated the data available on the PomBase web site to include manual curation through March7, 2015, including 250 community-curated publications.The autocomplete feature of the Advanced Search ontology term filter has been improved with respect to response time and relevance of suggested terms.
2015-02-26
Registration for Pombe 2015: 8th International Fission Yeast Meeting is now open at the conference web site, https://amarys-jtb.jp/web/Pombe2015/index.html
The registration deadline is 17 May 2015.
Thanks to Yasushi Hiraoka for this item.
2015-02-16
We have updated the data available on the PomBase web site to include manual curation through February 2, 2015, including 245 community-curated publications. On the gene pages, the interaction tables now provides a bit of descriptive text for each annotation, indicating the nature and direction of the interaction.
2015-01-26
We have updated the data available on the PomBase web site to include manual curation through January 12, 2015, including 240 community-curated publications. The gene page Phenotype section now features a compact default display. A downloadable “viability summary” data file is now available. The PomBase BLAST server has incorporated interface changes made Ensembl-wide.
2014-12-10
To make the Gene Ontology (GO) annotations easier to read on PomBase gene pages, we have introduced a new, streamlined display that presents just the essentials. The summary shows the term name (hyperlinked to the ontology term page), the count of genes annotated to the term, and any annotation extensions. All of the previously visible annotation details are still available – simply click the “Summary” button to switch to the “Full” view. Or click the “+” and “-” icons to expand or collapse the annotation to a single term.
In addition, the top of the Biological Process table now lists any GO slim terms applicable to the gene.
2014-12-10
PomBase has implemented network visualisations for fission yeast in esyN, using data curated by BioGRID and PomBase. esyN is a web-based tool for building, sharing, and viewing network data developed by Dan Bean and Giorgio Favrin in the Cambridge Systems Biology Centre, University of Cambridge, UK.
On gene pages, we have links to gene-specific interaction networks in esyN in the table headers of the Interactions sections:
We also have esyN links on the GO Slim page and on ontology term pages for GO Slim biological process terms. Each GO Slim term links to the HCPIN physical interaction network in esyN (for example, see the “regulation of mitotic cell cycle” network).
2014-11-12
We have updated the data available on the PomBase web site to include manual curation through October 27, 2014, including 225 community-curated publications. The gene page Phenotype section now includes data from the high-throughput microscopy analysis of viable deletion mutants reported in:
Graml V, Studera X, Lawson JL, Chessel A, Geymonat M, Bortfeld-Miller M, Walter T, Wagstaff L, Piddini E, Carazo-Salas RE. A Genomic Multiprocess Survey of Machineries that Control and Link Cell Shape, Microtubule Organization, and Cell-Cycle Progression. Dev Cell. 2014 Oct 27;31(2):227-39. doi: 10.1016/j.devcel.2014.09.005 PMID:25373780. Links to the accompanying SYSGRO resource have been added to the External References section of the gene pages.
The genome browser now includes tracks for intron branch point data from:
Bitton DA, Rallis C, Jeffares DC, Smith GC, Chen YY, Codlin S, Marguerat S, Bähler J. LaSSO, a strategy for genome-wide mapping of intronic lariats and branch points using RNA-seq. Genome Res. 2014 Jul;24(7):1169-79. doi: 10.1101/gr.166819.113 PMID:24709818.
We have greatly improved search results for GO and FYPO annotations: both now follow more relationship types within the ontology to retrieve genes annotated to a term. The PomBase GO search now includes the regulates relationships, so its search results are consistent with those in the GO Consortium’s AmiGO browser. The FYPO search now uses has_part, has_output, and output_of as well as is_a and part_of. The Phenotype section now includes a highlighted sub-header that indicates whether a deletion mutant is viable or inviable. A file of protein complex subunits is available for download, and numerous smaller improvements have been made in the gene pages and static pages.
2014-09-16
We have updated the data available on the PomBase web site to include manual curation through August 30, 2014. Community curation now covers over 200 papers.
2014-08-18
We have updated the data available on the PomBase web site to include manual curation through August 8, 2014. Community curation now covers over 190 papers. Gene pages now include links to the S. pombe PeptideAtlas, a database of peptides identified in tandem mass spectrometry proteomics experiments.
2014-07-17
We have updated the data available on the PomBase web site to include manual curation through July 8, 2014. The gene pages also now display protein modification data from an additional large-scale dataset:
Koch A, Krug K, Pengelley S, Macek B, Hauf S. 2011. Mitotic substrates of the kinase aurora with roles in chromatin regulation identified through quantitative phosphoproteomics of fission yeast. Sci Signal. 4(179): rs6 doi: 10.1126/scisignal.2001588 PMID:21712547
We have also made corrections to some residue positions affected by sequence updates in one of the modification datasets we added last month:
Carpy A, Krug K, Graf S, Koch A, Popic S, Hauf S, Macek B. 2014. Absolute proteome and phosphoproteome dynamics during the cell cycle of fission yeast. Mol Cell Proteomics. 2014 Apr 23. [Epub ahead of print] PMID:24763107
2014-07-08
We have updated the data available on the PomBase web site. The data now includes manual curation through June 6, 2014. In other improvements, a downloadable file of intron sequence data (FASTA format) is now available, and phenotypes are now included in the Target Of section on gene pages.
The gene pages also now display protein modification data from two large-scale datasets:
Link updated 2021-02-04
2014-06-29
PomBase was an early adopter of annotation extensions, which add spatial, temporal, or substrate/target details to GO annotations. The GO Consortium has now published a paper describing its implementation of annotation extensions, in which PomBase examples and its gene page display figure prominently:
Huntley, R.P. et al. (2014) A method for increasing expressivity of Gene Ontology annotations using a compositional approach. BMC Bioinformatics 2014, 15:155. doi:10.1186/1471-2105-15-155 PMID:24885854
2014-05-15
We have updated the data available on the PomBase web site. The data now includes manual curation through April 28, 2014. Transcriptome data from Margeurat et al (2012) is now available as Ensembl Browser tracks.
Thank you to all who have done, or are doing, paper curation in Canto. Over 159 community-curated papers are now included in PomBase.
There are a number of routes to accelerate your data into PomBase, (either through community curation, or by supplying HTP sequence, modification or phenotype data in one of our specified formats), see http://www.pombase.org/submit-data for more details.
As usual, please don’t hesitate to alert us of any other problems with data or site performance, or if you have any questions.
Sincerely yours,
The PomBase Staff
2014-03-20
Data on the PomBase web site now includes manual curation through February 24, 2014. Human orthologs that went missing from gene pages have been restored, and other small improvements have been made to gene pages. Community curation now covers over 130 publications.
2014-02-20
We have once again updated the data available on the PomBase web site. The data now includes manual curation through January 10, 2014, and covers over 100 papers that have been curated in Canto by community members. We again thank all who have contributed curation via Canto.
We have made some improvements to the gene pages. Highlights:
In the genome browser, new data tracks are now available for data from these publications:
Now that more data tracks are available, we have added some categories to the track configuration section to improve organization. Additional documentation is in preparation, and will be announced here when available.
Genome sequences for additional Schizosaccharomyces species (S. japonicus, S. octosporus, and S. cryophilus) have recently become available in Ensembl Fungi, and the PomBase genome browser now includes comparative genomics data, with a view of region comparisons between each new genome and S. pombe.
2014-02-19
We are about to release a data update for PomBase. Please note that there is still a problem with the human orthologs, as originally described on this list in mid-December (see archived message at http://listserver.ebi.ac.uk/pipermail/pombelist/2013/003926.html). We will correct this problem in the next PomBase release, and apologise for any inconvenience in the meantime.
2013-12-08
We have updated the data available on the PomBase web site to include manual curation through November 11, 2013. We now have future meetings available as a calendar or a list. The FAQ and some documentation pages have also been updated.
2021-08-18: Updated to remove out-of-date links (events are now listed only as news items).
2013-11-24
A series of mini-reviews, which were invited in association with the International Fission Yeast Meeting in London, have now been published in Biochemical Society Transactions: http://www.biochemsoctrans.org/bst/041/6/default.htm#c
(Thanks to Jürg Bahler for this item)
2013-11-20
The 2013 PomBase user survey closed at the end of October, and the results are available here (PDF at FTP site). Some highlights have been sent to the pombe mailing list. Many thanks to all who completed the survey.
Link updated 2021-02-04
2013-10-27
With the October 2013 update, gene pages now include “Target Of” annotations, which describe genes that affect the gene of interest. These annotations are essentially the reciprocal of ontology annotation extensions. Each “Target Of” annotation includes a relationship that indicates how the genes are connected, the name and product of the second gene, and a reference. Genes listed under “Target Of” may include upstream regulators or enzymes that modify the product of the gene of interest. For example, the “Target Of” annotations for cdc2 indicate that it is a substrate of, and regulated by, the kinase Wee1 and the phosphatase Cdc25 (among others). At present, “Target Of” data includes annotations derived from GO annotation extensions. We will soon extend it to include data from phenotype annotation extensions.
2013-10-21
The PomBase web site has been updated and now includes manually curated data through October 6, 2013. The number of community-curated papers continues to increase, ensuring that PomBase gene pages contain complete and up-to-date information. We are also pleased to announce that data tracks are now available in the genome browser for data from these two publications:
2013-09-18
To guide current and future development, PomBase is now conducting a user survey, where we invite the fission yeast research community and any other PomBase users to evaluate the resources provided so far and comment on future priorities. The survey should take about 10 minutes to complete. Thank you for your participation!
2013-09-15
We have once again updated the data available on the PomBase web site. The data now includes manual curation through August 11, 2013. We are particularly pleased to note that this update includes annotations from several dozen papers curated by the S. pombe community. Many thanks to all who have done, or are doing, paper curation in Canto.
We also have an updated version of the S. pombe/human ortholog table available upon request.
2013-08-18
At the pombe 2013 meeting in London, PomBase staff received numerous requests display various published data, such as gene expression, histone modifications, etc. in the genome browser. To provide this, we now invite pombe researchers to send data: If you have published any high-throughput experiments that produced data that can be associated with genome sequence coordinates, and thereby displayed as tracks on the PomBase genome browser, please fill out the HTP Data Submission Form. We can also accept large sets of phenotype data via the Phenotype Data Submission Form. If you have any problems or questions, contact us via the PomBase Helpdesk at any time.
2013-07-29
To complement the mailing list and twitter (@PomBase) it is now possible to follow the activities of PomBase and interact with other members of the pombe community via the new LinkedIn Group and Google+.
Links to these are also available from the front page of the PomBase.org site.
2013-07-21
Update: This item dates from July 2013, and the links in it no longer work. \ Please see the Fission Yeast Community page for the current mailing list link. \ (2020-02-18)
The pombe community mailing list, pombelist, has migrated from the Wellcome Trust Sanger Institute and is now hosted by EBI. The new address is pombelist@ebi.ac.uk (please note that the old address no longer works, and will generate an automatic notification including the new address). The link to subscribe has also been updated, and the entire archive is available at the new location.
2013-07-18
We’d like to highlight a few improvements we’ve just made to the PomBase website. Most of the changes affect the gene pages:
In addition, the Motif Search output now includes standard gene names and product descriptions. As we noted in a separate message, CDS coordinate files are once again available from the Downloads, with accurate and up-to-date data.
2013-06-23
At the pombe 2013 conference in London, PomBase officially launched its community curation initiative, which allows researchers to contribute publication-based annotations directly to the database. PomBase curators invite lab heads by individual email to curate newly published papers, providing links to the online curation system and its documentation. Researchers can also initiate curation of any older fission yeast publication in PubMed. Community curation uses the open-source online tool Canto.
2013-06-20
PomBase data now includes manual curation through June 9, 2013, and represents complete annotation for 664 publications (as well as partial curation of many more). A highlight of this month’s literature curation update is the addition of over 9400 phenotype annotations, representing about 95% of the phenotype data from the recently published genome-wide study of cell cycle and cell morphology (Hayles et al. Open Biology May 2013; PMID:23697806). We have also improved the display of allele details for phenotype annotations. Other changes include better support for gene synonyms in the simple search, regular updates to the UTR data files, and a number of minor adjustments to external links in the annotation data tables and the external references section.
2013-05-20
We have updated the data available on the PomBase web site. The data now includes manual curation through 13 May, 2013.
2013-05-13
As of 14 May 2013, the old GeneDB database for S. pombe is no longer available. This resource consisted of static web pages, was not updated after March 2012, and not supported by an underlying relational database. The PomBase site fully supersedes GeneDB S. pombe, and provides improved infrastructure that will meet the current and future needs of the fission yeast community. Please e-mail the helpdesk if you cannot find a replacement for any GeneDB functionality in PomBase.
2013-05-07
We have extended the Gene Expression section of each gene page to support the display of quantitative expression data, and are now showing data from two publications:
We will also soon refine the display of the new expression data, and can add more datasets upon request. We thank Sam Marguerat for preparing the data from both papers for inclusion in PomBase.
We have also updated the PomBase site to include manual curation through April 4, 2013, and we have updated the “all gene names” file on the PomBase ftp site. The new file is available at
https://www.pombase.org/data/names_and_identifiers/gene_IDs_names.tsv
Link updated 2021-02-04
2013-04-11
Carl Singer, who was an integral part of the yeast research community for many years, passed away on February 8, 2013. Throughout his career, Carl supported yeast research both with his engineering expertise and with his good cheer. In tribute to Carl, the Singer family has now set up The Carl Singer Foundation, a charitable foundation dedicated to supporting scientific education in the field of yeast genetics. Questions about the foundation may be directed to Harry Singer at harry [at] thecarlsingerfoundation.org.
Carl’s family would be happy to receive memories of Carl’s life at regards [at] singerinstruments.com.
H/T SGD
2013-04-02
Dear Pombe Fans,
Please remember the imminent deadline (Monday 8th April) to register and submit abstracts for Pombe 2013: http://events.embo.org/13-pombe
Abstracts are also required from all who have already been invited to talk.
And do book your accommodation if you haven't yet done so.
More details are in previous email forwarded below.
Cheers,
-Jürg & Jacky
From: On Behalf Of Bahler, Jurg
Sent: 18 March 2013 17:49
To: pombelist at sanger.ac.uk
Subject: [Pombelist] Pombe 2013: Accommodation, registration & abstracts
Dear Pombe Afficionados,
Only three weeks left to register and submit abstracts for Pombe 2013, by Monday 8th April: http://events.embo.org/13-pombe
Speakers for 10 plenary talks and all workshop talks will be selected from abstracts, and there will be attractive poster prizes.
Payment is only requested after registration, by 10th May.
Important: if you require accommodation, please do book this real soon now. Especially the most cost-effective student accommodation (comfortable, with private bathrooms) may not be available much longer, as it will be put on general sale shortly. Both hotels and student accommodation will sell out in June, so you have to arrange it now. Information on accommodation is available here: http://events.embo.org/13-pombe/application.html
We will provide a number of free registrations for which you can apply during online registration (a few of which are reserved for student members of The Genetics Society: you become eligible if you join them now). The meeting is also supported by the Biochemical Society, so if you are, or become, a member you can apply to them for student bursaries or, if you have been a member for at least 1 year, also for travel grants.
We highly appreciate all the generous contributions from our sponsors so far:
Platinum: EMBO
Gold: Biochemical Society, Genetics Society, Formedium, Sunrise Science Products, Singer Instruments, F1000Research, PomBase/Wellcome Trust
Silver: MDPI - Open Access Publishing, Hybrigenics, Infors, Life Technologies, Bioneer
Bronze: Nature Communications, m2p labs, Imsol, Open Biology
We look very much forward to welcoming you in London this June!
All the best,
-Jürg & Jacky
2013-04-01
We have once again updated the data available on the PomBase web site. The data now includes manual curation through March 6, 2013.
We now expect to be able to update PomBase data every month, and will soon have an automated pipeline in place. We thank all of you for your patience during the long months when updates were infrequent.
You should also see a few small improvements in the site:
Last month we noted an intermittent problem with the “Reference” column display in the data tables. The occurrence of this problem should now be greatly reduced, so please let us know if you see it recurring.
As usual, please don’t hesitate to alert us of any other problems with data or site performance, or if you have any questions.
2013-03-01
We have updated the data available on the PomBase web site. The data now includes manual curation through December 17, 2012, and reflects complete curation of an additional 70 papers.
We have also made some improvements “under the hood” that should make gene page loading much faster. Please let us know if you have any problems with gene pages loading slowly or incompletely, whether or not you have reported issues in the past.
We are aware that there is an intermittent problem with the “Reference” column display in the data tables – sometimes a PubMed ID appears instead of an author name and year. This problem will be fixed as soon as possible. Please alert us if you notice anything else odd or wrong.
2012-11-06
We are pleased to announce that we have updated both data and web site features for PomBase.
Most importantly, we have added new data types, and upgraded the gene pages to display them.
We have also added more annotations of existing data types, bringing the web site content up to September 11, 2012. The new annotations include the first contributions to come in via the new community curation system, and we thank the researchers who are participating in the initial phase of community curation.
New annotation types:
You can see these new data types on many gene pages, such as cdc2 or pka1.
New web site features:
What are annotation extensions?
Annotation extensions are a form of supporting data that can be added GO annotations (or other ontology annotations) to capture additional details not provided by the ontology term itself.
The information in GO annotation extensions encompasses several effector-target relationships, such as
Additional extensions describe spatial and temporal aspects of processes. For example, several S. pombe annotations now include extensions that indicate in which phase of the cell cycle a gene product is found in a cellular component or involved in a process – see the pka1 annotations to “nucleus” (GO:0005634) and “cytoplasm” (GO:0005737).
You may also find the GO wiki page on annotation extensions informative, although it is primarily aimed at curators.
Annotation extensions can also be used with phenotype annotations. The most common usage of phenotype annotation extensions is to capture which gene, protein, etc. was used in an assay. For example, the sam5 (G441E) mutation of pka1 causes nuclear accumulation of Ste11. This is represented by annotation to the ontology term “nuclear protein accumulation” (FYPO:0000255), with the extension “assayed_using(PomBase:SPBC32C12.02)”. Extensions can also indicate expressivity or penetrance for a phenotype.
2012-07-01
Note (2023-06-09): This is an archived news item about PomBase V1. See the documentation page to learn new Advanced search in PomBase V2.
We are pleased to announce that the PomBase web site, www.pombase.org, is now fully live; the preview phase has ended. The site has been updated with an assortment of new features, datatypes, and bug fixes.
More recent data, reflecting additions and changes through March 20, 2012, are now available on gene pages and in search results.
The updated site features a Gene List Search that provides behavior equivalent to GeneDB’s List Download. You can now type or paste lists into the Gene Systematic IDs and Gene Names filters, and use the Query History to combine a gene list search with other search options. For convenience, there is a direct link to a search page pre-configured to accept a list of systematic IDs available in the Find menu, on the Find page, and here: http://www.pombase.org/spombe/query/builder?filter=12
The Advanced Search also now offers:
We have also fixed a Sequence Download error reported by some users, so that the “CDS”, CDS + UTRs”, and “CDS + UTRs + Introns” options now retrieve the correct sequences.
In addition, numerous minor improvements have been made. Please send any questions or comments on the PomBase web site to us at <helpdesk@pombase.org>.
2011-11-27
A preview of PomBase, the new model organism database for the fission yeast Schizosaccharomyces pombe, has been announced to the S. pombe community for testing and feedback. For more on PomBase, see the NAR Database Issue paper (PubMed abstract) or contact the PomBase staff.
2011-10-27
A paper describing PomBase has been published online will be included in the 2012 Database Issue of Nucleic Acids Research. Abstract and open access full text are available.
2011-04-28
2011-04-21
A paper describing the major findings of the Schizosaccharomyces Comparative Genome Project was published today in Science Express and reported changes are included in GeneDB.
Further details are described in the pombe mailing list posts:
2011-02-01
Further information on the pombe mailing list.
2011-01-31
Further details are available on the pombe mailing list.
2010-05-15
The analysis of the fission yeast deletion collection is now published online in Nature Biotechnology.
2010-02-28
Funding was awarded by the Wellcome Trust for a fission yeast Model Organism Database, PomBase.
2009-11-30
Fission yeast is one of the 12 key organisms of the reference genomes project. The goal of this project is to completely annotate twelve reference genomes so that those annotations may be used to effectively seed the automatic annotation efforts of other genome.
2009-10-31
GeneDB (S. pombe) now uses the latest update to Pfam, release 24.0 and 88.5% of fission yeast proteins now contain a match to at least one Pfam domain (increased from 83% in version 23).
2009-09-30
The fission yeast genome and annotation dataset is now available as part of Ensembl Fungi.
2009-08-31
GeneDB is now using Version 23 of the Pfam protein family database. A total of 4154 (83%) S. pombe proteins now have at least one Pfam domain or family assignment (compared to 76% for S. cerevisiae), the highest percentage coverage for any eukaryote.
2008-11-30
S. pombe GeneDB now includes “deep links” to the Biological General Repository for Interaction Datasets (BioGRID) interaction datasets from the ‘Database Cross References’ section of the individual Gene Pages.
2008-04-30
Dynamic repertoire of the fission yeast transcriptome reveals: 94% of the genome is transcribed; extensive variation in different stages and conditions; global and condition-specific coupling between splicing efficiency and transcription; confirms the majority of introns; refines ~75 gene structures; identifies 453 new transcripts 26 of which were predicted to code for proteins.
2008-01-31
The h- mating type region has been provided by Xavier Marsellach and Lorena Aguilar.
2007-12-31
Baumann and Zakian labs identify elusive telomerase RNA (PMID:18157152 and PMID:18157149)
2007-09-30
Wellcome Trust Advanced Course ‘Genome-wide approaches with fission yeast’ held in Hinxton.
2007-05-31
4th International Fission Yeast Meeting held in Copenhagen.
2006-12-31
GeneDB representation of the fission yeast data moved from contigs to chromosomes. See the pombelist archive for details.
2006-09-30
The October issue of the journal Yeast is a fission yeast special issue containing 13 articles and reviews commissioned as a result of the European Fission Yeast Meeting, which are FREE to download.
2006-06-30
The first fission yeast whole proteome localization study is now published: Matsuyama A. et al (2006): ORFeome cloning and global analysis of protein localization in the fission yeast Schizosaccharomyces pombe. Nat Biotech 24, 841-7.
2006-04-30
The fission yeast database survey is now closed. You can view the survey results here.
2006-03-17
The European Fission Yeast Meeting (16th-18th March 2006) and The Fission Yeast Bioinformatics workshop (15th - 16th Mar 2006) both took place at the Wellcome Trust Genome Campus in Hinxton (Cambridge, UK).
2005-11-16
Comparative Genomics of Eukaryotic Microorganisms:
Eukaryotic Genome Evolution, Approaches with Yeasts and Fungi
This conference took place from 12th-17th November 2005 in Sant Feliu de Guixols, Spain. Full details can be found here.
2005-11-12
Second East Coast Regional pombe Meeting
This meeting took place from November 11-13, 2005 in Miami Beach, Florida.
2004-08-31
A project to record published genetic and physical interactions is underway with Mike Tyers and the GRID group at Toronto.
2004-08-29
The meeting was held at UC San Diego on August 24-29, 2004.
2004-04-30
This issue of Methods includes 11 papers for fission yeast protocols including DNA damage checkpoint assays, cell wall analysis, TAP, nuclear envelope integrity assays, GFP imaging, TS mutant creation and plasmid use and construction. See the Methods site for details of the papers including PMIDs.
2021-08-18: Updated to remove out-of-date link.
2003-10-31
Correlations Between Gene Expression and Gene Conservation in Fission Yeast. Mata J, Bahler J. Genome Res. 2003 Nov 12 PMID:14613978
FELINES: a utility for extracting and examining EST-defined introns and exons. Drabenstot SD et al Nucleic Acids Res. 2003 Nov 15;31(22):e141. PMID:14602934
Genome-wide distribution of DNA replication origins at A+T-rich islands in Schizosaccharomyces pombe. Segurado M, De Luis A, Antequera F. EMBO Rep. 2003 Nov;4(11):1048-53. Epub 2003 Oct 17. PMID:14566325
Retrotransposons and their recognition of pol II promoters: a comprehensive survey… Bowen NJ et al Genome Res. 2003 Sep;13(9):1984-97. PMID:12952871
2003-08-31
Egel, R., Copenhagen, Denmark (Ed.) The Molecular Biology of Schizosaccharomyces pombe Genetics, Genomics and Beyond ISBN:3-540-00693-1
2003-02-28
Decottignies A, Sanchez-Perez I, Nurse P Genome Res. 2003 Mar;13(3):399-406. PMID:12618370
2002-12-31
Chen D, Toone WM, Mata J, Lyne R, Burns G, Kivinen K, Brazma A, Jones N, Bähler J. Mol Biol Cell. 2003 Jan;14(1):214-29. PMID:12529438
Repeats are also shown in the diagram below. To see the repeat sequences, download and unzip the contiguated sequence files and view them in Artemis. (See this FAQ for more information.)
Notes:
Recent work by Chad Ellermeier and Gerry Smith suggests that there are only 4 +/- 1 copies of the 6760 bp repeat missing from chromosome 3
This map is a schematic diagram. Distances and overlaps are approximate. Please refer to the sequence data to design experimental constructs.
Centromere map from Wood et al. 2002 The genome sequence of Schizosaccharomyces pombe. Nature 415(6874):871-80 (PMID:11859360). Created by Rhian Gwilliam.
Protein-coding gene characterisation status descriptions
Published: Completely or partially characterised in a small scale experiment, with some published information about the biological role (corresponding to any of the fission yeast GO biological process slim terms)
Biological role inferred: A biological role (as above, a fission yeast GO Process slim term) is inferred from homology to an experimentally characterised gene product
Conserved protein (unknown biological role): Conserved outside the Schizosaccharomyces, but nothing known about the biological role in any organism
Schizosaccharomyces specific protein, uncharacterized: Unpublished and found only in fission yeast (S. pombe, S. octosporus, S. japonicus, S. cryophilus); nothing known about biological role. May be single copy or a member of a multi-member family.
S. pombe specific protein, uncharacterized: Unpublished and found only in S. pombe (not detected in other Schizosaccharomyces species); nothing known about biological role
Dubious: Unlikely to be protein coding
Transposon: A predicted or experimentally verified transposable element.
Note: You can retrieve current lists of genes with each characterisation status using the advanced search. Select the Characterisation status query, then choose a status from the pulldown menu, and submit. A set of historical data recorded at various intervals is available.
| Date | Published | Role inferred | Conserved unknown | Schizo. | S. pombe | Dubious | Transposon | Total |
|---|---|---|---|---|---|---|---|---|
| 2022-12-31 | 2477 | 1931 | 385 | 155 | 103 | 69 | 13 | 5133 |
| 2021-08-31 | 2441 | 1953 | 390 | 164 | 117 | 55 | 13 | 5133 |
| 2020-09-11 | 2389 | 1985 | 408 | 162 | 121 | 55 | 13 | 5133 |
| 2019-12-31 | 2368 | 2010 | 406 | 162 | 122 | 55 | 13 | 5136 |
| 2018-10-05 | 2339 | 2035 | 410 | 163 | 122 | 55 | 13 | 5137 |
| 2017-01-30 | 2235 | 1996 | 511 | 180 | 145 | 54 | 13 | 5171 |
| 2016-09-12 | 2227 | 2034 | 503 | 190 | 149 | 55 | 13 | 5171 |
| 2015-01-19 | 2154 | 2050 | 529 | 178 | 143 | 76 | 13 | 5143 |
| 2014-09-17 | 2124 | 2066 | 537 | 183 | 143 | 77 | 13 | 5143 |
| Date | Published | Role inferred | Conserved unknown | S. pombe | Orphan | Dubious | Transposon | Total |
|---|---|---|---|---|---|---|---|---|
| 2006-08-25 | 1560 | 2433 | 458 | 68 | 403 | 57 | 4979 | |
| 2007-02-27 | 1607 | 2329 | 572 | 47 | 364 | 60 | 4979 | |
| 2008-06-05 | 1715 | 2210 | 634 | 42 | 344 | 57 | 5002 | |
| 2009-01-14 | 1812 | 2132 | 636 | 56 | 318 | 57 | 5011 | |
| 2010-02-22 | 1848 | 2160 | 614 | 55 | 286 | 57 | 5020 | |
| 2010-06-30 | 1916 | 2163 | 592 | 54 | 285 | 58 | 11 | 5025 |
| 2011-04-27 | 1916 | 2169 | 588 | 64 | 315 | 79 | 11 | 5142 |
| 2011-12-16 | 1936 | 2165 | 582 | 66 | 309 | 73 | 11 | 5142 |
| 2013-05-23 | 2012 | 2137 | 541 | 66 | 303 | 71 | 13 | 5143 |
| 2013-12-06 | 2083 | 2096 | 522 | 64 | 294 | 71 | 13 | 5143 |
| 2014-07-14 | 2110 | 2076 | 517 | 64 | 292 | 71 | 13 | 5143 |
| Shorthand | Full name | Description | Comment |
|---|---|---|---|
| Published | Experimentally characterised (or published) | Completely or partially characterised in a small scale experiment, with some published information about the biological role (corresponding to any of the fission yeast GO biological process slim terms) | |
| Role inferred | Role inferred from homology | A biological role (as above, a fission yeast GO process slim term) is inferred from homology to an experimentally characterised gene product | |
| Conserved unknown | Conserved protein (unknown biological role) | Conserved outside the Schizosaccharomyces, but nothing known about the biological role in any organism | |
| Schizo. | Schizosaccharomyces specific protein, uncharacterised | Unpublished and found only in fission yeast (S. pombe, S. octosporus, S. japonicus, S. cryophilus); nothing known about biological role. May be single copy or a member of a multi-member family. | Introduced Sept. 2014 |
| S. pombe | S. pombe specific protein, uncharacterised | Unpublished and found only in S. pombe (not detected in other Schizosaccharomyces species); nothing known about biological role | Introduced Sept. 2014 |
| Transposon | |||
| Dubious | Unlikely to be protein coding | ||
| S. pombe | S. pombe specific families | Unpublished and found only in fission yeast (S. pombe, S. octosporus, S. japonicus, S. cryophilus); nothing known about biological role, but are not single copy (duplications in fission yeast) | Used Aug. 2006-Aug. 2014 |
| Orphan | Sequence orphan, uncharacterised | Unpublished and found only in fission yeast (S. pombe, S. octosporus, S. japonicus, S. cryophilus); nothing known about biological role | Used Aug. 2006-Aug. 2014 |
| Date | Systematic id | Primary name | Before / after change | Coordinates | Comment | Reference |
|---|---|---|---|---|---|---|
| 2023-05-03 | SPAC1F8.07c | pdc101 | after | I:complement(join(101836.. | ||
| 2023-05-03 | SPAC1F8.07c | pdc101 | before | I:complement(join(101836.. | ||
| 2023-01-13 | SPBC17D1.06 | dbp3 | after | II:3338751..3340340 | ||
| 2023-01-13 | SPBC17D1.06 | dbp3 | before | II:3338604..3340340 | ||
| 2023-01-10 | SPAC227.11c | yos9 | after | I:complement(join(514552.. | ||
| 2023-01-10 | SPAC227.11c | yos9 | before | I:complement(join(514552.. | ||
| 2022-12-30 | SPBC1E8.04 | Tf2-10 | after | II:join(1965390.. | ||
| 2022-12-30 | SPBC1E8.04 | Tf2-10 | before | II:join(1965390.. | ||
| 2022-12-26 | SPBP16F5.03c | tra1 | after | II:complement(1894433.. | ||
| 2022-12-26 | SPBP16F5.03c | tra1 | before | II:complement(1894433.. | ||
| 2022-12-12 | SPAC9G1.07 | after | I:join(1983182.. | |||
| 2022-12-12 | SPAC9G1.07 | before | I:1983182..1984438 | |||
| 2022-12-12 | SPBC3B8.10 | ina17 | after | II:join(3390968.. | ||
| 2022-12-12 | SPBC3B8.10 | ina17 | before | II:join(3390968.. | ||
| 2022-12-12 | SPBP4H10.12 | after | II:join(2895800.. | |||
| 2022-12-12 | SPBP4H10.12 | before | II:join(2895855.. | |||
| 2022-12-02 | SPAPB1E7.05 | gde1 | after | I:join(3293630.. | ||
| 2022-12-02 | SPAPB1E7.05 | gde1 | before | I:3294111..3297341 | ||
| 2022-10-04 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1169936.. | ||
| 2022-10-04 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1169939.. | ||
| 2022-10-04 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | ||
| 2022-10-04 | SPBC16E9.16c | lsd90 | before | II:complement(join(1947985.. | ||
| 2022-10-04 | SPBC32F12.08c | duo1 | after | II:complement(join(2797658.. | ||
| 2022-10-04 | SPBC32F12.08c | duo1 | before | II:complement(join(2797652.. | ||
| 2022-10-04 | SPCC417.03 | after | III:join(1672003.. | |||
| 2022-10-04 | SPCC417.03 | before | III:join(1672003.. | |||
| 2022-09-16 | SPBC32H8.08c | omh5 | after | II:complement(join(1465811.. | ||
| 2022-09-16 | SPBC32H8.08c | omh5 | before | II:complement(join(1465811.. | ||
| 2022-08-25 | SPAC23E2.02 | lsd2 | after | I:join(446770.. | ||
| 2022-08-25 | SPAC23E2.02 | lsd2 | before | I:join(446491.. | ||
| 2022-08-25 | SPAC343.16 | lys2 | after | I:1675823..1677895 | ||
| 2022-08-25 | SPAC343.16 | lys2 | before | I:1675730..1677895 | ||
| 2022-08-25 | SPBC16H5.11c | skb1 | after | II:join(2277275.. | ||
| 2022-08-25 | SPBC16H5.11c | skb1 | before | II:join(2277215.. | ||
| 2022-08-25 | SPBC13A2.02 | nup82 | after | II:3400618..3403014 | ||
| 2022-08-25 | SPBC13A2.02 | nup82 | before | II:3400603..3403014 | ||
| 2022-08-25 | SPBC13G1.14c | rns1 | after | II:complement(join(3727332.. | ||
| 2022-08-25 | SPBC13G1.14c | rns1 | before | II:complement(join(3727332.. | ||
| 2022-08-25 | SPBC16A3.01 | spn3 | after | II:complement(join(4299042.. | ||
| 2022-08-25 | SPBC16A3.01 | spn3 | before | II:complement(join(4299042.. | ||
| 2022-08-25 | SPBC25D12.05 | trm1 | after | II:3723455..3725029 | ||
| 2022-08-25 | SPBC25D12.05 | trm1 | before | II:3723383..3725029 | ||
| 2022-08-25 | SPBC31F10.17c | after | II:complement(join(3788317.. | |||
| 2022-08-25 | SPBC31F10.17c | before | II:complement(join(3788317.. | |||
| 2022-08-25 | SPBC887.07 | mrpl38 | after | II:join(3551348.. | ||
| 2022-08-25 | SPBC887.07 | mrpl38 | before | II:join(3551318.. | ||
| 2022-08-25 | SPBP8B7.05c | nce103 | after | II:complement(3641216.. | ||
| 2022-08-25 | SPBP8B7.05c | nce103 | before | II:complement(3641216.. | ||
| 2022-08-25 | SPCC1259.12c | gid1 | after | III:complement(join(1056598.. | ||
| 2022-08-25 | SPCC1259.12c | gid1 | before | III:complement(join(1056598.. | ||
| 2022-08-25 | SPCC126.15c | sec65 | after | III:complement(join(2142679.. | ||
| 2022-08-25 | SPCC126.15c | sec65 | before | III:complement(join(2142679.. | ||
| 2022-08-25 | SPCC1620.10 | cwf26 | after | III:join(2163220.. | ||
| 2022-08-25 | SPCC1620.10 | cwf26 | before | III:join(2163205.. | ||
| 2022-08-25 | SPCC1682.01 | qcr9 | after | III:join(371284.. | ||
| 2022-08-25 | SPCC1682.01 | qcr9 | before | III:join(371230.. | ||
| 2022-08-25 | SPCC1682.05c | srp68 | after | III:complement(join(379065.. | ||
| 2022-08-25 | SPCC1682.05c | srp68 | before | III:complement(join(379065.. | ||
| 2022-08-25 | SPCC569.03 | after | III:complement(join(2430334.. | |||
| 2022-08-25 | SPCC569.03 | before | III:complement(join(2430334.. | |||
| 2022-08-25 | SPCC622.11 | lmb1 | after | III:join(1417271.. | ||
| 2022-08-25 | SPCC622.11 | lmb1 | before | III:join(1417100.. | ||
| 2022-08-25 | SPCC825.04c | naa40 | after | III:complement(1030256.. | ||
| 2022-08-25 | SPCC825.04c | naa40 | before | III:complement(1030256.. | ||
| 2022-08-25 | SPCP1E11.06 | apl4 | after | III:2402067..2404577 | ||
| 2022-08-25 | SPCP1E11.06 | apl4 | before | III:2401980..2404577 | ||
| 2022-08-25 | SPBC14C8.01c | cut2 | after | II:complement(2203316.. | ||
| 2022-08-25 | SPBC14C8.01c | cut2 | before | II:complement(2203316.. | ||
| 2022-08-25 | SPBC1703.06 | pof10 | after | II:join(2925563.. | ||
| 2022-08-25 | SPBC1703.06 | pof10 | before | II:join(2925512.. | ||
| 2022-08-25 | SPBC1709.17 | met7 | after | II:join(1132227.. | ||
| 2022-08-25 | SPBC1709.17 | met7 | before | II:join(1132170.. | ||
| 2022-08-25 | SPBC18E5.12c | mas2 | after | II:complement(2096528.. | ||
| 2022-08-25 | SPBC18E5.12c | mas2 | before | II:complement(2096528.. | ||
| 2022-08-25 | SPBC19G7.04 | after | II:join(2349611.. | |||
| 2022-08-25 | SPBC19G7.04 | before | II:join(2349593.. | |||
| 2022-08-25 | SPBC2A9.05c | tvp23 | after | II:complement(join(2956469.. | ||
| 2022-08-25 | SPBC2A9.05c | tvp23 | before | II:complement(join(2956469.. | ||
| 2022-08-25 | SPBC30B4.08 | eri1 | after | II:join(1320740.. | ||
| 2022-08-25 | SPBC30B4.08 | eri1 | before | II:join(1320692.. | ||
| 2022-08-25 | SPBC30D10.09c | hva22 | after | II:join(3083470.. | SPD:10/10A04 | |
| 2022-08-25 | SPBC30D10.09c | before | II:join(3083317.. | SPD:10/10A04 | ||
| 2022-08-25 | SPBC336.10c | tif512 | after | II:complement(2758761.. | ||
| 2022-08-25 | SPBC336.10c | tif512 | before | II:complement(2758761.. | ||
| 2022-08-25 | SPBC337.16 | cho1 | after | II:join(1058422.. | ||
| 2022-08-25 | SPBC337.16 | cho1 | before | II:join(1058347.. | ||
| 2022-08-25 | SPBC428.01c | nup107 | after | II:complement(join(439274.. | ||
| 2022-08-25 | SPBC428.01c | nup107 | before | II:complement(join(439274.. | ||
| 2022-08-25 | SPBC428.18 | cdt1 | after | II:477431..478699 | ||
| 2022-08-25 | SPBC428.18 | cdt1 | before | II:477365..478699 | ||
| 2022-08-25 | SPBC582.05c | brc1 | after | II:complement(join(426160.. | ||
| 2022-08-25 | SPBC582.05c | brc1 | before | II:complement(join(426160.. | ||
| 2022-08-25 | SPBC582.07c | rpn7 | after | II:complement(430551.. | ||
| 2022-08-25 | SPBC582.07c | rpn7 | before | II:complement(430551.. | ||
| 2022-08-25 | SPBC582.08 | alt1 | after | II:join(432595.. | SPD:36/36B08 | |
| 2022-08-25 | SPBC582.08 | before | II:join(432550.. | SPD:36/36B08 | ||
| 2022-08-25 | SPBC685.09 | orc2 | after | II:2782066..2783565 | ||
| 2022-08-25 | SPBC685.09 | orc2 | before | II:2781958..2783565 | ||
| 2022-08-25 | SPBC8D2.10c | rmt3 | after | II:complement(join(1376341.. | ||
| 2022-08-25 | SPBC8D2.10c | rmt3 | before | II:complement(join(1376341.. | ||
| 2022-08-25 | SPBC947.03c | naa38 | after | II:join(676761.. | ||
| 2022-08-25 | SPBC947.03c | naa38 | before | II:join(676629.. | ||
| 2022-08-25 | SPAC1071.09c | after | I:complement(3870660.. | |||
| 2022-08-25 | SPAC1071.09c | before | I:complement(3870660.. | |||
| 2022-08-25 | SPAC17H9.04c | dri1 | after | I:complement(2009905.. | remove MSKLPSPT | |
| 2022-08-25 | SPAC17H9.04c | dri1 | before | I:complement(2009905.. | remove MSKLPSPT | |
| 2022-08-25 | SPAC1952.03 | otu2 | after | I:join(4971189.. | ||
| 2022-08-25 | SPAC1952.03 | otu2 | before | I:join(4971117.. | ||
| 2022-08-25 | SPAC1952.15c | rec24 | after | I:complement(join(4996030.. | ||
| 2022-08-25 | SPAC1952.15c | rec24 | before | I:complement(join(4996030.. | ||
| 2022-08-25 | SPAC19A8.06 | pbr1 | after | I:complement(2475966.. | ||
| 2022-08-25 | SPAC19A8.06 | pbr1 | before | I:complement(2475966.. | ||
| 2022-08-25 | SPAC1B2.03c | elo2 | after | I:complement(join(2811438.. | remove MDLTGAH to get /score=2039.31 | |
| 2022-08-25 | SPAC1B2.03c | elo2 | before | I:complement(join(2811438.. | remove MDLTGAH to get /score=2039.31 | |
| 2022-08-25 | SPAC1B3.18c | mrps18 | after | I:complement(4967223.. | ||
| 2022-08-25 | SPAC1B3.18c | mrps18 | before | I:complement(4967223.. | ||
| 2022-08-25 | SPAC1F12.09 | gpi17 | after | I:join(3818803.. | ||
| 2022-08-25 | SPAC1F12.09 | gpi17 | before | I:join(3818668.. | ||
| 2022-08-25 | SPAC22F8.10c | sap145 | after | I:complement(4804630.. | ||
| 2022-08-25 | SPAC22F8.10c | sap145 | before | I:complement(4804630.. | ||
| 2022-08-25 | SPAC23C11.17 | mdm28 | after | I:join(2167206.. | remove MKYPRTHIQFPS | |
| 2022-08-25 | SPAC23C11.17 | mdm28 | before | I:join(2167170.. | remove MKYPRTHIQFPS | |
| 2022-08-25 | SPAC25B8.08 | after | I:4168263..4169984 | |||
| 2022-08-25 | SPAC25B8.08 | before | I:4168212..4169984 | |||
| 2022-08-25 | SPAC26A3.09c | rga2 | after | I:complement(3348569.. | ||
| 2022-08-25 | SPAC26A3.09c | rga2 | before | I:complement(3348569.. | ||
| 2022-08-25 | SPAC26F1.02 | pnn1 | after | I:complement(join(5181982.. | ||
| 2022-08-25 | SPAC26F1.02 | pnn1 | before | I:complement(join(5181982.. | ||
| 2022-08-25 | SPAC26F1.14c | aif1 | after | I:5146273..5148000 | ||
| 2022-08-25 | SPAC26F1.14c | aif1 | before | I:5146165..5148000 | ||
| 2022-08-25 | SPAC4G9.11c | cmb1 | after | I:complement(2275578.. | ||
| 2022-08-25 | SPAC4G9.11c | cmb1 | before | I:complement(2275578.. | ||
| 2022-08-25 | SPAC4H3.06 | after | I:join(3837449.. | |||
| 2022-08-25 | SPAC4H3.06 | before | I:join(3837431.. | |||
| 2022-08-25 | SPAC521.02 | wss1 | after | I:843296..844084 | ||
| 2022-08-25 | SPAC521.02 | wss1 | before | I:843233..844084 | ||
| 2022-08-25 | SPAC589.02c | med13 | after | I:complement(join(3095075.. | truncated 40 AA | |
| 2022-08-25 | SPAC589.02c | med13 | before | I:complement(join(3095075.. | truncated 40 AA | |
| 2022-08-25 | SPAC637.09 | rex1 | after | I:4555423..4557294 | ||
| 2022-08-25 | SPAC637.09 | rex1 | before | I:4555399..4557294 | ||
| 2022-08-25 | SPAC688.09 | rim2 | after | I:join(3127689.. | ||
| 2022-08-25 | SPAC688.09 | rim2 | before | I:join(3127647.. | ||
| 2022-08-25 | SPAP8A3.12c | tpp2 | after | I:complement(5336815.. | ||
| 2022-08-25 | SPAP8A3.12c | tpp2 | before | I:complement(5336815.. | ||
| 2022-08-25 | SPAPB18E9.01 | trm5 | after | I:join(3974340.. | ||
| 2022-08-25 | SPAPB18E9.01 | trm5 | before | I:join(3974310.. | ||
| 2022-04-03 | SPAC1002.01 | mrx11 | after | I:1798347..1798835 | remove final exon | |
| 2022-04-03 | SPAC1002.01 | mrx11 | before | I:join(1798347.. | remove final exon | |
| 2022-04-03 | SPAC1002.12c | after | I:complement(1818695.. | |||
| 2022-04-03 | SPAC1002.12c | before | I:complement(1818695.. | |||
| 2022-04-03 | SPAC1002.17c | urg2 | after | I:complement(1831012.. | change MSTTTTVSAIRTVEE to MSNITISSHPV | |
| 2022-04-03 | SPAC1002.17c | urg2 | before | I:complement(1831012.. | change MSTTTTVSAIRTVEE to MSNITISSHPV | |
| 2022-04-03 | SPAC1565.08 | cdc48 | after | I:join(1306457.. | ||
| 2022-04-03 | SPAC1565.08 | cdc48 | before | I:join(1306439.. | ||
| 2022-04-03 | SPAC167.04 | pam17 | after | I:complement(join(1554001.. | ||
| 2022-04-03 | SPAC167.04 | pam17 | before | I:complement(join(1554001.. | ||
| 2022-04-03 | SPAC17A5.02c | dbr1 | after | I:complement(join(1754033.. | trim to MRVGVQGC | |
| 2022-04-03 | SPAC17A5.02c | dbr1 | before | I:complement(join(1754033.. | trim to MRVGVQGC | |
| 2022-04-03 | SPAC1A6.10 | tcd1 | after | I:1090729..1092135 | truncate at MAG (AA20) | |
| 2022-04-03 | SPAC1A6.10 | tcd1 | before | I:1090678..1092135 | truncate at MAG (AA20) | |
| 2022-04-03 | SPAC227.11c | yos9 | after | I:complement(join(514552.. | ||
| 2022-04-03 | SPAC227.11c | yos9 | before | I:complement(join(514552.. | ||
| 2022-04-03 | SPAC2F7.08c | snf5 | after | I:complement(546664.. | ||
| 2022-04-03 | SPAC2F7.08c | snf5 | before | I:complement(546664.. | ||
| 2022-04-03 | SPAC30D11.03 | ddx27 | after | I:complement(join(1116057.. | trim to MET at AA41 | |
| 2022-04-03 | SPAC30D11.03 | ddx27 | before | I:complement(join(1116057.. | trim to MET at AA41 | |
| 2022-04-03 | SPAC3H1.05 | ste24 | after | I:join(1938990.. | new start MGIL | |
| 2022-04-03 | SPAC3H1.05 | ste24 | before | I:join(1938900.. | new start MGIL | |
| 2022-04-03 | SPAC3H1.12c | snt2 | after | I:complement(1961710.. | ||
| 2022-04-03 | SPAC3H1.12c | snt2 | before | I:complement(1961710.. | ||
| 2022-04-03 | SPAC4G8.07c | trm2 | after | I:complement(join(774000.. | ||
| 2022-04-03 | SPAC4G8.07c | trm2 | before | I:complement(join(774000.. | ||
| 2022-04-03 | SPAC56E4.04c | cut6 | after | I:complement(join(1246095.. | trim to MET at AA34 | |
| 2022-04-03 | SPAC56E4.04c | cut6 | before | I:complement(join(1246095.. | trim to MET at AA34 | |
| 2022-04-03 | SPAC56F8.04c | ppt1 | after | I:complement(1133226.. | ||
| 2022-04-03 | SPAC56F8.04c | ppt1 | before | I:complement(join(1133226.. | ||
| 2022-04-03 | SPAC57A7.12 | ssz1 | after | I:complement(join(1515089.. | ||
| 2022-04-03 | SPAC57A7.12 | ssz1 | before | I:complement(join(1515089.. | ||
| 2022-04-03 | SPAC630.14c | tup12 | after | I:complement(join(374683.. | ||
| 2022-04-03 | SPAC630.14c | tup12 | before | I:complement(join(374683.. | ||
| 2021-07-27 | SPAC4F10.02 | aap1 | after | I:join(4832911.. | PMID:34169534 | |
| 2021-07-27 | SPAC4F10.02 | aap1 | before | I:join(4832929.. | PMID:34169534 | |
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1169939.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.2 | crd1 | after | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.2 | crd1 | before | I:complement(join(1169939.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1169939.. | ||
| 2020-05-01 | SPAC2E12.05 | wtf1 | after | I:join(5064781.. | pseudo->coding | PMID:28631610, |
| 2020-05-01 | SPAC2E12.05 | wtf1 | before | I:5064305..5066231 | pseudo->coding | PMID:28631610 |
| 2020-05-01 | SPBC1706.02c | wtf2 | after | II:complement(join(593185.. | PMID:28631610, | |
| 2020-05-01 | SPBC1706.02c | wtf2 | before | II:complement(join(593188.. | PMID:28631610, | |
| 2020-05-01 | SPCC162.04c | wtf13 | after | III:complement(join(1580123.. | PMID:28631610, | |
| 2020-05-01 | SPCC162.04c | wtf13 | before | III:complement(join(1580123.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.06c | wtf17 | after | III:complement(join(1805166.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.06c | wtf17 | before | III:complement(join(1805166.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.07c | wtf18 | after | III:complement(join(1807004.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.07c | wtf18 | before | III:complement(join(1807004.. | PMID:28631610, | |
| 2020-05-01 | SPCC306.10 | wtf8 | after | III:join(427445.. | PMID:28631610 | |
| 2020-05-01 | SPCC306.10 | wtf8 | before | III:join(427445.. | ||
| 2020-05-01 | SPCC548.02c | wtf3 | after | III:complement(join(219185.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.02c | wtf3 | before | III:complement(join(219185.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.03c | wtf4 | after | III:complement(join(221199.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.03c | wtf4 | before | III:complement(join(221199.. | PMID:28631610, | |
| 2020-05-01 | SPCC553.05c | wtf6 | after | III:complement(join(297140.. | introduces stop codon at position 25 | PMID:28631610, |
| 2020-05-01 | SPCC553.05c | wtf6 | before | III:complement(join(297354.. | introduces stop codon at position 25 | PMID:28631610, |
| 2020-05-01 | SPCC576.16c | wtf22 | after | III:complement(join(2109178.. | introduces stop codon at position 50 | PMID:28631610, |
| 2020-05-01 | SPCC576.16c | wtf22 | before | III:complement(join(2109181.. | introduces stop codon at position 50 | PMID:28631610 |
| 2020-05-01 | SPCC622.21 | wtf12 | after | III:join(1401530.. | introduces stop codon at position 274 | PMID:30991417, |
| 2020-05-01 | SPCC622.21 | wtf12 | before | III:join(1401530.. | introduces stop codon at position 274 | PMID:30991417 |
| 2020-05-01 | SPCC736.05 | wtf7 | after | III:join(320617.. | PMID:28631610, | |
| 2020-05-01 | SPCC736.05 | wtf7 | before | III:join(320608.. | PMID:28631610, | |
| 2020-05-01 | SPCC830.02 | wtf24 | after | III:join(2181204.. | introduces stop codon at position 145 | PMID:28631610, |
| 2020-05-01 | SPCC830.02 | wtf24 | before | III:join(2181204.. | introduces stop codon at position 145 | PMID:28631610, |
| 2020-04-30 | SPMIT.03 | cox1-I2b | after | mitochondrial:6965.. | ||
| 2020-04-30 | SPMIT.03 | cox1-I2b | before | mitochondrial:<6845.. | ||
| 2020-04-30 | SPMIT.01 | cox1 | after | mitochondrial:join(4885.. | ||
| 2020-04-30 | SPMIT.01 | cox1 | before | mitochondrial:join(4886.. | ||
| 2020-04-30 | SPMIT.03 | cox1-I2b | after | mitochondrial:<6845.. | ||
| 2020-04-30 | SPMIT.03 | before | mitochondrial:<6966.. | |||
| 2020-04-30 | SPMIT.04 | cox3 | after | mitochondrial:8961.. | ||
| 2020-04-30 | SPMIT.04 | cox3 | before | mitochondrial:8947.. | ||
| 2020-04-30 | SPMIT.05 | cob1 | after | mitochondrial:join(10175.. | ||
| 2020-04-30 | SPMIT.05 | cob1 | before | mitochondrial:join(10173.. | ||
| 2020-04-30 | SPMIT.06 | after | mitochondrial:<10859.. | |||
| 2020-04-30 | SPMIT.06 | before | mitochondrial:10857.. | |||
| 2020-04-30 | SPMIT.07 | atp6 | after | mitochondrial:14758.. | ||
| 2020-04-30 | SPMIT.07 | atp6 | before | mitochondrial:14756.. | ||
| 2020-04-30 | SPMIT.11 | cox2 | after | mitochondrial:18563.. | ||
| 2020-04-30 | SPMIT.11 | cox2 | before | mitochondrial:18561.. | ||
| 2019-10-16 | SPBPB8B6.04c | grt1 | after | II:complement(join(49143.. | ||
| 2019-10-16 | SPBPB8B6.04c | grt1 | before | II:complement(join(49152.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | after | II:complement(350783.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | before | II:complement(join(350692.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | after | II:complement(join(350692.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | before | II:complement(350783.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | after | II:complement(350783.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | before | II:complement(352200.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | after | II:complement(352200.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | before | II:complement(join(350692.. | ||
| 2018-02-19 | SPBPB8B6.04c | grt1 | after | II:complement(join(49152.. | ||
| 2018-02-19 | SPBPB8B6.04c | grt1 | before | II:complement(join(49143.. | ||
| 2017-09-14 | SPBC577.05c | rec27 | after | II:complement(join(757566.. | PMID:28469148 | |
| 2017-09-14 | SPBC577.05c | rec27 | before | II:complement(join(757566.. | PMID:28469148 | |
| 2017-05-02 | SPAC9G1.15c | mzt1 | after | I:complement(1985350.. | ||
| 2017-05-02 | SPAC9G1.15c | mzt1 | before | I:complement(1985350.. | ||
| 2017-04-17 | SPBC530.13 | lsc1 | after | II:join(824374.. | Frameshifted by Chr_II:825012!G→A | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-17 | SPBC530.13 | lsc1 | before | II:join(824374.. | Frameshifted by Chr_II:825012!G→A | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1071.01c | pta1 | after | I:complement(join(3855626.. | Frameshifted by Chr_I:3855790!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1071.01c | pta1 | before | I:complement(3855780.. | Frameshifted by Chr_I:3855790!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC12B10.09 | pet801 | after | I:join(4588487.. | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPAC12B10.09 | pet801 | before | I:join(4588250.. | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPAC1486.05 | nup189 | after | I:join(3197028.. | Frameshifted by Chr_I:3197528!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1486.05 | nup189 | before | I:join(3197028.. | Frameshifted by Chr_I:3197528!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29A4.03c | mrps9 | after | I:join(5142407.. | Frameshifted by Chr_I:5142627!A→AG | PMID:26615217; pers. comm. Li-Lin Du, |
| 2017-04-12 | SPAC29A4.03c | before | I:join(5142407.. | Frameshifted by Chr_I:5142627!A→AG | PMID:26615217; pers. comm. Li-Lin Du, | |
| 2017-04-12 | SPAC29E6.03c | uso1 | after | I:complement(join(4405990.. | Frameshifted by Chr_I:4407494!T→TG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.03c | uso1 | before | I:complement(join(4405990.. | Frameshifted by Chr_I:4407494!T→TG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.04 | nnf1 | after | I:join(4409773.. | Frameshifted by Chr_I:4410191!CG→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.04 | nnf1 | before | I:join(4409773.. | Frameshifted by Chr_I:4410191!CG→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.06 | mvp1 | after | I:complement(join(3459233.. | Frameshifted by Chr_I:3460318!T→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.06 | mvp1 | before | I:complement(join(3459233.. | Frameshifted by Chr_I:3460318!T→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.09 | sod22 | after | I:complement(join(3450056.. | Frameshifted by Chr_I:3450130!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.09 | sod22 | before | I:complement(join(3450114.. | Frameshifted by Chr_I:3450130!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC688.08 | srb8 | after | I:join(3123163.. | Frameshifted by Chr_I:3125118!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC688.08 | srb8 | before | I:join(3123163.. | Frameshifted by Chr_I:3125118!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | Frameshifted by Chr_II:3040332!C→CG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC13E7.01 | cwf22 | before | II:join(3037988.. | Frameshifted by Chr_II:3040332!C→CG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC14C8.09c | dbl3 | after | II:complement(join(2219430.. | Frameshifted by Chr_II:2219928!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC14C8.09c | dbl3 | before | II:complement(join(2219430.. | Frameshifted by Chr_II:2219928!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16D10.10 | tad2 | after | II:join(3618117.. | Frameshifted by Chr_II:3619003!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16D10.10 | tad2 | before | II:join(3618117.. | Frameshifted by Chr_II:3619003!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | Frameshifted by Chr_II:1948953!GA→G and Chr_II:1950050!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16E9.16c | lsd90 | before | II:complement(join(1947985.. | Frameshifted by Chr_II:1948953!GA→G and Chr_II:1950050!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1A4.06c | tam41 | after | II:complement(join(1987044.. | Frameshifted by Chr_II:1987101!CG→C and Chr_II:1987117!TG→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1A4.06c | tam41 | before | II:complement(join(1987044.. | Frameshifted by Chr_II:1987101!CG→C and Chr_II:1987117!TG→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1E8.03c | after | II:complement(join(1960166.. | Frameshifted by Chr_II:1960392!A→AG | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC1E8.03c | before | II:complement(1960384.. | Frameshifted by Chr_II:1960392!A→AG | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC23G7.06c | after | II:complement(join(2106448.. | Frameshifted by Chr_II:2108180!T→TA | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC23G7.06c | before | II:complement(join(2106448.. | Frameshifted by Chr_II:2108180!T→TA | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC29A3.08 | pof4 | after | II:join(2053033.. | Frameshifted by Chr_II:2053516!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC29A3.08 | pof4 | before | II:join(2053033.. | Frameshifted by Chr_II:2053516!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC32F12.08c | duo1 | after | II:complement(join(2797652.. | Frameshifted by Chr_II:2798040!CT→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC32F12.08c | duo1 | before | II:complement(2798007.. | Frameshifted by Chr_II:2798040!CT→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC4F6.10 | vps901 | after | II:join(2708076.. | Frameshifted by Chr_II:2709414!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC4F6.10 | vps901 | before | II:join(2708076.. | Frameshifted by Chr_II:2709414!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC17G8.01c | trl1 | after | I:complement(join(2341346.. | Frameshifted by Chr_I:2343703!G→GA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC17G8.01c | trl1 | before | I:complement(join(2341346.. | Frameshifted by Chr_I:2343703!G→GA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC3A12.04c | rpp1 | after | I:complement(join(1424660.. | Frameshifted by Chr_I:1424708!CA→C | PMID:26615217, |
| 2017-04-04 | SPAC3A12.04c | rpp1 | before | I:complement(join(1424697.. | Frameshifted by Chr_I:1424708!CA→C | PMID:26615217, |
| 2017-04-04 | SPAC823.04 | rrp36 | after | I:join(2587729.. | Frameshifted by Chr_I:2588066!C→CA and Chr_I:2588021!C→CA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC823.04 | rrp36 | before | I:join(2587729.. | Frameshifted by Chr_I:2588066!C→CA and Chr_I:2588021!C→CA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAP27G11.10c | nup184 | after | I:complement(join(1624885.. | Frameshifted by Chr_I:1625092!T→TC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAP27G11.10c | nup184 | before | I:complement(join(1625076.. | Frameshifted by Chr_I:1625092!T→TC | PMID:26615217; pers. comm. Li-Lin Du |
| 2016-04-19 | SPBC21B10.12 | rec6 | after | II:complement(join(1649038.. | PMID:26917764 | |
| 2016-04-19 | SPBC21B10.12 | rec6 | before | II:complement(join(1649038.. | PMID:26917764 | |
| 2016-03-17 | SPAC22F3.11c | snu23 | after | I:join(682874.. | based on ribosome profiling | PMID:22365419, |
| 2016-03-17 | SPAC22F3.11c | snu23 | before | I:join(682874.. | based on ribosome profiling | PMID:22365419, |
| 2016-03-17 | SPAC29A4.23 | after | I:join(5139024.. | Frameshifted; intron/exon boundary changes; coordinates changed | PMID:26494834 | |
| 2016-03-17 | SPAC29A4.23 | before | I:join(5139024.. | Frameshifted; intron/exon boundary changes; coordinates changed | PMID:26494834 | |
| 2016-03-17 | SPAPB24D3.05c | after | I:complement(join(2954983.. | |||
| 2016-03-17 | SPAPB24D3.05c | before | I:complement(join(2954983.. | |||
| 2016-02-09 | SPCC622.17 | apn1 | after | III:join(1435178.. | ||
| 2016-02-09 | SPCC622.17 | apn1 | before | III:join(1435178.. | ||
| 2015-10-14 | SPBC13G1.04c | abh1 | after | II:complement(join(3732806.. | N-terminal shortened to use downstream methionine | PMID:22365419 |
| 2015-10-14 | SPBC13G1.04c | abh1 | before | II:complement(join(3732806.. | N-terminal shortened to use downstream methionine | PMID:22365419 |
| 2015-09-01 | SPAC1486.05 | nup189 | after | I:join(3197028.. | ||
| 2015-09-01 | SPAC1486.05 | nup189 | before | I:join(3197028.. | ||
| 2015-04-14 | SPAC1486.05 | nup189 | after | I:join(3197028.. | pers. comm. Y. Hiraoka | |
| 2015-04-14 | SPAC1486.05 | nup189 | before | I:join(3197028.. | pers. comm. Y. Hiraoka | |
| 2014-07-08 | SPAC1D4.08 | pis1 | after | I:join(650488.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC1D4.08 | pis1 | before | I:join(650814.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC22F3.04 | mug62 | after | I:complement(join(698033.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC22F3.04 | mug62 | before | I:complement(join(698033.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-07 | SPCC320.09 | hem15 | after | III:complement(join(149153.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-07 | SPCC320.09 | hem15 | before | III:complement(join(149153.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC146.01 | med15 | after | II:join(996797.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC146.01 | med15 | before | II:join(996843.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC27B12.10c | tom7 | after | II:complement(join(1343913.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC27B12.10c | tom7 | before | II:complement(join(1344032.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC839.02 | after | II:597611..599125 | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPBC839.02 | before | II:join(597611.. | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPCC162.07 | ent1 | after | III:complement(join(1571648.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPCC162.07 | ent1 | before | III:complement(join(1571648.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPCC417.03 | after | III:join(1672003.. | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPCC417.03 | before | III:join(1672003.. | based on ribosome profiling | PMID:24929437 | |
| 2014-05-06 | SPBC17G9.09 | tif213 | after | II:2187712..2189052 | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | before | II:join(2187712.. | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | after | II:join(2187712.. | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | before | II:2187712..2189052 | ||
| 2014-01-07 | SPAC5H10.06c | adh4 | after | I:complement(156548.. | N-terminal shortened to use downstream methionine; removed 43 amino acids; UTR exon annotated | PMID:24003116 |
| 2014-01-07 | SPAC5H10.06c | adh4 | before | I:complement(156548.. | N-terminal shortened to use downstream methionine; removed 43 amino acids; UTR exon annotated | PMID:24003116 |
| 2013-11-26 | SPBC3D6.04c | mad1 | after | II:complement(join(1274979.. | N-terminal shortened to use downstream methionine; removed 13 amino acids | pers. comm. Silke Hauf |
| 2013-11-26 | SPBC3D6.04c | mad1 | before | II:complement(join(1274979.. | N-terminal shortened to use downstream methionine; removed 13 amino acids | pers. comm. Silke Hauf |
| 2013-11-22 | SPBC25B2.07c | mmb1 | after | II:complement(2609038.. | N-terminal shortened to use downstream methionine | PMID:21856157 |
| 2013-11-22 | SPBC25B2.07c | mmb1 | before | II:complement(2609038.. | N-terminal shortened to use downstream methionine | PMID:21856157 |
| 2013-11-01 | SPAC9G1.15c | mzt1 | after | I:complement(1985350.. | N-terminal shortened to use downstream methionine | PMID:23885124, |
| 2013-11-01 | SPAC9G1.15c | mzt1 | before | I:complement(1985350.. | N-terminal shortened to use downstream methionine | PMID:23885124, |
| 2013-07-19 | SPAC4A8.08c | vrs2 | after | I:complement(join(2558600.. | ||
| 2013-07-19 | SPAC4A8.08c | vrs2 | before | I:complement(join(2558600.. | KEGG:MAP00290, | |
| 2012-12-07 | SPAC2F3.13c | after | I:complement(join(3949057.. | removed N terminal region overlapping with plp1 | ||
| 2012-12-07 | SPAC2F3.13c | before | I:complement(join(3947930.. | removed N terminal region overlapping with plp1 | ||
| 2012-11-01 | SPAC4A8.08c | vrs2 | after | I:complement(join(2558600.. | ||
| 2012-11-01 | SPAC4A8.08c | vrs2 | before | I:complement(join(2558600.. | ||
| 2012-06-27 | SPBC1E8.04 | Tf2-10 | after | II:join(1965390.. | ||
| 2012-06-27 | SPBC1E8.04 | Tf2-10-pseudo | before | II:1965390..1969387 | ||
| 2012-06-27 | SPCC1494.11c | Tf2-13 | after | III:complement(join(2320320.. | ||
| 2012-06-27 | SPCC1494.11c | Tf2-13-pseudo | before | III:complement(2320320.. | ||
| 2012-01-17 | SPBC1861.08c | lea1 | after | II:complement(join(4145289.. | ||
| 2012-01-17 | SPBC1861.08c | lea1 | before | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC1861.08c | lea1 | after | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC1861.08c | lea1 | before | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC29A3.06 | after | II:join(2048228.. | N terminal extended | ||
| 2011-12-14 | SPBC29A3.06 | before | II:join(2048336.. | N terminal extended | ||
| 2011-12-14 | SPBC30D10.16 | pha2 | after | II:complement(join(3064223.. | ||
| 2011-12-14 | SPBC30D10.16 | pha2 | before | II:complement(join(3064223.. | ||
| 2011-12-14 | SPBPB10D8.03 | after | II:87727..89029 | |||
| 2011-12-14 | SPBPB10D8.03 | before | II:join(87727.. | |||
| 2011-12-14 | SPCC1281.07c | after | III:complement(1397625.. | N terminal extended by 24 amino acids | ||
| 2011-12-14 | SPCC1281.07c | before | III:complement(1397625.. | N terminal extended by 24 amino acids | ||
| 2011-12-14 | SPCC4B3.05c | hem12 | after | III:join(1166559.. | N terminal extended by 4 amino acids based on homology | |
| 2011-12-14 | SPCC4B3.05c | hem12 | before | III:join(1166571.. | N terminal extended by 4 amino acids based on homology | |
| 2011-12-14 | SPCC622.17 | apn1 | after | III:join(1435178.. | ||
| 2011-12-14 | SPCC622.17 | apn1 | before | III:join(1435250.. | ||
| 2011-10-11 | SPMIT.03 | after | mitochondrial:<6966.. | |||
| 2011-10-11 | SPMIT.03 | before | mitochondrial:<6845.. | |||
| 2011-08-27 | SPAC23A1.20 | new11 | after | I:complement(join(4100755.. | ||
| 2011-08-27 | SPAC23A1.20 | new11 | before | I:complement(4100755.. | ||
| 2011-08-22 | SPAC24H6.06 | sld3 | after | I:complement(join(476549.. | ||
| 2011-08-22 | SPAC24H6.06 | sld3 | before | I:complement(join(476549.. | ||
| 2011-08-22 | SPAC4G9.22 | after | I:2292013..2292297 | |||
| 2011-08-22 | SPAC4G9.22 | before | I:2291983..2292297 | |||
| 2011-08-22 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | ||
| 2011-08-22 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | ||
| 2011-08-22 | SPBC1711.10c | npl4 | after | II:complement(join(2152459.. | ||
| 2011-08-22 | SPBC1711.10c | npl4 | before | II:complement(join(2152462.. | ||
| 2011-04-18 | SPCC622.17 | apn1 | after | III:join(1435250.. | ||
| 2011-04-18 | SPCC622.17 | apn1 | before | III:join(1435178.. | ||
| 2011-03-24 | SPAC1002.12c | after | I:complement(1818695.. | |||
| 2011-03-24 | SPAC1002.12c | before | I:complement(1818695.. | |||
| 2011-03-24 | SPAC1002.17c | urg2 | after | I:complement(1831012.. | ||
| 2011-03-24 | SPAC1002.17c | urg2 | before | I:complement(1831012.. | ||
| 2011-03-24 | SPAC105.01c | kha1 | after | I:complement(join(1740616.. | ||
| 2011-03-24 | SPAC105.01c | kha1 | before | I:complement(join(1740616.. | ||
| 2011-03-24 | SPAC1093.03 | after | I:join(4613627.. | |||
| 2011-03-24 | SPAC1093.03 | before | I:join(4613627.. | |||
| 2011-03-24 | SPAC10F6.10 | after | I:join(1225599.. | |||
| 2011-03-24 | SPAC10F6.10 | before | I:join(1225599.. | |||
| 2011-03-24 | SPAC10F6.11c | atg17 | after | I:complement(1227416.. | ||
| 2011-03-24 | SPAC10F6.11c | atg17 | before | I:complement(1227416.. | ||
| 2011-03-24 | SPAC11E3.03 | pcs1 | after | I:join(5286130.. | ||
| 2011-03-24 | SPAC11E3.03 | pcs1 | before | I:join(5286289.. | ||
| 2011-03-24 | SPAC1296.06 | tah18 | after | I:join(719447.. | ||
| 2011-03-24 | SPAC1296.06 | tah18 | before | I:join(719447.. | ||
| 2011-03-24 | SPAC12G12.15 | sif3 | after | I:complement(join(317431.. | ||
| 2011-03-24 | SPAC12G12.15 | sif3 | before | I:complement(join(317310.. | ||
| 2011-03-24 | SPAC13F5.04c | after | I:complement(join(2177582.. | |||
| 2011-03-24 | SPAC13F5.04c | before | I:complement(join(2177582.. | |||
| 2011-03-24 | SPAC13G6.05c | trs33 | after | I:complement(join(181077.. | ||
| 2011-03-24 | SPAC13G6.05c | trs33 | before | I:complement(join(181077.. | ||
| 2011-03-24 | SPAC13G6.06c | gcv2 | after | I:complement(182976.. | ||
| 2011-03-24 | SPAC13G6.06c | gcv2 | before | I:complement(182976.. | ||
| 2011-03-24 | SPAC13G7.07 | arb2 | after | I:join(2309026.. | ||
| 2011-03-24 | SPAC13G7.07 | arb2 | before | I:join(2309026.. | ||
| 2011-03-24 | SPAC140.01 | sdh2 | after | I:1895464..1896291 | ||
| 2011-03-24 | SPAC140.01 | sdh2 | before | I:1895533..1896291 | ||
| 2011-03-24 | SPAC144.06 | apl5 | after | I:join(4664387.. | ||
| 2011-03-24 | SPAC144.06 | apl5 | before | I:join(4664387.. | ||
| 2011-03-24 | SPAC14C4.02c | smc5 | after | I:complement(join(5226406.. | ||
| 2011-03-24 | SPAC14C4.02c | smc5 | before | I:complement(join(5226406.. | ||
| 2011-03-24 | SPAC14C4.08 | mug5 | after | I:5243053..5243610 | ||
| 2011-03-24 | SPAC14C4.08 | mug5 | before | I:5243071..5243610 | ||
| 2011-03-24 | SPAC15A10.06 | after | I:join(3688782.. | |||
| 2011-03-24 | SPAC15A10.06 | before | I:join(3689230.. | |||
| 2011-03-24 | SPAC15A10.07 | after | I:3691391..3691879 | |||
| 2011-03-24 | SPAC15A10.07 | before | I:3691307..3691879 | |||
| 2011-03-24 | SPAC1639.01c | after | I:complement(join(251726.. | |||
| 2011-03-24 | SPAC1639.01c | before | I:complement(join(251726.. | |||
| 2011-03-24 | SPAC1639.02c | trk2 | after | I:complement(join(256030.. | ||
| 2011-03-24 | SPAC1639.02c | trk2 | before | I:complement(join(256030.. | ||
| 2011-03-24 | SPAC167.04 | pam17 | after | I:complement(join(1554001.. | ||
| 2011-03-24 | SPAC167.04 | pam17 | before | I:complement(join(1554001.. | ||
| 2011-03-24 | SPAC167.09 | after | I:join(1558670.. | |||
| 2011-03-24 | SPAC167.09 | before | I:join(1558670.. | |||
| 2011-03-24 | SPAC1687.17c | after | I:complement(join(935249.. | |||
| 2011-03-24 | SPAC1687.17c | before | I:complement(join(935249.. | |||
| 2011-03-24 | SPAC16A10.03c | after | I:complement(join(3081568.. | |||
| 2011-03-24 | SPAC16A10.03c | before | I:complement(join(3081568.. | |||
| 2011-03-24 | SPAC16A10.05c | dad1 | after | I:complement(3089053.. | ||
| 2011-03-24 | SPAC16A10.05c | dad1 | before | I:complement(3089053.. | ||
| 2011-03-24 | SPAC16A10.06c | nse2 | after | I:complement(join(3089583.. | ||
| 2011-03-24 | SPAC16A10.06c | nse2 | before | I:complement(join(3089583.. | ||
| 2011-03-24 | SPAC16E8.07c | vph1 | after | I:complement(join(3510419.. | ||
| 2011-03-24 | SPAC16E8.07c | vph1 | before | I:complement(join(3510419.. | ||
| 2011-03-24 | SPAC16E8.11c | tfb1 | after | I:complement(join(3520542.. | ||
| 2011-03-24 | SPAC16E8.11c | tfb1 | before | I:complement(join(3520542.. | ||
| 2011-03-24 | SPAC1751.04 | after | I:join(384320.. | |||
| 2011-03-24 | SPAC1751.04 | before | I:join(384627.. | |||
| 2011-03-24 | SPAC1783.02c | vps66 | after | I:complement(join(2189507.. | ||
| 2011-03-24 | SPAC1783.02c | vps66 | before | I:complement(join(2189507.. | ||
| 2011-03-24 | SPAC17A2.08c | after | I:complement(join(3568267.. | |||
| 2011-03-24 | SPAC17A2.08c | before | I:complement(3568267.. | |||
| 2011-03-24 | SPAC17A5.07c | ulp2 | after | I:complement(join(1764336.. | ||
| 2011-03-24 | SPAC17A5.07c | ulp2 | before | I:complement(join(1764336.. | ||
| 2011-03-24 | SPAC17D4.04 | after | I:join(4729751.. | |||
| 2011-03-24 | SPAC17D4.04 | before | I:join(4729888.. | |||
| 2011-03-24 | SPAC17G6.15c | after | I:complement(join(3619344.. | |||
| 2011-03-24 | SPAC17G6.15c | before | I:complement(join(3619344.. | |||
| 2011-03-24 | SPAC17G6.16c | ysh1 | after | I:complement(join(3621007.. | ||
| 2011-03-24 | SPAC17G6.16c | ysh1 | before | I:complement(join(3621007.. | ||
| 2011-03-24 | SPAC17G8.05 | med20 | after | I:join(2350327.. | ||
| 2011-03-24 | SPAC17G8.05 | med20 | before | I:join(2350408.. | ||
| 2011-03-24 | SPAC17G8.09 | shg1 | after | I:join(2357361.. | ||
| 2011-03-24 | SPAC17G8.09 | shg1 | before | I:join(2357361.. | ||
| 2011-03-24 | SPAC17G8.15 | new1 | after | I:join(2348008.. | ||
| 2011-03-24 | SPAC17G8.15 | new1 | before | I:join(2348008.. | ||
| 2011-03-24 | SPAC1805.03c | trm13 | after | I:complement(join(2775340.. | ||
| 2011-03-24 | SPAC1805.03c | trm13 | before | I:complement(join(2775340.. | ||
| 2011-03-24 | SPAC186.04c | after | I:complement(5538574.. | |||
| 2011-03-24 | SPAC186.04c | before | I:complement(5538574.. | |||
| 2011-03-24 | SPAC18B11.03c | after | I:join(312182.. | |||
| 2011-03-24 | SPAC18B11.03c | before | I:312264..313586 | |||
| 2011-03-24 | SPAC18G6.04c | shm2 | after | I:complement(join(2217187.. | ||
| 2011-03-24 | SPAC18G6.04c | shm2 | before | I:complement(2217187.. | ||
| 2011-03-24 | SPAC1952.04c | after | I:complement(join(4972426.. | |||
| 2011-03-24 | SPAC1952.04c | before | I:complement(join(4972134.. | |||
| 2011-03-24 | SPAC1952.14c | mrpl25 | after | I:complement(join(4993896.. | ||
| 2011-03-24 | SPAC1952.14c | mrpl25 | before | I:complement(4993998.. | ||
| 2011-03-24 | SPAC1952.16 | rga9 | after | I:join(4997617.. | ||
| 2011-03-24 | SPAC1952.16 | rga9 | before | I:join(4997617.. | ||
| 2011-03-24 | SPAC19A8.04 | erg5 | after | I:complement(join(2480147.. | ||
| 2011-03-24 | SPAC19A8.04 | erg5 | before | I:complement(join(2480147.. | ||
| 2011-03-24 | SPAC19G12.07c | rsd1 | after | I:complement(join(4053810.. | ||
| 2011-03-24 | SPAC19G12.07c | rsd1 | before | I:complement(join(4053810.. | ||
| 2011-03-24 | SPAC19G12.17 | new10 | after | I:complement(join(4066258.. | ||
| 2011-03-24 | SPAC19G12.17 | new10 | before | I:complement(join(4066258.. | ||
| 2011-03-24 | SPAC1A6.03c | after | I:complement(join(1070061.. | |||
| 2011-03-24 | SPAC1A6.03c | before | I:complement(join(1070061.. | |||
| 2011-03-24 | SPAC1B1.04c | after | I:complement(join(3544727.. | |||
| 2011-03-24 | SPAC1B1.04c | before | I:complement(join(3544813.. | |||
| 2011-03-24 | SPAC1B3.04c | after | I:complement(join(4931313.. | |||
| 2011-03-24 | SPAC1B3.04c | before | I:complement(join(4931482.. | |||
| 2011-03-24 | SPAC1B3.05 | not3 | after | I:join(4934663.. | ||
| 2011-03-24 | SPAC1B3.05 | not3 | before | I:join(4934801.. | ||
| 2011-03-24 | SPAC1B3.13 | after | I:join(4951432.. | |||
| 2011-03-24 | SPAC1B3.13 | before | I:join(4951450.. | |||
| 2011-03-24 | SPAC1D4.01 | after | I:639411..640175 | |||
| 2011-03-24 | SPAC1D4.01 | before | I:639318..640175 | |||
| 2011-03-24 | SPAC20H4.05c | after | I:complement(join(2119362.. | |||
| 2011-03-24 | SPAC20H4.05c | before | I:complement(join(2119362.. | |||
| 2011-03-24 | SPAC212.06c | after | I:join(18072.. | |||
| 2011-03-24 | SPAC212.06c | before | I:join(18042.. | |||
| 2011-03-24 | SPAC212.12 | after | I:15855..16226 | |||
| 2011-03-24 | SPAC212.12 | before | I:15993..16226 | |||
| 2011-03-24 | SPAC222.16c | csn3 | after | I:complement(join(979679.. | ||
| 2011-03-24 | SPAC222.16c | csn3 | before | I:complement(join(979679.. | ||
| 2011-03-24 | SPAC227.11c | after | I:complement(join(514552.. | |||
| 2011-03-24 | SPAC227.11c | before | I:complement(join(514552.. | |||
| 2011-03-24 | SPAC22A12.13 | mug84 | after | I:1180254..1180841 | ||
| 2011-03-24 | SPAC22A12.13 | mug84 | before | I:1180479..1180841 | ||
| 2011-03-24 | SPAC22E12.17c | glo3 | after | I:complement(join(5053107.. | ||
| 2011-03-24 | SPAC22E12.17c | glo3 | before | I:complement(join(5053107.. | ||
| 2011-03-24 | SPAC22F3.11c | snu23 | after | I:join(682874.. | gene structure updated | PMID:21511999 |
| 2011-03-24 | SPAC22F3.11c | snu23 | before | I:join(682874.. | gene structure updated | PMID:21511999 |
| 2011-03-24 | SPAC22G7.07c | after | I:complement(747143.. | |||
| 2011-03-24 | SPAC22G7.07c | before | I:complement(747143.. | |||
| 2011-03-24 | SPAC22H10.02 | after | I:join(2371752.. | |||
| 2011-03-24 | SPAC22H10.02 | before | I:join(2371692.. | |||
| 2011-03-24 | SPAC22H10.03c | kap114 | after | I:complement(join(2373144.. | ||
| 2011-03-24 | SPAC22H10.03c | kap114 | before | I:complement(join(2373144.. | ||
| 2011-03-24 | SPAC23A1.18c | mrp51 | after | I:complement(4112685.. | ||
| 2011-03-24 | SPAC23A1.18c | mrp51 | before | I:complement(4112685.. | ||
| 2011-03-24 | SPAC23C11.04c | pnk1 | after | I:complement(join(2138064.. | ||
| 2011-03-24 | SPAC23C11.04c | pnk1 | before | I:complement(join(2138064.. | ||
| 2011-03-24 | SPAC23C4.17 | after | I:join(1058395.. | |||
| 2011-03-24 | SPAC23C4.17 | before | I:join(1058395.. | |||
| 2011-03-24 | SPAC23D3.09 | arp42 | after | I:complement(join(4353826.. | ||
| 2011-03-24 | SPAC23D3.09 | arp42 | before | I:complement(4353826.. | ||
| 2011-03-24 | SPAC23D3.16 | after | I:join(4365700.. | |||
| 2011-03-24 | SPAC23D3.16 | before | I:join(4365700.. | |||
| 2011-03-24 | SPAC23D3.17 | after | I:complement(join(4366509.. | |||
| 2011-03-24 | SPAC23D3.17 | before | I:complement(join(4366509.. | |||
| 2011-03-24 | SPAC23H4.17c | srb10 | after | I:join(1576854.. | ||
| 2011-03-24 | SPAC23H4.17c | srb10 | before | I:1576854..1577912 | ||
| 2011-03-24 | SPAC24C9.06c | after | I:complement(join(3048409.. | |||
| 2011-03-24 | SPAC24C9.06c | before | I:complement(3048409.. | |||
| 2011-03-24 | SPAC24C9.09 | after | I:3063767..3065191 | |||
| 2011-03-24 | SPAC24C9.09 | before | I:3063770..3065191 | |||
| 2011-03-24 | SPAC25B8.06c | after | I:complement(join(4164278.. | |||
| 2011-03-24 | SPAC25B8.06c | before | I:complement(join(4164278.. | |||
| 2011-03-24 | SPAC26F1.14c | aif1 | after | I:5146165..5148000 | ||
| 2011-03-24 | SPAC26F1.14c | aif1 | before | I:5146273..5148000 | ||
| 2011-03-24 | SPAC26H5.12 | rpo41 | after | I:4147739..4151203 | ||
| 2011-03-24 | SPAC26H5.12 | rpo41 | before | I:4147841..4151203 | ||
| 2011-03-24 | SPAC29B12.08 | after | I:join(5428407.. | |||
| 2011-03-24 | SPAC29B12.08 | before | I:join(5429038.. | |||
| 2011-03-24 | SPAC29B12.14c | after | I:complement(5439849.. | |||
| 2011-03-24 | SPAC29B12.14c | before | I:complement(5439849.. | |||
| 2011-03-24 | SPAC2C4.06c | after | I:complement(join(4269367.. | |||
| 2011-03-24 | SPAC2C4.06c | before | I:complement(join(4269367.. | |||
| 2011-03-24 | SPAC2C4.12c | after | I:complement(4279873.. | |||
| 2011-03-24 | SPAC2C4.12c | before | I:complement(4279873.. | |||
| 2011-03-24 | SPAC2F3.13c | after | I:complement(join(3947930.. | |||
| 2011-03-24 | SPAC2F3.13c | before | I:complement(join(3949057.. | |||
| 2011-03-24 | SPAC2F3.18c | after | I:complement(join(3942299.. | |||
| 2011-03-24 | SPAC2F3.18c | before | I:complement(join(3942299.. | |||
| 2011-03-24 | SPAC2G11.09 | after | I:join(823739.. | |||
| 2011-03-24 | SPAC2G11.09 | before | I:join(823755.. | |||
| 2011-03-24 | SPAC31A2.05c | mis4 | after | I:complement(join(391838.. | ||
| 2011-03-24 | SPAC31A2.05c | mis4 | before | I:complement(join(391838.. | ||
| 2011-03-24 | SPAC31A2.15c | dcc1 | after | I:complement(join(418475.. | ||
| 2011-03-24 | SPAC31A2.15c | dcc1 | before | I:complement(join(418537.. | ||
| 2011-03-24 | SPAC31G5.15 | psd3 | after | I:join(3014466.. | ||
| 2011-03-24 | SPAC31G5.15 | psd3 | before | I:join(3014466.. | ||
| 2011-03-24 | SPAC323.01c | pos5 | after | I:complement(join(3907586.. | ||
| 2011-03-24 | SPAC323.01c | pos5 | before | I:complement(join(3907586.. | ||
| 2011-03-24 | SPAC323.06c | uba5 | after | I:complement(join(3915615.. | ||
| 2011-03-24 | SPAC323.06c | uba5 | before | I:complement(join(3915615.. | ||
| 2011-03-24 | SPAC328.05 | after | I:join(3484678.. | |||
| 2011-03-24 | SPAC328.05 | before | I:join(3484695.. | |||
| 2011-03-24 | SPAC343.08c | mrp17 | after | I:complement(join(1653288.. | ||
| 2011-03-24 | SPAC343.08c | mrp17 | before | I:complement(join(1653288.. | ||
| 2011-03-24 | SPAC3A11.03 | after | I:join(3466834.. | |||
| 2011-03-24 | SPAC3A11.03 | before | I:join(3466462.. | |||
| 2011-03-24 | SPAC3A11.04 | after | I:complement(join(3465309.. | |||
| 2011-03-24 | SPAC3A11.04 | before | I:complement(join(3465309.. | |||
| 2011-03-24 | SPAC3C7.07c | after | I:complement(join(2077280.. | |||
| 2011-03-24 | SPAC3C7.07c | before | I:complement(join(2077280.. | |||
| 2011-03-24 | SPAC3F10.11c | abc2 | after | I:complement(2837268.. | ||
| 2011-03-24 | SPAC3F10.11c | abc2 | before | I:complement(2837268.. | ||
| 2011-03-24 | SPAC3G6.03c | after | I:complement(join(5383955.. | |||
| 2011-03-24 | SPAC3G6.03c | before | I:complement(join(5383955.. | |||
| 2011-03-24 | SPAC3H5.08c | after | I:join(3425966.. | |||
| 2011-03-24 | SPAC3H5.08c | before | I:join(3426306.. | |||
| 2011-03-24 | SPAC3H5.09c | after | I:3416722..3424821 | |||
| 2011-03-24 | SPAC3H5.09c | before | I:3416764..3424821 | |||
| 2011-03-24 | SPAC458.04c | dil1 | after | I:complement(join(4737605.. | ||
| 2011-03-24 | SPAC458.04c | dil1 | before | I:complement(join(4737605.. | ||
| 2011-03-24 | SPAC458.07 | tfa1 | after | I:join(4744584.. | ||
| 2011-03-24 | SPAC458.07 | tfa1 | before | I:join(4744584.. | ||
| 2011-03-24 | SPAC4A8.10 | after | I:join(2564279.. | |||
| 2011-03-24 | SPAC4A8.10 | before | I:2564629..2566800 | |||
| 2011-03-24 | SPAC4D7.02c | after | I:complement(join(5352606.. | |||
| 2011-03-24 | SPAC4D7.02c | before | I:complement(join(5352606.. | |||
| 2011-03-24 | SPAC4D7.07c | after | I:complement(5361908.. | |||
| 2011-03-24 | SPAC4D7.07c | before | I:complement(5361908.. | |||
| 2011-03-24 | SPAC4D7.09 | tif223 | after | I:join(5367548.. | ||
| 2011-03-24 | SPAC4D7.09 | tif223 | before | I:join(5367548.. | ||
| 2011-03-24 | SPAC4F8.06 | after | I:complement(2668334.. | |||
| 2011-03-24 | SPAC4F8.06 | before | I:complement(2668334.. | |||
| 2011-03-24 | SPAC4G9.20c | after | I:complement(join(2288689.. | |||
| 2011-03-24 | SPAC4G9.20c | before | I:complement(join(2288689.. | |||
| 2011-03-24 | SPAC4H3.06 | after | I:join(3837431.. | |||
| 2011-03-24 | SPAC4H3.06 | before | I:join(3837449.. | |||
| 2011-03-24 | SPAC4H3.07c | after | I:complement(join(3838713.. | |||
| 2011-03-24 | SPAC4H3.07c | before | I:complement(join(3838713.. | |||
| 2011-03-24 | SPAC57A10.04 | mug10 | after | I:join(1370179.. | ||
| 2011-03-24 | SPAC57A10.04 | mug10 | before | I:join(1370197.. | ||
| 2011-03-24 | SPAC630.14c | tup12 | after | I:complement(join(374683.. | ||
| 2011-03-24 | SPAC630.14c | tup12 | before | I:complement(join(374683.. | ||
| 2011-03-24 | SPAC631.02 | after | I:2107940..2110123 | |||
| 2011-03-24 | SPAC631.02 | before | I:join(2107470.. | |||
| 2011-03-24 | SPAC637.09 | after | I:4555399..4557294 | |||
| 2011-03-24 | SPAC637.09 | before | I:4555423..4557294 | |||
| 2011-03-24 | SPAC664.02c | arp8 | after | I:complement(join(1704981.. | ||
| 2011-03-24 | SPAC664.02c | arp8 | before | I:complement(join(1704981.. | ||
| 2011-03-24 | SPAC664.03 | after | I:join(1708822.. | |||
| 2011-03-24 | SPAC664.03 | before | I:join(1708822.. | |||
| 2011-03-24 | SPAC688.03c | after | I:complement(join(3114616.. | |||
| 2011-03-24 | SPAC688.03c | before | I:complement(join(3114616.. | |||
| 2011-03-24 | SPAC688.14 | set13 | after | I:join(3141463.. | ||
| 2011-03-24 | SPAC688.14 | set13 | before | I:join(3141484.. | ||
| 2011-03-24 | SPAC6B12.07c | after | I:complement(2421791.. | |||
| 2011-03-24 | SPAC6B12.07c | before | I:complement(2421791.. | |||
| 2011-03-24 | SPAC6C3.04 | cit1 | after | I:join(2327861.. | ||
| 2011-03-24 | SPAC6C3.04 | cit1 | before | I:2328675..2330096 | ||
| 2011-03-24 | SPAC6G10.08 | idp1 | after | I:3231536..3232855 | ||
| 2011-03-24 | SPAC6G10.08 | idp1 | before | I:3231599..3232855 | ||
| 2011-03-24 | SPAC6G9.03c | mug183 | after | I:complement(join(3246488.. | ||
| 2011-03-24 | SPAC6G9.03c | mug183 | before | I:complement(join(3246488.. | ||
| 2011-03-24 | SPAC6G9.08 | ubp6 | after | I:3259701..3261107 | ||
| 2011-03-24 | SPAC6G9.08 | ubp6 | before | I:3259704..3261107 | ||
| 2011-03-24 | SPAC750.01 | after | I:5555791..5556768 | |||
| 2011-03-24 | SPAC750.01 | before | I:5555716..5556768 | |||
| 2011-03-24 | SPAC7D4.05 | after | I:complement(join(2629373.. | |||
| 2011-03-24 | SPAC7D4.05 | before | I:complement(join(2629373.. | |||
| 2011-03-24 | SPAC806.04c | after | I:complement(join(241426.. | |||
| 2011-03-24 | SPAC806.04c | before | I:complement(join(241426.. | |||
| 2011-03-24 | SPAC806.06c | after | I:complement(245304.. | |||
| 2011-03-24 | SPAC806.06c | before | I:complement(245304.. | |||
| 2011-03-24 | SPAC806.08c | mod21 | after | I:complement(join(248680.. | ||
| 2011-03-24 | SPAC806.08c | mod21 | before | I:complement(248680.. | ||
| 2011-03-24 | SPAC821.07c | moc3 | after | I:complement(991752.. | ||
| 2011-03-24 | SPAC821.07c | moc3 | before | I:complement(991752.. | ||
| 2011-03-24 | SPAC823.09c | after | I:complement(join(2594633.. | |||
| 2011-03-24 | SPAC823.09c | before | I:complement(join(2594777.. | |||
| 2011-03-24 | SPAC869.11 | cat1 | after | I:complement(5489385.. | ||
| 2011-03-24 | SPAC869.11 | cat1 | before | I:complement(5489385.. | ||
| 2011-03-24 | SPAC8C9.11 | after | I:join(3659132.. | |||
| 2011-03-24 | SPAC8C9.11 | before | I:join(3659132.. | |||
| 2011-03-24 | SPAC9.12c | atp12 | after | I:complement(join(1487131.. | ||
| 2011-03-24 | SPAC9.12c | atp12 | before | I:complement(join(1487131.. | ||
| 2011-03-24 | SPAC959.05c | after | I:complement(join(3395685.. | |||
| 2011-03-24 | SPAC959.05c | before | I:complement(join(3395685.. | |||
| 2011-03-24 | SPAC959.09c | apc5 | after | I:complement(join(3401279.. | ||
| 2011-03-24 | SPAC959.09c | apc5 | before | I:complement(join(3401279.. | ||
| 2011-03-24 | SPAC977.04 | after | I:34349..34816 | |||
| 2011-03-24 | SPAC977.04 | before | I:34298..34816 | |||
| 2011-03-24 | SPACUNK4.17 | after | I:complement(2873032.. | |||
| 2011-03-24 | SPACUNK4.17 | before | I:complement(2873032.. | |||
| 2011-03-24 | SPAP27G11.05c | vps41 | after | I:complement(join(1615930.. | ||
| 2011-03-24 | SPAP27G11.05c | vps41 | before | I:complement(join(1615930.. | ||
| 2011-03-24 | SPAPB17E12.06 | after | I:join(1276673.. | |||
| 2011-03-24 | SPAPB17E12.06 | before | I:join(1276673.. | |||
| 2011-03-24 | SPAPB18E9.02c | ppk18 | after | I:complement(join(3976370.. | ||
| 2011-03-24 | SPAPB18E9.02c | ppk18 | before | I:complement(join(3976370.. | ||
| 2011-03-24 | SPAPB1A10.05 | after | I:1867135..1868019 | |||
| 2011-03-24 | SPAPB1A10.05 | before | I:1867162..1868019 | |||
| 2011-03-24 | SPAPB1A10.08 | after | I:join(1876259.. | |||
| 2011-03-24 | SPAPB1A10.08 | before | I:join(1876271.. | |||
| 2011-03-24 | SPAPB1A10.15 | arv1 | after | I:join(1892554.. | ||
| 2011-03-24 | SPAPB1A10.15 | arv1 | before | I:join(1892554.. | ||
| 2011-03-24 | SPAPB1E7.06c | eme1 | after | I:complement(join(3297520.. | ||
| 2011-03-24 | SPAPB1E7.06c | eme1 | before | I:complement(join(3297520.. | ||
| 2011-03-24 | SPAPB24D3.03 | after | I:2952416..2953642 | |||
| 2011-03-24 | SPAPB24D3.03 | before | I:2952485..2953642 | |||
| 2011-03-24 | SPAPYUG7.03c | mid2 | after | I:complement(4749139.. | ||
| 2011-03-24 | SPAPYUG7.03c | mid2 | before | I:complement(4749139.. | ||
| 2011-03-24 | SPBC106.04 | ada1 | after | II:join(380390.. | ||
| 2011-03-24 | SPBC106.04 | ada1 | before | II:join(380228.. | ||
| 2011-03-24 | SPBC106.15 | idi1 | after | II:join(406868.. | ||
| 2011-03-24 | SPBC106.15 | idi1 | before | II:join(406874.. | ||
| 2011-03-24 | SPBC1198.07c | after | II:complement(join(185289.. | |||
| 2011-03-24 | SPBC1198.07c | before | II:complement(join(185289.. | |||
| 2011-03-24 | SPBC1198.08 | after | II:join(187424.. | |||
| 2011-03-24 | SPBC1198.08 | before | II:join(187430.. | |||
| 2011-03-24 | SPBC11B10.01 | alg2 | after | II:join(1486152.. | ||
| 2011-03-24 | SPBC11B10.01 | alg2 | before | II:join(1486152.. | ||
| 2011-03-24 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | ||
| 2011-03-24 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | ||
| 2011-03-24 | SPBC11C11.01 | after | II:join(3344613.. | |||
| 2011-03-24 | SPBC11C11.01 | before | II:join(3344613.. | |||
| 2011-03-24 | SPBC11C11.04c | alp1 | after | II:complement(join(3353145.. | ||
| 2011-03-24 | SPBC11C11.04c | alp1 | before | II:complement(join(3353145.. | ||
| 2011-03-24 | SPBC1289.12 | usp109 | after | II:join(4405971.. | ||
| 2011-03-24 | SPBC1289.12 | usp109 | before | II:4406049..4407107 | ||
| 2011-03-24 | SPBC12D12.07c | trx2 | after | II:complement(join(2317984.. | ||
| 2011-03-24 | SPBC12D12.07c | trx2 | before | II:complement(join(2317984.. | ||
| 2011-03-24 | SPBC1347.05c | after | II:complement(join(4069285.. | |||
| 2011-03-24 | SPBC1347.05c | before | II:complement(join(4069285.. | |||
| 2011-03-24 | SPBC1347.07 | rex2 | after | II:join(4073591.. | ||
| 2011-03-24 | SPBC1347.07 | rex2 | before | II:join(4073912.. | ||
| 2011-03-24 | SPBC13E7.04 | atp16 | after | II:3046852..3047355 | ||
| 2011-03-24 | SPBC13E7.04 | atp16 | before | II:3046873..3047355 | ||
| 2011-03-24 | SPBC13E7.10c | brf1 | after | II:complement(join(3056760.. | ||
| 2011-03-24 | SPBC13E7.10c | brf1 | before | II:complement(join(3056760.. | ||
| 2011-03-24 | SPBC13G1.04c | after | II:complement(join(3732806.. | |||
| 2011-03-24 | SPBC13G1.04c | before | II:complement(join(3732806.. | |||
| 2011-03-24 | SPBC13G1.12 | did2 | after | II:join(3752361.. | ||
| 2011-03-24 | SPBC13G1.12 | did2 | before | II:join(3752588.. | ||
| 2011-03-24 | SPBC146.11c | mug97 | after | II:complement(1020296.. | ||
| 2011-03-24 | SPBC146.11c | mug97 | before | II:complement(1020296.. | ||
| 2011-03-24 | SPBC146.12 | coq6 | after | II:1022416..1023855 | ||
| 2011-03-24 | SPBC146.12 | coq6 | before | II:1022455..1023855 | ||
| 2011-03-24 | SPBC14C8.11c | after | II:complement(2222650.. | |||
| 2011-03-24 | SPBC14C8.11c | before | II:complement(2222650.. | |||
| 2011-03-24 | SPBC15C4.02 | after | II:join(2238826.. | |||
| 2011-03-24 | SPBC15C4.02 | before | II:join(2238671.. | |||
| 2011-03-24 | SPBC15D4.02 | after | II:3012934..3014577 | |||
| 2011-03-24 | SPBC15D4.02 | before | II:3013318..3014577 | |||
| 2011-03-24 | SPBC1604.04 | after | II:complement(join(3924320.. | |||
| 2011-03-24 | SPBC1604.04 | before | II:complement(join(3924320.. | |||
| 2011-03-24 | SPBC1652.01 | after | II:4253265..4254440 | |||
| 2011-03-24 | SPBC1652.01 | before | II:4253280..4254440 | |||
| 2011-03-24 | SPBC1685.16 | vma9 | after | II:join(501305.. | ||
| 2011-03-24 | SPBC1685.16 | vma9 | before | II:join(501695.. | ||
| 2011-03-24 | SPBC16C6.03c | after | II:complement(join(4332356.. | |||
| 2011-03-24 | SPBC16C6.03c | before | II:complement(4332698.. | |||
| 2011-03-24 | SPBC16D10.04c | dna2 | after | II:complement(join(3592359.. | ||
| 2011-03-24 | SPBC16D10.04c | dna2 | before | II:complement(join(3592359.. | ||
| 2011-03-24 | SPBC16E9.19 | after | II:join(1921511.. | |||
| 2011-03-24 | SPBC16E9.19 | before | II:1921868..1922173 | |||
| 2011-03-24 | SPBC1703.05 | after | II:join(2924013.. | |||
| 2011-03-24 | SPBC1703.05 | before | II:join(2924037.. | |||
| 2011-03-24 | SPBC1706.01 | tea4 | after | II:588729..591194 | ||
| 2011-03-24 | SPBC1706.01 | tea4 | before | II:588765..591194 | ||
| 2011-03-24 | SPBC1709.03 | after | II:join(1102314.. | |||
| 2011-03-24 | SPBC1709.03 | before | II:join(1102449.. | |||
| 2011-03-24 | SPBC1709.16c | after | II:complement(join(1130896.. | |||
| 2011-03-24 | SPBC1709.16c | before | II:complement(join(1130896.. | |||
| 2011-03-24 | SPBC1711.09c | after | II:complement(join(2150960.. | |||
| 2011-03-24 | SPBC1711.09c | before | II:complement(join(2150960.. | |||
| 2011-03-24 | SPBC1734.03 | after | II:1064200..1066401 | |||
| 2011-03-24 | SPBC1734.03 | before | II:1064341..1066401 | |||
| 2011-03-24 | SPBC1773.08c | omh4 | after | II:complement(297771.. | ||
| 2011-03-24 | SPBC1773.08c | omh4 | before | II:complement(297771.. | ||
| 2011-03-24 | SPBC1778.05c | after | II:complement(join(3105116.. | |||
| 2011-03-24 | SPBC1778.05c | before | II:complement(3105116.. | |||
| 2011-03-24 | SPBC1778.10c | ppk21 | after | II:complement(join(3114461.. | ||
| 2011-03-24 | SPBC1778.10c | ppk21 | before | II:complement(join(3114461.. | ||
| 2011-03-24 | SPBC17A3.03c | after | II:complement(join(1404360.. | |||
| 2011-03-24 | SPBC17A3.03c | before | II:complement(join(1404360.. | |||
| 2011-03-24 | SPBC17D1.07c | after | II:complement(join(3340725.. | |||
| 2011-03-24 | SPBC17D1.07c | before | II:complement(join(3340725.. | |||
| 2011-03-24 | SPBC18E5.12c | mas2 | after | II:complement(2096528.. | ||
| 2011-03-24 | SPBC18E5.12c | mas2 | before | II:complement(2096528.. | ||
| 2011-03-24 | SPBC18E5.14c | after | II:complement(2089944.. | |||
| 2011-03-24 | SPBC18E5.14c | before | II:complement(join(2089944.. | |||
| 2011-03-24 | SPBC18H10.09 | after | II:join(1786332.. | |||
| 2011-03-24 | SPBC18H10.09 | before | II:join(1786596.. | |||
| 2011-03-24 | SPBC18H10.10c | saf4 | after | II:complement(join(1788047.. | ||
| 2011-03-24 | SPBC18H10.10c | saf4 | before | II:complement(join(1788047.. | ||
| 2011-03-24 | SPBC18H10.19 | atg14 | after | II:join(1806262.. | ||
| 2011-03-24 | SPBC18H10.19 | atg14 | before | II:1807057..1807980 | ||
| 2011-03-24 | SPBC19C7.11 | after | II:join(2843141.. | |||
| 2011-03-24 | SPBC19C7.11 | before | II:2843141..2845579 | |||
| 2011-03-24 | SPBC21.03c | after | II:complement(join(3217985.. | |||
| 2011-03-24 | SPBC21.03c | before | II:complement(join(3217985.. | |||
| 2011-03-24 | SPBC211.01 | rsm10 | after | II:join(3870293.. | ||
| 2011-03-24 | SPBC211.01 | rsm10 | before | II:join(3870305.. | ||
| 2011-03-24 | SPBC215.06c | after | II:complement(join(4038119.. | |||
| 2011-03-24 | SPBC215.06c | before | II:complement(4038119.. | |||
| 2011-03-24 | SPBC215.12 | cwf10 | after | II:join(4052601.. | ||
| 2011-03-24 | SPBC215.12 | cwf10 | before | II:join(4052604.. | ||
| 2011-03-24 | SPBC21C3.03 | after | II:join(3802197.. | |||
| 2011-03-24 | SPBC21C3.03 | before | II:join(3802251.. | |||
| 2011-03-24 | SPBC21D10.11c | nfs1 | after | II:2422760..2424265 | ||
| 2011-03-24 | SPBC21D10.11c | nfs1 | before | II:2422769..2424265 | ||
| 2011-03-24 | SPBC25B2.07c | mug164 | after | II:complement(2609038.. | ||
| 2011-03-24 | SPBC25B2.07c | mug164 | before | II:complement(2609038.. | ||
| 2011-03-24 | SPBC25D12.06 | after | II:3725370..3727127 | |||
| 2011-03-24 | SPBC25D12.06 | before | II:3725430..3727127 | |||
| 2011-03-24 | SPBC27B12.01c | mmm1 | after | II:complement(join(1321952.. | ||
| 2011-03-24 | SPBC27B12.01c | mmm1 | before | II:complement(join(1321952.. | ||
| 2011-03-24 | SPBC27B12.02 | after | II:1323731..1324069 | |||
| 2011-03-24 | SPBC27B12.02 | before | II:1323740..1324069 | |||
| 2011-03-24 | SPBC27B12.05 | after | II:join(1328794.. | |||
| 2011-03-24 | SPBC27B12.05 | before | II:join(1329204.. | |||
| 2011-03-24 | SPBC29A10.04 | psm1 | after | II:join(2540743.. | ||
| 2011-03-24 | SPBC29A10.04 | psm1 | before | II:2540743..2544444 | ||
| 2011-03-24 | SPBC29A10.06c | after | II:complement(join(2547516.. | |||
| 2011-03-24 | SPBC29A10.06c | before | II:complement(join(2547516.. | |||
| 2011-03-24 | SPBC29A10.17 | after | II:join(2573829.. | |||
| 2011-03-24 | SPBC29A10.17 | before | II:join(2573866.. | |||
| 2011-03-24 | SPBC2A9.07c | after | II:complement(join(2959078.. | |||
| 2011-03-24 | SPBC2A9.07c | before | II:complement(2959078.. | |||
| 2011-03-24 | SPBC2A9.08c | sec22 | after | II:complement(join(2961668.. | ||
| 2011-03-24 | SPBC2A9.08c | sec22 | before | II:complement(join(2961668.. | ||
| 2011-03-24 | SPBC2F12.10 | after | II:complement(1719551.. | |||
| 2011-03-24 | SPBC2F12.10 | before | II:complement(1719551.. | |||
| 2011-03-24 | SPBC2G2.08 | ade9 | after | II:join(3448967.. | ||
| 2011-03-24 | SPBC2G2.08 | ade9 | before | II:join(3448976.. | ||
| 2011-03-24 | SPBC2G2.12 | hrs1 | after | II:3457165..3458856 | ||
| 2011-03-24 | SPBC2G2.12 | hrs1 | before | II:3457240..3458856 | ||
| 2011-03-24 | SPBC2G2.13c | after | II:complement(join(3458998.. | |||
| 2011-03-24 | SPBC2G2.13c | before | II:complement(join(3458998.. | |||
| 2011-03-24 | SPBC30D10.08 | mgm101 | after | II:complement(3084534.. | ||
| 2011-03-24 | SPBC30D10.08 | mgm101 | before | II:complement(3084534.. | ||
| 2011-03-24 | SPBC30D10.16 | pha2 | after | II:complement(join(3064223.. | ||
| 2011-03-24 | SPBC30D10.16 | pha2 | before | II:complement(join(3064223.. | ||
| 2011-03-24 | SPBC31E1.04 | pep12 | after | II:join(245718.. | ||
| 2011-03-24 | SPBC31E1.04 | pep12 | before | II:join(245718.. | ||
| 2011-03-24 | SPBC31F10.09c | nut2 | after | II:complement(3765847.. | ||
| 2011-03-24 | SPBC31F10.09c | nut2 | before | II:complement(3765847.. | ||
| 2011-03-24 | SPBC31F10.16 | after | II:join(3785848.. | |||
| 2011-03-24 | SPBC31F10.16 | before | II:join(3785848.. | |||
| 2011-03-24 | SPBC336.10c | tif512 | after | II:complement(2758761.. | ||
| 2011-03-24 | SPBC336.10c | tif512 | before | II:complement(2758761.. | ||
| 2011-03-24 | SPBC337.12 | after | II:join(1052080.. | |||
| 2011-03-24 | SPBC337.12 | before | II:join(1052080.. | |||
| 2011-03-24 | SPBC354.06 | mrps16 | after | II:join(555893.. | ||
| 2011-03-24 | SPBC354.06 | mrps16 | before | II:join(555893.. | ||
| 2011-03-24 | SPBC354.07c | after | II:complement(join(558335.. | |||
| 2011-03-24 | SPBC354.07c | before | II:complement(join(558335.. | |||
| 2011-03-24 | SPBC36B7.06c | mug20 | after | II:complement(join(2392551.. | ||
| 2011-03-24 | SPBC36B7.06c | mug20 | before | II:complement(join(2392551.. | ||
| 2011-03-24 | SPBC3E7.04c | after | II:complement(join(2662488.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBC3E7.04c | before | II:complement(join(2662663.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBC428.01c | nup107 | after | II:complement(join(439274.. | ||
| 2011-03-24 | SPBC428.01c | nup107 | before | II:complement(join(439274.. | ||
| 2011-03-24 | SPBC428.02c | eca39 | after | II:complement(442631.. | ||
| 2011-03-24 | SPBC428.02c | eca39 | before | II:complement(442631.. | ||
| 2011-03-24 | SPBC428.06c | rxt2 | after | II:complement(join(451989.. | ||
| 2011-03-24 | SPBC428.06c | rxt2 | before | II:complement(join(451989.. | ||
| 2011-03-24 | SPBC428.10 | after | II:461024..463561 | |||
| 2011-03-24 | SPBC428.10 | before | II:461306..463561 | |||
| 2011-03-24 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2011-03-24 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2011-03-24 | SPBC4F6.13c | after | II:complement(2714424.. | |||
| 2011-03-24 | SPBC4F6.13c | before | II:complement(2714424.. | |||
| 2011-03-24 | SPBC530.05 | after | II:796583..798871 | |||
| 2011-03-24 | SPBC530.05 | before | II:796640..798871 | |||
| 2011-03-24 | SPBC530.12c | pdf1 | after | II:complement(821281.. | ||
| 2011-03-24 | SPBC530.12c | pdf1 | before | II:complement(821281.. | ||
| 2011-03-24 | SPBC530.13 | lsc1 | after | II:join(824374.. | ||
| 2011-03-24 | SPBC530.13 | lsc1 | before | II:join(824374.. | ||
| 2011-03-24 | SPBC56F2.11 | met6 | after | II:complement(join(4089279.. | ||
| 2011-03-24 | SPBC56F2.11 | met6 | before | II:complement(4089357.. | ||
| 2011-03-24 | SPBC646.15c | after | II:complement(join(955201.. | |||
| 2011-03-24 | SPBC646.15c | before | II:complement(join(955128.. | |||
| 2011-03-24 | SPBC651.06 | mug166 | after | II:1247484..1248188 | PMID:21270388 | |
| 2011-03-24 | SPBC651.06 | mug166 | before | II:join(1247484.. | PMID:21270388 | |
| 2011-03-24 | SPBC660.08 | after | II:join(209802.. | |||
| 2011-03-24 | SPBC660.08 | before | II:209985..211172 | |||
| 2011-03-24 | SPBC660.11 | tcg1 | after | II:join(215144.. | ||
| 2011-03-24 | SPBC660.11 | tcg1 | before | II:join(215147.. | ||
| 2011-03-24 | SPBC713.11c | pmp3 | after | II:complement(join(887999.. | ||
| 2011-03-24 | SPBC713.11c | pmp3 | before | II:complement(887999.. | ||
| 2011-03-24 | SPBC725.10 | after | II:join(1224974.. | |||
| 2011-03-24 | SPBC725.10 | before | II:1224974..1225462 | |||
| 2011-03-24 | SPBC776.05 | after | II:join(3182005.. | |||
| 2011-03-24 | SPBC776.05 | before | II:join(3182005.. | |||
| 2011-03-24 | SPBC776.06c | after | II:complement(join(3183676.. | |||
| 2011-03-24 | SPBC776.06c | before | II:complement(3183803.. | |||
| 2011-03-24 | SPBC776.14 | plh1 | after | II:join(3204448.. | ||
| 2011-03-24 | SPBC776.14 | plh1 | before | II:join(3204448.. | ||
| 2011-03-24 | SPBC776.17 | after | II:join(3211353.. | |||
| 2011-03-24 | SPBC776.17 | before | II:3211353..3212117 | |||
| 2011-03-24 | SPBC800.02 | whi5 | after | II:join(253148.. | ||
| 2011-03-24 | SPBC800.02 | whi5 | before | II:join(253148.. | ||
| 2011-03-24 | SPBC83.01 | ucp8 | after | II:join(1510581.. | ||
| 2011-03-24 | SPBC83.01 | ucp8 | before | II:join(1510581.. | ||
| 2011-03-24 | SPBC83.06c | after | II:complement(1520212.. | |||
| 2011-03-24 | SPBC83.06c | before | II:complement(1520212.. | |||
| 2011-03-24 | SPBC83.11 | after | II:join(1529220.. | |||
| 2011-03-24 | SPBC83.11 | before | II:join(1529291.. | |||
| 2011-03-24 | SPBC887.02 | after | II:join(3541262.. | |||
| 2011-03-24 | SPBC887.02 | before | II:join(3541262.. | |||
| 2011-03-24 | SPBC887.04c | lub1 | after | II:complement(join(3546238.. | ||
| 2011-03-24 | SPBC887.04c | lub1 | before | II:complement(join(3546238.. | ||
| 2011-03-24 | SPBC887.07 | mrpl38 | after | II:join(3551318.. | ||
| 2011-03-24 | SPBC887.07 | mrpl38 | before | II:join(3551348.. | ||
| 2011-03-24 | SPBC902.05c | idh2 | after | II:complement(join(492162.. | ||
| 2011-03-24 | SPBC902.05c | idh2 | before | II:complement(join(492162.. | ||
| 2011-03-24 | SPBC9B6.06 | mrpl10 | after | II:1822936..1823700 | ||
| 2011-03-24 | SPBC9B6.06 | mrpl10 | before | II:1823038..1823700 | ||
| 2011-03-24 | SPBP18G5.02 | after | II:join(2401753.. | |||
| 2011-03-24 | SPBP18G5.02 | before | II:join(2401753.. | |||
| 2011-03-24 | SPBP19A11.07c | after | II:complement(join(2868453.. | |||
| 2011-03-24 | SPBP19A11.07c | before | II:complement(join(2868453.. | |||
| 2011-03-24 | SPBP23A10.16 | sdh4 | after | II:2036100..2036579 | ||
| 2011-03-24 | SPBP23A10.16 | sdh4 | before | II:2036019..2036579 | ||
| 2011-03-24 | SPBP35G2.06c | nup131 | after | II:complement(join(973049.. | ||
| 2011-03-24 | SPBP35G2.06c | nup131 | before | II:complement(join(973049.. | ||
| 2011-03-24 | SPBP35G2.08c | air1 | after | II:complement(join(979529.. | ||
| 2011-03-24 | SPBP35G2.08c | air1 | before | II:complement(join(979529.. | ||
| 2011-03-24 | SPBP35G2.14 | after | II:992872..996069 | |||
| 2011-03-24 | SPBP35G2.14 | before | II:992887..996069 | |||
| 2011-03-24 | SPBP4H10.15 | after | II:join(2903085.. | |||
| 2011-03-24 | SPBP4H10.15 | before | II:join(2903103.. | |||
| 2011-03-24 | SPBP8B7.05c | after | II:complement(3641216.. | |||
| 2011-03-24 | SPBP8B7.05c | before | II:complement(3641216.. | |||
| 2011-03-24 | SPBP8B7.10c | after | II:complement(join(3650627.. | |||
| 2011-03-24 | SPBP8B7.10c | before | II:complement(join(3650627.. | |||
| 2011-03-24 | SPBPB21E7.02c | after | II:complement(join(60553.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBPB21E7.02c | before | II:complement(join(60553.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBPB2B2.05 | after | II:4466754..4467515 | |||
| 2011-03-24 | SPBPB2B2.05 | before | II:join(4466723.. | |||
| 2011-03-24 | SPCC1183.01 | sec15 | after | III:join(591852.. | ||
| 2011-03-24 | SPCC1183.01 | sec15 | before | III:join(591852.. | ||
| 2011-03-24 | SPCC1183.05c | lig4 | after | III:complement(join(599520.. | ||
| 2011-03-24 | SPCC1183.05c | lig4 | before | III:complement(join(599310.. | ||
| 2011-03-24 | SPCC1183.09c | pmp31 | after | III:complement(join(613283.. | ||
| 2011-03-24 | SPCC1183.09c | pmp31 | before | III:complement(join(613345.. | ||
| 2011-03-24 | SPCC1235.03 | after | III:join(179039.. | |||
| 2011-03-24 | SPCC1235.03 | before | III:179387..180586 | |||
| 2011-03-24 | SPCC1235.10c | sec6 | after | III:complement(join(196809.. | ||
| 2011-03-24 | SPCC1235.10c | sec6 | before | III:complement(join(196809.. | ||
| 2011-03-24 | SPCC1259.12c | after | III:complement(join(1056598.. | |||
| 2011-03-24 | SPCC1259.12c | before | III:complement(join(1056495.. | |||
| 2011-03-24 | SPCC126.09 | after | III:join(2131761.. | |||
| 2011-03-24 | SPCC126.09 | before | III:2132202..2133458 | |||
| 2011-03-24 | SPCC126.15c | sec65 | after | III:complement(join(2142679.. | ||
| 2011-03-24 | SPCC126.15c | sec65 | before | III:complement(join(2142679.. | ||
| 2011-03-24 | SPCC1442.12 | pps1 | after | III:join(1789596.. | ||
| 2011-03-24 | SPCC1442.12 | pps1 | before | III:join(1789596.. | ||
| 2011-03-24 | SPCC1450.08c | wtf16 | after | III:complement(join(1739338.. | ||
| 2011-03-24 | SPCC1450.08c | wtf16 | before | III:complement(join(1739338.. | ||
| 2011-03-24 | SPCC1450.15 | after | III:join(1761207.. | |||
| 2011-03-24 | SPCC1450.15 | before | III:join(1761516.. | |||
| 2011-03-24 | SPCC1450.16c | after | III:complement(join(1763350.. | |||
| 2011-03-24 | SPCC1450.16c | before | III:complement(1763497.. | |||
| 2011-03-24 | SPCC162.05 | coq3 | after | III:complement(1578220.. | ||
| 2011-03-24 | SPCC162.05 | coq3 | before | III:complement(1578220.. | ||
| 2011-03-24 | SPCC1620.12c | after | III:complement(join(2167799.. | |||
| 2011-03-24 | SPCC1620.12c | before | III:complement(2167799.. | |||
| 2011-03-24 | SPCC1672.04c | after | III:complement(join(568700.. | |||
| 2011-03-24 | SPCC1672.04c | before | III:complement(join(568700.. | |||
| 2011-03-24 | SPCC16C4.15 | rml2 | after | III:join(695922.. | ||
| 2011-03-24 | SPCC16C4.15 | rml2 | before | III:join(696054.. | ||
| 2011-03-24 | SPCC1739.03 | hrr1 | after | III:join(2029655.. | ||
| 2011-03-24 | SPCC1739.03 | hrr1 | before | III:join(2029655.. | ||
| 2011-03-24 | SPCC1739.04c | after | III:complement(join(2033032.. | |||
| 2011-03-24 | SPCC1739.04c | before | III:complement(join(2033032.. | |||
| 2011-03-24 | SPCC1795.08c | vid21 | after | III:join(981120.. | ||
| 2011-03-24 | SPCC1795.08c | vid21 | before | III:join(981120.. | ||
| 2011-03-24 | SPCC18.06c | caf1 | after | III:complement(1965839.. | ||
| 2011-03-24 | SPCC18.06c | caf1 | before | III:complement(1965839.. | ||
| 2011-03-24 | SPCC18.15 | after | III:join(1983372.. | |||
| 2011-03-24 | SPCC18.15 | before | III:join(1983372.. | |||
| 2011-03-24 | SPCC1884.02 | nic1 | after | III:43845..45071 | ||
| 2011-03-24 | SPCC1884.02 | nic1 | before | III:43854..45071 | ||
| 2011-03-24 | SPCC18B5.07c | nup61 | after | III:complement(join(731472.. | ||
| 2011-03-24 | SPCC18B5.07c | nup61 | before | III:complement(join(731472.. | ||
| 2011-03-24 | SPCC1919.14c | bdp1 | after | III:complement(join(2237547.. | ||
| 2011-03-24 | SPCC1919.14c | bdp1 | before | III:complement(join(2237547.. | ||
| 2011-03-24 | SPCC23B6.01c | after | III:complement(join(1264730.. | |||
| 2011-03-24 | SPCC23B6.01c | before | III:complement(join(1264730.. | |||
| 2011-03-24 | SPCC23B6.02c | after | III:complement(join(1268158.. | |||
| 2011-03-24 | SPCC23B6.02c | before | III:complement(join(1268069.. | |||
| 2011-03-24 | SPCC24B10.15 | after | III:927990..929387 | |||
| 2011-03-24 | SPCC24B10.15 | before | III:927999..929387 | |||
| 2011-03-24 | SPCC24B10.16c | after | III:complement(929755.. | |||
| 2011-03-24 | SPCC24B10.16c | before | III:complement(929755.. | |||
| 2011-03-24 | SPCC24B10.19c | after | III:complement(join(932963.. | |||
| 2011-03-24 | SPCC24B10.19c | before | III:complement(join(932963.. | |||
| 2011-03-24 | SPCC285.07c | wtf18 | after | III:complement(join(1807004.. | ||
| 2011-03-24 | SPCC285.07c | wtf18 | before | III:complement(join(1807004.. | ||
| 2011-03-24 | SPCC330.10 | pcm1 | after | III:129931..131013 | ||
| 2011-03-24 | SPCC330.10 | pcm1 | before | III:129844..131013 | ||
| 2011-03-24 | SPCC338.10c | cox5 | after | III:1357866..1358426 | ||
| 2011-03-24 | SPCC338.10c | cox5 | before | III:1357902..1358426 | ||
| 2011-03-24 | SPCC417.11c | after | III:complement(1698190.. | |||
| 2011-03-24 | SPCC417.11c | before | III:complement(1698190.. | |||
| 2011-03-24 | SPCC417.12 | after | III:1699682..1701301 | |||
| 2011-03-24 | SPCC417.12 | before | III:1699739..1701301 | |||
| 2011-03-24 | SPCC4B3.09c | after | III:join(1160510.. | |||
| 2011-03-24 | SPCC4B3.09c | before | III:join(1160411.. | |||
| 2011-03-24 | SPCC550.14 | vgl1 | after | III:1217142..1221017 | ||
| 2011-03-24 | SPCC550.14 | vgl1 | before | III:1217178..1221017 | ||
| 2011-03-24 | SPCC553.05c | after | III:complement(join(297354.. | SPD:51/51D01 | ||
| 2011-03-24 | SPCC553.05c | wtf6 | before | III:complement(join(297140.. | SPD:51/51D01 | |
| 2011-03-24 | SPCC553.11c | after | III:join(281902.. | |||
| 2011-03-24 | SPCC553.11c | before | III:join(281902.. | |||
| 2011-03-24 | SPCC569.03 | after | III:complement(join(2430334.. | |||
| 2011-03-24 | SPCC569.03 | before | III:complement(2430334.. | |||
| 2011-03-24 | SPCC584.14 | mug160 | after | III:1518916..1520220 | ||
| 2011-03-24 | SPCC584.14 | mug160 | before | III:1518925..1520220 | ||
| 2011-03-24 | SPCC594.04c | after | III:complement(362699.. | |||
| 2011-03-24 | SPCC594.04c | before | III:complement(362699.. | |||
| 2011-03-24 | SPCC613.08 | after | III:join(93146.. | |||
| 2011-03-24 | SPCC613.08 | before | III:join(93017.. | |||
| 2011-03-24 | SPCC63.03 | after | III:join(837605.. | |||
| 2011-03-24 | SPCC63.03 | before | III:join(837605.. | |||
| 2011-03-24 | SPCC63.10c | sec59 | after | III:complement(join(854651.. | ||
| 2011-03-24 | SPCC63.10c | sec59 | before | III:complement(join(854651.. | ||
| 2011-03-24 | SPCC645.02 | gep4 | after | III:join(1229724.. | ||
| 2011-03-24 | SPCC645.02 | gep4 | before | III:1229724..1230290 | ||
| 2011-03-24 | SPCC663.02 | wtf14 | after | III:join(1630438.. | ||
| 2011-03-24 | SPCC663.02 | wtf14 | before | III:join(1630438.. | ||
| 2011-03-24 | SPCC663.15c | after | III:complement(join(1660282.. | |||
| 2011-03-24 | SPCC663.15c | before | III:complement(1660282.. | |||
| 2011-03-24 | SPCC663.17 | wtf15 | after | III:join(1632825.. | ||
| 2011-03-24 | SPCC663.17 | wtf15 | before | III:1632825..1633709 | ||
| 2011-03-24 | SPCC736.05 | wtf7 | after | III:join(320608.. | ||
| 2011-03-24 | SPCC736.05 | wtf7 | before | III:join(320617.. | ||
| 2011-03-24 | SPCC757.04 | after | III:join(50527.. | |||
| 2011-03-24 | SPCC757.04 | before | III:join(50358.. | |||
| 2011-03-24 | SPCC757.10 | vph2 | after | III:join(68531.. | ||
| 2011-03-24 | SPCC757.10 | vph2 | before | III:join(68612.. | ||
| 2011-03-24 | SPCC777.02 | after | III:join(1599182.. | |||
| 2011-03-24 | SPCC777.02 | before | III:join(1598981.. | |||
| 2011-03-24 | SPCC777.13 | vps35 | after | III:join(1619556.. | ||
| 2011-03-24 | SPCC777.13 | vps35 | before | III:join(1619709.. | ||
| 2011-03-24 | SPCC790.03 | after | III:join(2245960.. | |||
| 2011-03-24 | SPCC790.03 | before | III:join(2245969.. | |||
| 2011-03-24 | SPCC970.01 | rad16 | after | III:complement(join(514906.. | ||
| 2011-03-24 | SPCC970.01 | rad16 | before | III:complement(join(514906.. | ||
| 2011-03-24 | SPCC970.09 | sec8 | after | III:complement(join(492370.. | ||
| 2011-03-24 | SPCC970.09 | sec8 | before | III:complement(join(492370.. | ||
| 2011-03-24 | SPCC970.12 | mis18 | after | III:complement(join(513931.. | ||
| 2011-03-24 | SPCC970.12 | mis18 | before | III:complement(join(514122.. | ||
| 2011-03-24 | SPCPB16A4.02c | after | III:complement(join(944872.. | |||
| 2011-03-24 | SPCPB16A4.02c | before | III:complement(join(944872.. | |||
| 2011-03-04 | SPAC1006.03c | red1 | after | I:complement(join(5071212.. | intron donor corrected | SPD:38/38H01 |
| 2011-03-04 | SPAC1006.03c | before | I:complement(join(5071212.. | intron donor corrected | SPD:38/38H01 | |
| 2011-03-04 | SPBC2G2.09c | crs1 | after | II:complement(join(3452323.. | ||
| 2011-03-04 | SPBC2G2.09c | crs1 | before | II:complement(join(3452323.. | ||
| 2011-03-04 | SPBC947.10 | dsc1 | after | II:complement(join(653091.. | N-terminal extended to use upstream methionine | pers. comm. E. Stewart |
| 2011-03-04 | SPBC947.10 | dsc1 | before | II:complement(join(653091.. | N-terminal extended to use upstream methionine | pers. comm. E. Stewart |
| 2011-02-04 | SPAC11D3.11c | after | I:complement(join(128025.. | |||
| 2011-02-04 | SPAC11D3.11c | before | I:complement(join(127165.. | |||
| 2011-02-04 | SPAC13F5.07c | after | I:complement(join(2184865.. | PMID:21270388 | ||
| 2011-02-04 | SPAC13F5.07c | before | I:complement(2184865.. | PMID:21270388 | ||
| 2011-02-04 | SPAC18B11.05 | gpi18 | after | I:complement(join(308381.. | PMID:21270388 | |
| 2011-02-04 | SPAC18B11.05 | gpi18 | before | I:complement(308381.. | PMID:21270388 | |
| 2011-02-04 | SPAC29A4.03c | after | I:join(5142407.. | PMID:21270388 | ||
| 2011-02-04 | SPAC29A4.03c | before | I:5142826..5143224 | PMID:21270388 | ||
| 2011-02-04 | SPAC3A11.03 | after | I:join(3466462.. | PMID:21270388 | ||
| 2011-02-04 | SPAC3A11.03 | before | I:join(3466462.. | PMID:21270388 | ||
| 2011-02-04 | SPAC688.04c | gst3 | after | I:complement(3116067.. | PMID:21270388 | |
| 2011-02-04 | SPAC688.04c | gst3 | before | I:complement(3116067.. | PMID:21270388 | |
| 2011-02-04 | SPAC688.11 | end4 | after | I:3135125..3138433 | PMID:21270388 | |
| 2011-02-04 | SPAC688.11 | end4 | before | I:3135155..3138433 | PMID:21270388 | |
| 2011-02-04 | SPAC823.04 | after | I:join(2587729.. | PMID:21270388 | ||
| 2011-02-04 | SPAC823.04 | before | I:join(2587729.. | PMID:21270388 | ||
| 2011-02-04 | SPACUNK4.14 | mdb1 | after | I:complement(join(2883184.. | PMID:21270388 | |
| 2011-02-04 | SPACUNK4.14 | mdb1 | before | I:complement(join(2883184.. | PMID:21270388 | |
| 2011-02-04 | SPAPB17E12.14c | after | I:complement(1286916.. | PMID:21270388 | ||
| 2011-02-04 | SPAPB17E12.14c | before | I:complement(1286916.. | PMID:21270388 | ||
| 2011-02-04 | SPBC16H5.12c | after | II:join(2274073.. | PMID:21270388 | ||
| 2011-02-04 | SPBC16H5.12c | before | II:join(2274403.. | PMID:21270388 | ||
| 2011-02-04 | SPBC1709.12 | rid1 | after | II:join(1122828.. | PMID:21270388 | |
| 2011-02-04 | SPBC1709.12 | rid1 | before | II:join(1122828.. | PMID:21270388 | |
| 2011-02-04 | SPBC1711.10c | npl4 | after | II:complement(join(2152462.. | PMID:21270388 | |
| 2011-02-04 | SPBC1711.10c | npl4 | before | II:complement(join(2152591.. | PMID:21270388 | |
| 2011-02-04 | SPBC25H2.11c | spt7 | after | II:join(3263377.. | PMID:21270388 | |
| 2011-02-04 | SPBC25H2.11c | spt7 | before | II:join(3263377.. | PMID:21270388 | |
| 2011-02-04 | SPBC29A10.17 | after | II:join(2573866.. | PMID:21270388 | ||
| 2011-02-04 | SPBC29A10.17 | before | II:join(2574032.. | PMID:21270388 | ||
| 2011-02-04 | SPBC4F6.10 | vps901 | after | II:join(2708076.. | PMID:21270388 | |
| 2011-02-04 | SPBC4F6.10 | vps901 | before | II:2708076..2709689 | PMID:21270388 | |
| 2011-02-04 | SPBP8B7.31 | after | II:join(3698333.. | PMID:21270388 | ||
| 2011-02-04 | SPBP8B7.31 | before | II:join(3698333.. | PMID:21270388 | ||
| 2011-02-04 | SPCC1322.16 | phb2 | after | III:join(1323844.. | PMID:21270388 | |
| 2011-02-04 | SPCC1322.16 | phb2 | before | III:join(1323871.. | PMID:21270388 | |
| 2011-02-04 | SPCC4G3.15c | not2 | after | III:join(441589.. | ||
| 2011-02-04 | SPCC4G3.15c | not2 | before | III:join(442039.. | ||
| 2011-02-04 | SPCC622.17 | apn1 | after | III:join(1435178.. | added 2 5’ exons | PMID:21193357 |
| 2011-02-04 | SPCC622.17 | apn1 | before | III:join(1435549.. | added 2 5’ exons | PMID:21193357 |
| 2010-12-09 | SPAC22G7.04 | ubp13 | after | I:join(732880.. | pers. comm. James Iben | |
| 2010-12-09 | SPAC22G7.04 | ubp13 | before | I:join(732880.. | pers. comm. James Iben | |
| 2010-10-15 | SPAC27F1.09c | prp10 | after | I:complement(join(4333170.. | added intron to match fully spliced | PMID:9837997 |
| 2010-10-15 | SPAC27F1.09c | prp10 | before | I:complement(join(4333170.. | added intron to match fully spliced | PMID:9837997 |
| 2010-10-15 | SPAPB24D3.05c | after | I:complement(join(2954983.. | |||
| 2010-10-15 | SPAPB24D3.05c | before | I:complement(join(2954989.. | |||
| 2010-10-15 | SPCC285.06c | wtf17 | after | III:complement(join(1805166.. | ||
| 2010-10-15 | SPCC285.06c | wtf17 | before | III:complement(join(1805165.. | ||
| 2010-09-28 | SPAPB24D3.05c | after | I:complement(join(2954989.. | |||
| 2010-09-28 | SPAPB24D3.05c | before | I:complement(2954989.. | |||
| 2010-09-28 | SPCC285.06c | wtf17 | after | III:complement(join(1805165.. | ||
| 2010-09-28 | SPCC285.06c | wtf17 | before | III:complement(join(1805169.. | ||
| 2010-05-20 | SPAC458.04c | dil1 | after | I:complement(join(4737605.. | pers. comm. Val Wood | |
| 2010-05-20 | SPAC458.04c | before | I:complement(join(4737605.. | pers. comm. Val Wood | ||
| 2010-05-20 | SPCC306.10 | wtf8 | after | III:join(427445.. | pseudo->coding | pers. comm. Val Wood |
| 2010-05-20 | SPCC306.10 | wtf8 | before | III:join(427445.. | pseudo->coding | pers. comm. Val Wood |
| 2010-05-20 | SPCC5E4.10c | after | III:complement(join(651622.. | pers. comm. K. Gould | ||
| 2010-05-20 | SPCC5E4.10c | before | III:complement(join(651622.. | pers. comm. K. Gould | ||
| 2010-01-29 | SPAC29B12.08 | after | I:join(5429038.. | replaced exon 5428786.. | pers. comm. Val Wood | |
| 2010-01-29 | SPAC29B12.08 | before | I:join(5428786.. | replaced exon 5428786.. | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.11 | after | II:join(33231.. | |||
| 2010-01-29 | SPBC1348.11 | before | II:33231..34820 | |||
| 2010-01-29 | SPBC1348.12 | after | II:join(35112.. | pseudo->coding | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.12 | before | II:35223..36658 | pseudo->coding | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.13 | after | II:36892..37188 | |||
| 2010-01-29 | SPBC1348.13 | before | II:36901..37263 | |||
| 2010-01-29 | SPBC18E5.15 | after | II:join(2091892.. | |||
| 2010-01-29 | SPBC18E5.15 | before | II:join(2091892.. | |||
| 2010-01-29 | SPBC31A8.02 | after | II:1268093..1268452 | |||
| 2010-01-29 | SPBC31A8.02 | before | II:1268094..1268452 | |||
| 2010-01-29 | SPBC3E7.04c | after | II:complement(join(2662663.. | |||
| 2010-01-29 | SPBC3E7.04c | before | II:complement(join(2662488.. | |||
| 2010-01-29 | SPBPB21E7.02c | after | II:complement(join(60553.. | |||
| 2010-01-29 | SPBPB21E7.02c | before | II:complement(join(60553.. | |||
| 2010-01-29 | SPCP20C8.03 | after | III:join(32624.. | |||
| 2010-01-29 | SPCP20C8.03 | before | III:32624..33393 | |||
| 2009-10-23 | SPBC18H10.08c | ubp4 | after | II:complement(join(1784219.. | missing 2 N-terminal exons | pers. comm. I. Kouranti |
| 2009-10-23 | SPBC18H10.08c | ubp4 | before | II:complement(1784219.. | missing 2 N-terminal exons | pers. comm. I. Kouranti |
| 2009-10-23 | SPBC2A9.07c | after | II:complement(2959078.. | removed intron | pers. comm. Cathrine Arnason Boe | |
| 2009-10-23 | SPBC2A9.07c | before | II:complement(join(2959078.. | removed intron | pers. comm. Cathrine Arnason Boe | |
| 2009-10-23 | SPBP22H7.09c | mis15 | after | II:complement(join(1448815.. | ||
| 2009-10-23 | SPBP22H7.09c | mis15 | before | II:complement(join(1448815.. | ||
| 2009-09-04 | SPAC1F8.07c | after | I:complement(join(101836.. | |||
| 2009-09-04 | SPAC1F8.07c | before | I:complement(join(101836.. | |||
| 2009-08-19 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | PMID:21270388 | |
| 2009-08-19 | SPBC13E7.01 | cwf22 | before | II:join(3037988.. | PMID:21270388 | |
| 2009-08-19 | SPBC14C8.09c | after | II:complement(join(2219430.. | |||
| 2009-08-19 | SPBC14C8.09c | before | II:complement(join(2219430.. | |||
| 2009-08-19 | SPBC1A4.06c | after | II:complement(join(1987044.. | |||
| 2009-08-19 | SPBC1A4.06c | before | II:complement(join(1987044.. | |||
| 2009-08-19 | SPBC23G7.06c | after | II:complement(join(2106448.. | |||
| 2009-08-19 | SPBC23G7.06c | before | II:complement(join(2106448.. | |||
| 2009-08-19 | SPBC29A3.08 | pof4 | after | II:join(2053033.. | frameshifted; truncated to 2048336.. | PMID:16823372 |
| 2009-08-19 | SPBC29A3.08 | pof4 | before | II:2053033..2053632 | frameshifted; truncated to 2048336.. | PMID:16823372 |
| 2009-08-19 | SPBC337.02c | after | II:complement(join(1032857.. | |||
| 2009-08-19 | SPBC337.02c | before | II:complement(1032857.. | |||
| 2009-08-19 | SPCC1442.04c | after | III:complement(join(1773925.. | |||
| 2009-08-19 | SPCC1442.04c | before | III:complement(join(1773925.. | |||
| 2009-07-30 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2009-07-30 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2009-07-30 | SPBC800.02 | whi5 | after | II:join(253148.. | increased intron by 42bp | pers. comm. Rob de Bruin |
| 2009-07-30 | SPBC800.02 | whi5 | before | II:join(253148.. | increased intron by 42bp | pers. comm. Rob de Bruin |
| 2009-07-06 | SPCC16C4.01 | sif2 | after | III:join(658832.. | ||
| 2009-07-06 | SPCC16C4.01 | sif2 | before | III:join(658832.. | ||
| 2009-05-01 | SPBP23A10.07 | rpa2 | after | II:2008119..2011643 | truncated N-term to agree with orthologs; 2007960 -> 2008119 | pers. comm. Val Wood |
| 2009-05-01 | SPBP23A10.07 | rpa2 | before | II:2007960..2011643 | truncated N-term to agree with orthologs; 2007960 -> 2008119 | pers. comm. Val Wood |
| 2009-05-01 | SPCC548.04 | urm1 | after | III:join(223385.. | final exon 223687.. | pers. comm. Marc Feuermann, |
| 2009-05-01 | SPCC548.04 | before | III:join(223385.. | final exon 223687.. | pers. comm. Marc Feuermann, | |
| 2009-02-19 | SPAC1F8.07c | after | I:complement(join(101836.. | frameshifted | PMID:16823372, | |
| 2009-02-19 | SPAC1F8.07c | before | I:complement(101760.. | frameshifted | PMID:16823372 | |
| 2009-02-19 | SPAC22F3.11c | snu23 | after | I:join(682874.. | frameshifted | PMID:16823372, |
| 2009-02-19 | SPAC22F3.11c | snu23 | before | I:join(682874.. | frameshifted | PMID:16823372 |
| 2009-02-19 | SPAC23H3.04 | after | I:join(2499035.. | SPD:19/19C03 | ||
| 2009-02-19 | SPAC23H3.04 | before | I:join(2499035.. | |||
| 2009-02-19 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | frameshifted | PMID:16823372, |
| 2009-02-19 | SPBC13E7.01 | cwf22 | before | II:3037988..3040492 | frameshifted | PMID:16823372 |
| 2009-02-19 | SPBC14C8.09c | after | II:complement(join(2219430.. | merged with SPBC14C8.08c; frameshifted | PMID:16823372, | |
| 2009-02-19 | SPBC14C8.09c | before | II:complement(2219888.. | merged with SPBC14C8.08c; frameshifted | PMID:16823372 | |
| 2009-02-19 | SPBC1A4.06c | after | II:complement(join(1987044.. | frameshifted; C term exon changed from 1987076.. | PMID:16823372, | |
| 2009-02-19 | SPBC1A4.06c | before | II:complement(join(1987076.. | frameshifted; C term exon changed from 1987076.. | PMID:16823372 | |
| 2009-02-19 | SPBC23G7.06c | after | II:complement(join(2106448.. | frameshifted; now a single exon | PMID:16823372, | |
| 2009-02-19 | SPBC23G7.06c | before | II:complement(join(2106448.. | frameshifted; now a single exon | PMID:16823372 | |
| 2009-02-19 | SPBC29A3.06 | after | II:join(2048336.. | SPD:35/35A03 | ||
| 2009-02-19 | SPBC29A3.06 | before | II:2048336..2050006 | |||
| 2009-02-19 | SPBC725.12 | nbl1 | after | II:join(1227762.. | pers. comm. Kathy Gould, | |
| 2009-02-19 | SPBC725.12 | mug118 | before | II:join(1227762.. | pers. comm. Kathy Gould | |
| 2009-02-19 | SPCC1442.04c | after | III:complement(join(1773925.. | frameshifted | PMID:16823372, | |
| 2009-02-19 | SPCC1442.04c | before | III:complement(1774200.. | frameshifted | PMID:16823372 | |
| 2009-01-14 | SPAC31G5.12c | maf1 | after | I:complement(join(3008184.. | PMID:15590667 | |
| 2009-01-14 | SPAC31G5.12c | maf1 | before | I:complement(join(3008184.. | PMID:15590667 | |
| 2009-01-14 | SPAPB1E7.14 | iec5 | after | I:join(3321979.. | PMID:19040720 | |
| 2009-01-14 | SPAPB1E7.14 | before | I:join(3322106.. | PMID:19040720, | ||
| 2008-12-10 | SPAC23H3.04 | after | I:join(2499035.. | |||
| 2008-12-10 | SPAC23H3.04 | before | I:join(2499035.. | |||
| 2008-12-10 | SPAC688.04c | gst3 | after | I:complement(3116067.. | ||
| 2008-12-10 | SPAC688.04c | gst3 | before | I:complement(3116067.. | ||
| 2008-09-22 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | N terminal shortened to 2nd methionine; starting coordinate changed from 1503157 to 1503064 | pers. comm. L Buchanan and F Stewart |
| 2008-09-22 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | N terminal shortened to 2nd methionine; starting coordinate changed from 1503157 to 1503064 | pers. comm. L Buchanan and F Stewart |
| 2008-08-27 | SPAC959.05c | after | I:complement(join(3395685.. | merged with SPAC959.06c; splicing is tentative | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPAC959.05c | before | I:complement(join(3395685.. | merged with SPAC959.06c; splicing is tentative | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC18E5.14c | after | II:complement(join(2089944.. | merged with SPBC18E5.09c | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC18E5.14c | before | II:complement(2089944.. | merged with SPBC18E5.09c | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC31F10.08 | mde2 | after | II:join(3764820.. | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC31F10.08 | mde2 | before | II:3764820..3765449 | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC651.06 | mug166 | after | II:join(1247484.. | merged with SPBC651.07 | pers. comm. Charley Chahwan |
| 2008-08-27 | SPBC651.06 | mug166 | before | II:1247484..1248188 | merged with SPBC651.07 | pers. comm. Charley Chahwan |
| 2008-07-16 | SPAC25H1.10c | atp19 | after | I:complement(join(2532904.. | PMID:18488015 | |
| 2008-07-16 | SPAC25H1.10c | atp19 | before | I:complement(join(2532905.. | PMID:xxxxtemp | |
| 2008-07-16 | SPAC6F6.16c | tpz1 | after | I:complement(join(2763686.. | merged with SPAC6F6.18c and five introns added | PMID:18535244 |
| 2008-07-16 | SPAC6F6.16c | before | I:complement(2763686.. | merged with SPAC6F6.18c and five introns added | PMID:18535244 | |
| 2008-07-16 | SPBC2G2.09c | crs1 | after | II:complement(join(3452323.. | added new C-terminal exon, | pers. comm. Charley Chahwan |
| 2008-07-16 | SPBC2G2.09c | crs1 | before | II:complement(join(3452584.. | added new C-terminal exon, | pers. comm. Charley Chahwan |
| 2008-07-16 | SPCC338.08 | ctp1 | after | III:complement(join(1358891.. | ||
| 2008-07-16 | SPCC338.08 | ctp1 | before | III:complement(join(1358891.. | ||
| 2008-07-16 | SPCC962.05 | ast1 | after | III:join(554521.. | pers. comm. Matthew O’Connell | |
| 2008-07-16 | SPCC962.05 | ast1 | after | III:join(554521.. | intron position moved | pers comm. M. O’Connell |
| 2008-07-16 | SPCC962.05 | before | III:join(554521.. | pers. comm. Matthew O’Connell | ||
| 2008-07-16 | SPCC962.05 | before | III:join(554521.. | intron position moved | pers comm. M. O’Connell | |
| 2008-05-12 | SPAC31G5.12c | maf1 | after | I:complement(join(3008184.. | ||
| 2008-05-12 | SPAC31G5.12c | maf1 | before | I:complement(join(3008184.. | ||
| 2008-04-18 | SPBC16C6.02c | vps1302 | after | II:complement(join(4322829.. | also adds new gene SPBC16C6.14, | PMID:18367542 |
| 2008-04-18 | SPBC16C6.02c | vps1302 | before | II:complement(join(4322221.. | also adds new gene SPBC16C6.14, | PMID:18367542 |
| 2008-02-22 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | Solexa intron data; altered 3rd intron branch acceptor to agree with published | PMID:18488015 |
| 2008-02-22 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | Solexa intron data; altered 3rd intron branch acceptor to agree with published | PMID:18488015 |
| 2008-02-22 | SPBC21C3.07c | before | II:complement(join(3807827.. | |||
| 2008-02-22 | SPBC21C3.07c | before | II:complement(join(3807920.. | Solexa transread data; added two 3’ exons | PMID:18488015 | |
| 2008-02-22 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2008-02-22 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2008-02-22 | SPCC338.08 | ctp1 | after | III:complement(join(1358891.. | ||
| 2008-02-22 | SPCC338.08 | ctp1 | before | III:complement(join(1358885.. | ||
| 2008-01-23 | SPAC1093.03 | after | I:join(4613627.. | Solexa intron data; improved distance between branch and acceptor, | PMID:18488015 | |
| 2008-01-23 | SPAC1093.03 | before | I:join(4613627.. | Solexa intron data; improved distance between branch and acceptor, | PMID:18488015 | |
| 2008-01-23 | SPAC1142.01 | after | I:3625574..3627544 | Solexa intron data; removed 5’ exon and trimmed to new Met, | PMID:18488015 | |
| 2008-01-23 | SPAC1142.01 | before | I:join(3625447.. | Solexa intron data; removed 5’ exon and trimmed to new Met, | PMID:18488015 | |
| 2008-01-23 | SPAC11D3.07c | after | I:complement(118195.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAC11D3.07c | before | I:complement(join(118195.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAC13G6.04 | tim8 | after | I:join(180423.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC13G6.04 | tim8 | before | I:join(180423.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC144.17c | after | I:complement(join(4687388.. | Solexa transread data; added 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPAC144.17c | before | I:complement(join(4687483.. | Solexa transread data; added 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1556.01c | rad50 | after | I:complement(join(3791831.. | Solexa transread data; added small 3’ intron and exon | PMID:18488015 |
| 2008-01-23 | SPAC1556.01c | rad50 | before | I:complement(join(3791855.. | Solexa transread data; added small 3’ intron and exon | PMID:18488015 |
| 2008-01-23 | SPAC1556.03 | azr1 | after | I:join(3799244.. | Solexa transread data; added new 5’ intron and exon/improved homology | PMID:18488015 |
| 2008-01-23 | SPAC1556.03 | azr1 | before | I:join(3799244.. | Solexa transread data; added new 5’ intron and exon/improved homology | PMID:18488015 |
| 2008-01-23 | SPAC15A10.10 | mde6 | after | I:join(3697508.. | Solexa transread data; added in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC15A10.10 | mde6 | before | I:join(3697508.. | Solexa transread data; added in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC15A10.12c | after | I:complement(join(3709206.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC15A10.12c | before | I:complement(3709451.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC1639.01c | after | I:complement(join(251726.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC1639.01c | before | I:complement(join(251726.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC16E8.12c | after | I:complement(join(3523136.. | Solexa transread data; added 2 5’ exons | PMID:18488015 | |
| 2008-01-23 | SPAC16E8.12c | before | I:complement(join(3523136.. | Solexa transread data; added 2 5’ exons | PMID:18488015 | |
| 2008-01-23 | SPAC1751.02c | rsm19 | after | I:complement(join(385755.. | Solexa intron data; remove 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPAC1751.02c | rsm19 | before | I:complement(join(385755.. | Solexa intron data; remove 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPAC17A5.02c | dbr1 | after | I:complement(join(1754033.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC17A5.02c | dbr1 | before | I:complement(join(1754109.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC1A6.03c | after | I:complement(join(1070061.. | Solexa transread data; new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1A6.03c | before | I:complement(1070139.. | Solexa transread data; new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1B3.10c | after | I:complement(4946090.. | Solexa intron data; removed 3’ exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1B3.10c | before | I:complement(join(4945933.. | Solexa intron data; removed 3’ exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1F12.08 | after | I:join(3817464.. | Solexa transread data; added new intron, | PMID:18488015 | |
| 2008-01-23 | SPAC1F12.08 | before | I:join(3817464.. | Solexa transread data; added new intron, | PMID:18488015 | |
| 2008-01-23 | SPAC22E12.10c | etp1 | after | I:complement(join(5037208.. | Solexa transread data; added in-frame splice | PMID:18488015 |
| 2008-01-23 | SPAC22E12.10c | etp1 | before | I:complement(5037208.. | Solexa transread data; added in-frame splice | PMID:18488015 |
| 2008-01-23 | SPAC23C4.04c | after | I:join(1036033.. | Solexa transread data; added intron | PMID:18488015 | |
| 2008-01-23 | SPAC23C4.04c | before | I:1036033..1036347 | Solexa transread data; added intron | PMID:18488015 | |
| 2008-01-23 | SPAC23H3.04 | after | I:join(2499035.. | Solexa intron data; changed 5’ 1st and 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC23H3.04 | before | I:join(2499035.. | Solexa intron data; changed 5’ 1st and 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC24H6.01c | after | I:join(490016.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC24H6.01c | before | I:join(490016.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC26H5.04 | after | I:4122149..4124518 | Solexa intron data | PMID:18488015 | |
| 2008-01-23 | SPAC26H5.04 | before | I:join(4122149.. | Solexa intron data | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.06c | after | I:complement(join(4269367.. | Solexa intron data; replaced 2 internal exons with a different single exon | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.06c | before | I:complement(join(4269367.. | Solexa intron data; replaced 2 internal exons with a different single exon | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.11c | rbp28 | after | I:complement(join(4278729.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC2C4.11c | rbp28 | before | I:complement(4278729.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC2F3.18c | after | I:complement(join(3942299.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 | |
| 2008-01-23 | SPAC2F3.18c | before | I:complement(3942398.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 | |
| 2008-01-23 | SPAC30.03c | tsn1 | after | I:complement(join(4394707.. | Solexa transread data; added in-frame intron to (previous) 2nd exon, | PMID:18488015 |
| 2008-01-23 | SPAC30.03c | tsn1 | before | I:complement(join(4394707.. | Solexa transread data; added in-frame intron to (previous) 2nd exon, | PMID:18488015 |
| 2008-01-23 | SPAC30C2.05 | erv14 | after | I:join(4639884.. | Solexa transread data; added new 5’ intron/exon, | PMID:18488015 |
| 2008-01-23 | SPAC30C2.05 | erv14 | before | I:join(4639916.. | Solexa transread data; added new 5’ intron/exon, | PMID:18488015 |
| 2008-01-23 | SPAC328.05 | after | I:join(3484695.. | Solexa intron data; removed in-frame splice (exon 5), | PMID:18488015 | |
| 2008-01-23 | SPAC328.05 | before | I:join(3484695.. | Solexa intron data; removed in-frame splice (exon 5), | PMID:18488015 | |
| 2008-01-23 | SPAC3A12.05c | taf2 | after | I:complement(join(1426213.. | Solexa intron data; improved distance between branch and acceptor | PMID:18488015 |
| 2008-01-23 | SPAC3A12.05c | taf2 | before | I:complement(join(1426213.. | Solexa intron data; improved distance between branch and acceptor | PMID:18488015 |
| 2008-01-23 | SPAC4F10.08 | mug126 | after | I:join(4844855.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC4F10.08 | mug126 | before | I:join(4844855.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC56F8.04c | coq2 | after | I:complement(join(1133226.. | Solexa transread data; added 5’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC56F8.04c | coq2 | before | I:complement(1133226.. | Solexa transread data; added 5’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC589.02c | med13 | after | I:complement(join(3095075.. | Solexa intron data; improved branch/acceptor for 1st intron | PMID:18488015 |
| 2008-01-23 | SPAC589.02c | med13 | before | I:complement(join(3095075.. | Solexa intron data; improved branch/acceptor for 1st intron | PMID:18488015 |
| 2008-01-23 | SPAC630.11 | vps55 | after | I:join(366801.. | Solexa transread data; changed internal intron acceptor, | PMID:18488015 |
| 2008-01-23 | SPAC630.11 | vps55 | before | I:join(366801.. | Solexa transread data; changed internal intron acceptor, | PMID:18488015 |
| 2008-01-23 | SPAC6F12.08c | after | I:complement(join(1322439.. | Solexa intron data; improved branch acceptor for intron 1 | PMID:18488015 | |
| 2008-01-23 | SPAC6F12.08c | before | I:complement(join(1322439.. | Solexa intron data; improved branch acceptor for intron 1 | PMID:18488015 | |
| 2008-01-23 | SPAC823.04 | after | I:join(2587729.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC823.04 | before | I:join(2587729.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC823.09c | after | I:complement(join(2594777.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC823.09c | before | I:complement(join(2594922.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC890.07c | rmt1 | after | I:complement(join(5016020.. | Solexa transread data; added small N terminal exon, | PMID:18488015 |
| 2008-01-23 | SPAC890.07c | rmt1 | before | I:complement(join(5016072.. | Solexa transread data; added small N terminal exon, | PMID:18488015 |
| 2008-01-23 | SPAC8C9.19 | after | I:join(3660430.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2008-01-23 | SPAC8C9.19 | before | I:join(3660430.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2008-01-23 | SPAC9.06c | after | I:complement(join(1473692.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC9.06c | before | I:complement(join(1473692.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC9G1.13c | after | I:complement(join(1995208.. | Solexa intron data; added a new 3rd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC9G1.13c | before | I:complement(join(1995208.. | Solexa intron data; added a new 3rd exon, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.03 | after | I:join(1271889.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.03 | before | I:join(1271889.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.08 | after | I:join(1279573.. | Solexa transread data; changed first donor to make n-terminal exon longer, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.08 | before | I:join(1279573.. | Solexa transread data; changed first donor to make n-terminal exon longer, | PMID:18488015 | |
| 2008-01-23 | SPAPB18E9.01 | trm5 | after | I:join(3974310.. | Solexa transread data; added small 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPAPB18E9.01 | trm5 | before | I:join(3974310.. | Solexa transread data; added small 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPAPB1A10.16 | after | I:join(1863972.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAPB1A10.16 | before | I:1863972..1864388 | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAPB2B4.06 | after | I:join(2722735.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAPB2B4.06 | before | I:join(2722735.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBC106.05c | tim11 | after | II:complement(join(383527.. | Solexa transread data; changed 5’ exon | PMID:18488015 |
| 2008-01-23 | SPBC106.05c | tim11 | before | II:complement(join(383527.. | Solexa transread data; changed 5’ exon | PMID:18488015 |
| 2008-01-23 | SPBC13G1.04c | after | II:complement(join(3732806.. | Solexa transread data; added new 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBC13G1.04c | before | II:complement(3732941.. | Solexa transread data; added new 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBC15D4.13c | after | II:complement(join(3032492.. | Solexa intron data; better donor for first intron | PMID:18488015 | |
| 2008-01-23 | SPBC15D4.13c | before | II:complement(join(3032492.. | Solexa intron data; better donor for first intron | PMID:18488015 | |
| 2008-01-23 | SPBC16C6.03c | after | II:complement(4332698.. | Solexa intron data; final exon, | PMID:18488015 | |
| 2008-01-23 | SPBC16C6.03c | before | II:complement(join(4332356.. | Solexa intron data; final exon, | PMID:18488015 | |
| 2008-01-23 | SPBC16D10.02 | trm11 | after | II:join(3588806.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPBC16D10.02 | trm11 | before | II:join(3588806.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPBC16D10.10 | after | II:join(3618117.. | Solexa transread data; changed 2 introns (existing 4 and 5) to create a new exon 5, | PMID:18488015 | |
| 2008-01-23 | SPBC16D10.10 | before | II:join(3618117.. | Solexa transread data; changed 2 introns (existing 4 and 5) to create a new exon 5, | PMID:18488015 | |
| 2008-01-23 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | gene structure revised to remove introns, | PMID:18079165 |
| 2008-01-23 | SPBC16E9.16c | before | II:complement(join(1947985.. | gene structure revised to remove introns, | PMID:18079165 | |
| 2008-01-23 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | ||
| 2008-01-23 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | ||
| 2008-01-23 | SPBC19G7.10c | after | II:complement(join(2369064.. | |||
| 2008-01-23 | SPBC19G7.10c | before | II:complement(join(2369064.. | |||
| 2008-01-23 | SPBC21.03c | after | II:complement(join(3217985.. | Solexa intron data; changed 2 internal introns, | PMID:18488015 | |
| 2008-01-23 | SPBC21.03c | before | II:complement(join(3217985.. | Solexa intron data; changed 2 internal introns, | PMID:18488015 | |
| 2008-01-23 | SPBC21C3.07c | after | II:complement(join(3807714.. | |||
| 2008-01-23 | SPBC21C3.07c | after | II:complement(join(3807827.. | Solexa transread data; added two 3’ exons | PMID:18488015 | |
| 2008-01-23 | SPBC2A9.07c | after | II:complement(join(2959078.. | Solexa transread data; added in-frame intron, | PMID:18488015 | |
| 2008-01-23 | SPBC2A9.07c | before | II:complement(2959078.. | Solexa transread data; added in-frame intron, | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.15c | after | II:complement(join(2995324.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.15c | before | II:complement(join(2995324.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.16 | after | II:join(2996452.. | Solexa transread data; added new intron in second exon, | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.16 | before | II:join(2996452.. | Solexa transread data; added new intron in second exon, | PMID:18488015 | |
| 2008-01-23 | SPBC31F10.12 | after | II:join(3773308.. | Solexa transread data; added new 5’ intron and exon | PMID:18488015 | |
| 2008-01-23 | SPBC31F10.12 | before | II:join(3773353.. | Solexa transread data; added new 5’ intron and exon | PMID:18488015 | |
| 2008-01-23 | SPBC32H8.08c | after | II:complement(join(1465811.. | Solexa intron data; removed 5’ intron/exon (unsupported) and trimmed to next met | PMID:18488015 | |
| 2008-01-23 | SPBC32H8.08c | before | II:complement(join(1465811.. | Solexa intron data; removed 5’ intron/exon (unsupported) and trimmed to next met | PMID:18488015 | |
| 2008-01-23 | SPBC4.02c | after | II:complement(join(1185617.. | |||
| 2008-01-23 | SPBC4.02c | before | II:complement(join(1185617.. | |||
| 2008-01-23 | SPBC582.04c | after | II:complement(join(423269.. | Solexa transread data; added in-frame intron to (existing) exon 3 | PMID:18488015 | |
| 2008-01-23 | SPBC582.04c | before | II:complement(join(423269.. | Solexa transread data; added in-frame intron to (existing) exon 3 | PMID:18488015 | |
| 2008-01-23 | SPBC725.04 | after | II:join(1208965.. | |||
| 2008-01-23 | SPBC725.04 | before | II:join(1208965.. | |||
| 2008-01-23 | SPBC8D2.17 | after | II:join(1390183.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBC8D2.17 | before | II:1390183..1391238 | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBC947.03c | after | II:join(676629.. | Solexa transread data; added 5’ inton/exon, | PMID:18488015 | |
| 2008-01-23 | SPBC947.03c | before | II:676629..676931 | Solexa transread data; added 5’ inton/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP35G2.06c | nup131 | after | II:complement(join(973049.. | Solexa intron data; changed donor for intron 3 | PMID:18488015 |
| 2008-01-23 | SPBP35G2.06c | nup131 | before | II:complement(join(973049.. | Solexa intron data; changed donor for intron 3 | PMID:18488015 |
| 2008-01-23 | SPBP4H10.12 | after | II:join(2895855.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP4H10.12 | before | II:join(2895855.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP4H10.15 | after | II:join(2903103.. | |||
| 2008-01-23 | SPBP4H10.15 | before | II:2903103..2905820 | |||
| 2008-01-23 | SPBPB2B2.18 | after | II:join(4502692.. | Solexa transread data; changed 5’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBPB2B2.18 | before | II:join(4502439.. | Solexa transread data; changed 5’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBPJ4664.05 | after | II:join(705932.. | Solexa transread data; added new 5’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBPJ4664.05 | before | II:706175..706666 | Solexa transread data; added new 5’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1020.11c | after | III:join(757365.. | Solexa transread data; added 3’intron/exon | PMID:18488015 | |
| 2008-01-23 | SPCC1020.11c | before | III:join(757365.. | Solexa transread data; added 3’intron/exon | PMID:18488015 | |
| 2008-01-23 | SPCC1393.06c | after | III:complement(join(804627.. | Solexa intron data; changed first intron and added a new 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1393.06c | before | III:complement(join(804627.. | Solexa intron data; changed first intron and added a new 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1442.08c | cox12 | after | III:complement(join(1781505.. | Solexa transread data; added 2 small 5’ exons, | PMID:18488015 |
| 2008-01-23 | SPCC1442.08c | cox12 | before | III:complement(join(1781505.. | Solexa transread data; added 2 small 5’ exons, | PMID:18488015 |
| 2008-01-23 | SPCC1450.14c | ero12 | after | III:complement(1759295.. | Solexa intron data; deleted first exon, | PMID:18488015 |
| 2008-01-23 | SPCC1450.14c | ero12 | before | III:complement(join(1759295.. | Solexa intron data; deleted first exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.09c | tfg1 | after | III:complement(join(2161331.. | Solexa transread data; added 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.09c | tfg1 | before | III:complement(join(2161527.. | Solexa transread data; added 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.10 | cwf26 | after | III:join(2163205.. | Solexa transread data; added 3’ exon encoding single methionine | PMID:18488015 |
| 2008-01-23 | SPCC1620.10 | cwf26 | before | III:2163205..2164122 | Solexa transread data; added 3’ exon encoding single methionine | PMID:18488015 |
| 2008-01-23 | SPCC16C4.01 | sif2 | after | III:join(658832.. | Solexa transread data; added 3’ intron which changed frame of final exon, | PMID:18488015 |
| 2008-01-23 | SPCC16C4.01 | sif2 | before | III:join(658832.. | Solexa transread data; added 3’ intron which changed frame of final exon, | PMID:18488015 |
| 2008-01-23 | SPCC16C4.16c | after | III:complement(join(697605.. | Solexa transread data; added 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPCC16C4.16c | before | III:complement(join(697862.. | Solexa transread data; added 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1827.02c | after | III:complement(2377039.. | Solexa intron data; deleted first exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1827.02c | before | III:complement(join(2377039.. | Solexa intron data; deleted first exon, | PMID:18488015 | |
| 2008-01-23 | SPCC338.08 | ctp1 | after | III:complement(join(1358885.. | in accordance with paper | pers. comm. Paul Russell; PMID:18378696 |
| 2008-01-23 | SPCC338.08 | ctp1 | before | III:complement(1358962.. | in accordance with paper | pers. comm. Paul Russell; PMID:18378696 |
| 2008-01-23 | SPCC63.10c | after | III:complement(join(854651.. | Solexa intron data; deleted 2nd and 3rd introns, | PMID:18488015 | |
| 2008-01-23 | SPCC63.10c | before | III:complement(join(854651.. | Solexa intron data; deleted 2nd and 3rd introns, | PMID:18488015 | |
| 2008-01-23 | SPCC736.12c | mmi1 | after | III:complement(join(337829.. | Solexa transread data; added 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC736.12c | mmi1 | before | III:complement(join(338026.. | Solexa transread data; added 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC830.02 | wtf24 | after | III:join(2181204.. | ||
| 2008-01-23 | SPCC830.02 | wtf24 | before | III:join(2181204.. | ||
| 2007-12-19 | SPAC1639.01c | after | I:complement(join(251726.. | |||
| 2007-12-19 | SPAC1639.01c | before | I:complement(join(251726.. | |||
| 2007-12-19 | SPAC16A10.06c | nse2 | after | I:complement(join(3089583.. | Solexa intron data; revised intron structure/original intron absent from Solexa data | PMID:18488015 |
| 2007-12-19 | SPAC16A10.06c | nse2 | before | I:complement(join(3089583.. | Solexa intron data; revised intron structure/original intron absent from Solexa data | PMID:18488015 |
| 2007-12-19 | SPAC17C9.08 | pnu1 | after | I:complement(join(4484835.. | Solexa intron data; revised intron structure/original intron absent from Solexa data and unsupported from mRNA data so final exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC17C9.08 | pnu1 | before | I:complement(join(4484758.. | Solexa intron data; revised intron structure/original intron absent from Solexa data and unsupported from mRNA data so final exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC227.11c | after | I:complement(join(514552.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPAC227.11c | before | I:complement(join(514434.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPAC23D3.08 | usp108 | after | I:join(4352514.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC23D3.08 | usp108 | before | I:join(4352514.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC29E6.03c | uso1 | after | I:complement(join(4405990.. | Solexa intron data; changed internal splice site, | PMID:18488015 |
| 2007-12-19 | SPAC29E6.03c | uso1 | before | I:complement(join(4405871.. | Solexa intron data; changed internal splice site, | PMID:18488015 |
| 2007-12-19 | SPAC4C5.01 | after | I:join(1192545.. | Solexa intron data` altered intron 5 to improve donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC4C5.01 | before | I:join(1192545.. | Solexa intron data` altered intron 5 to improve donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC56F8.05c | mug64 | after | I:complement(join(1134697.. | Solexa intron data; revised intron structure/original intron absent from Solexa data. N terminal exon unsupported and had no branch site so exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC56F8.05c | mug64 | before | I:complement(join(1134697.. | Solexa intron data; revised intron structure/original intron absent from Solexa data. N terminal exon unsupported and had no branch site so exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC631.02 | after | I:join(2107470.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC631.02 | before | I:2107940..2110123 | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC688.08 | srb8 | after | I:join(3123163.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC688.08 | srb8 | before | I:join(3123163.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC6G9.16c | after | I:complement(join(3278951.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC6G9.16c | before | I:complement(3278951.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC823.04 | after | I:join(2587729.. | Solexa intron data; changed first intron acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC823.04 | before | I:join(2587859.. | Solexa intron data; changed first intron acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAPB17E12.08 | after | I:join(1279573.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small N-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB17E12.08 | before | I:join(1279492.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small N-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB1A10.03 | nxt1 | after | I:join(1863363.. | Solexa intron data; SPAPB1A10.03 split to create SPAPB1A10.03 and SPAPB1A10.16; new coordinates 1863363.. | PMID:18488015 |
| 2007-12-19 | SPAPB1A10.03 | nxt1 | before | I:join(1863363.. | Solexa intron data; SPAPB1A10.03 split to create SPAPB1A10.03 and SPAPB1A10.16; new coordinates 1863363.. | PMID:18488015 |
| 2007-12-19 | SPAPB1A10.15 | after | I:join(1892554.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small C-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB1A10.15 | before | I:join(1892554.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small C-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPBC11B10.03 | cog8 | after | II:1490611..1491747 | Solexa intron data; removed N-teminal exon, | PMID:18488015 |
| 2007-12-19 | SPBC11B10.03 | cog8 | before | II:join(1490376.. | Solexa intron data; removed N-teminal exon, | PMID:18488015 |
| 2007-12-19 | SPBC1604.17c | after | II:join(3900047.. | Solexa intron data; updated, | PMID:18488015 | |
| 2007-12-19 | SPBC1604.17c | before | II:join(3900047.. | Solexa intron data; updated, | PMID:18488015 | |
| 2007-12-19 | SPBC16A3.14 | after | II:complement(4271131.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC16A3.14 | before | II:complement(join(4270907.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC16D10.10 | after | II:join(3618117.. | Solexa intron data; exon 4 splice altered | PMID:18488015 | |
| 2007-12-19 | SPBC16D10.10 | before | II:join(3618117.. | Solexa intron data; exon 4 splice altered | PMID:18488015 | |
| 2007-12-19 | SPBC16H5.04 | after | II:complement(join(2293393.. | Solexa intron data; altered intron 2 donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPBC16H5.04 | before | II:complement(join(2293393.. | Solexa intron data; altered intron 2 donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | Christopher J. McInerny | |
| 2007-12-19 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | Christopher J. McInerny | |
| 2007-12-19 | SPBC21B10.02 | after | II:complement(1669719.. | Solexa intron data; intron unsupported by Solexa transcript data, | PMID:18488015 | |
| 2007-12-19 | SPBC21B10.02 | before | II:complement(join(1669624.. | Solexa intron data; intron unsupported by Solexa transcript data, | PMID:18488015 | |
| 2007-12-19 | SPBC21C3.07c | after | II:complement(join(3807920.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC21C3.07c | before | II:complement(join(3807714.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC29A3.07c | after | II:complement(join(2050258.. | Solexa intron data; final exon deleted, | PMID:18488015 | |
| 2007-12-19 | SPBC29A3.07c | before | II:complement(join(2050069.. | Solexa intron data; final exon deleted, | PMID:18488015 | |
| 2007-12-19 | SPBC354.07c | after | II:complement(join(558335.. | Solexa transcript data; additional exon added | PMID:18488015 | |
| 2007-12-19 | SPBC354.07c | before | II:complement(join(558335.. | Solexa transcript data; additional exon added | PMID:18488015 | |
| 2007-12-19 | SPBPB2B2.07c | after | II:complement(join(4474145.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPBPB2B2.07c | before | II:complement(4474434.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPCC1442.13c | after | III:complement(1791346.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2007-12-19 | SPCC1442.13c | before | III:complement(join(1791196.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2007-12-19 | SPCC1450.09c | after | III:complement(1741588.. | Solexa intron data; original intron absent from Solexa data; C terminal exon unsupported so exon deleted | PMID:18488015 | |
| 2007-12-19 | SPCC1450.09c | before | III:complement(join(1741451.. | Solexa intron data; original intron absent from Solexa data; C terminal exon unsupported so exon deleted | PMID:18488015 | |
| 2007-12-19 | SPCC1494.02c | taf13 | after | III:complement(join(2318335.. | Solexa intron data; 2 C-terminal exons removed, | PMID:18488015 |
| 2007-12-19 | SPCC1494.02c | taf13 | before | III:complement(join(2317988.. | Solexa intron data; 2 C-terminal exons removed, | PMID:18488015 |
| 2007-12-19 | SPCC18.18c | fum1 | after | III:complement(join(1988631.. | Solexa transcript data | PMID:18488015 |
| 2007-12-19 | SPCC18.18c | fum1 | before | III:complement(1988631.. | Solexa transcript data | PMID:18488015 |
| 2007-12-19 | SPCC622.14 | after | III:join(1427098.. | Solexa intron data; altered donor for intron 3, | PMID:18488015 | |
| 2007-12-19 | SPCC622.14 | before | III:join(1427098.. | Solexa intron data; altered donor for intron 3, | PMID:18488015 | |
| 2007-12-19 | SPCC736.05 | wtf7 | after | III:join(320617.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPCC736.05 | wtf7 | before | III:join(320617.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-11-09 | SPCC1020.11c | after | III:join(757365.. | Solexa transcript data | PMID:18488015 | |
| 2007-11-09 | SPCC1020.11c | before | III:757494..757802 | Solexa transcript data | PMID:18488015 | |
| 2007-11-09 | SPCC1529.01 | after | III:join(237554.. | Solexa transcript data; new exon added | PMID:18488015 | |
| 2007-11-09 | SPCC1529.01 | before | III:join(237554.. | Solexa transcript data; new exon added | PMID:18488015 | |
| 2007-09-19 | SPBC725.04 | after | II:join(1208965.. | |||
| 2007-09-19 | SPBC725.04 | before | II:join(1208965.. | |||
| 2007-09-04 | SPAC22F8.07c | rtf1 | after | I:complement(join(4797267.. | Two in-frame splices added | EMBL:AJ627891 |
| 2007-09-04 | SPAC22F8.07c | rtf1 | before | I:complement(join(4797267.. | Two in-frame splices added | EMBL:AJ627891 |
| 2007-07-05 | SPAC23C4.04c | after | I:1036033..1036347 | altered to include stop codon and trimmed to methionine | pers. comm. Val Wood | |
| 2007-07-05 | SPAC23C4.04c | before | I:1036027..1036344 | altered to include stop codon and trimmed to methionine | pers. comm. Val Wood | |
| 2007-07-05 | SPAC9E9.02 | after | I:complement(4435617.. | altered to include stop codon | pers. comm. Val Wood | |
| 2007-07-05 | SPAC9E9.02 | before | I:complement(4435620.. | altered to include stop codon | pers. comm. Val Wood | |
| 2007-07-05 | SPCC338.03c | after | III:1368919..1369344 | |||
| 2007-07-05 | SPCC338.03c | before | III:1368919..1369341 | |||
| 2007-06-20 | SPAC11D3.11c | after | I:complement(join(127165.. | |||
| 2007-06-20 | SPAC11D3.11c | before | I:complement(join(127165.. | |||
| 2007-06-20 | SPAPB24D3.05c | after | I:complement(2954989.. | |||
| 2007-06-20 | SPAPB24D3.05c | before | I:complement(join(2954989.. | |||
| 2007-06-20 | SPBCPT2R1.07c | after | II:complement(4523274.. | |||
| 2007-06-20 | SPBCPT2R1.07c | before | II:complement(join(4523274.. | |||
| 2007-06-20 | SPCC18B5.02c | after | III:complement(717851.. | |||
| 2007-06-20 | SPCC18B5.02c | before | III:complement(join(717851.. | |||
| 2007-05-31 | SPAC29E6.04 | after | I:join(4409773.. | Sequence frameshifted at 4410192, | PMID:17035632 | |
| 2007-05-31 | SPAC29E6.04 | before | I:4409773..4410210 | Sequence frameshifted at 4410192, | PMID:17035632 | |
| 2007-04-12 | SPAC13G7.07 | after | I:join(2309026.. | changed second exon 3’ boundary and added C-terminal exons | PMID:17310250 | |
| 2007-04-12 | SPAC13G7.07 | before | I:join(2309026.. | changed second exon 3’ boundary and added C-terminal exons | PMID:17310250 | |
| 2007-03-12 | SPAC4H3.06 | after | I:join(3837449.. | |||
| 2007-03-12 | SPAC4H3.06 | before | I:join(3837431.. | |||
| 2007-01-11 | SPBP22H7.09c | mis15 | after | II:complement(join(1449715.. | updated sequence coordinates | PMID:15369671 |
| 2007-01-11 | SPBP22H7.09c | mis15 | before | II:complement(join(1449715.. | updated sequence coordinates | PMID:15369671 |
| 2006-12-18 | SPAPB17E12.08 | after | I:join(1280392.. | Improved homology | pers. comm. Val Wood | |
| 2006-12-18 | SPAPB17E12.08 | before | I:join(1280751.. | Improved homology | pers. comm. Val Wood | |
| 2006-12-18 | SPCC1223.10c | eaf1 | after | III:complement(join(1861667.. | Added exons | PMID:17150956 |
| 2006-12-18 | SPCC1223.10c | before | III:complement(join(1861667.. | Added exons | PMID:17150956 | |
| 2006-10-23 | SPCC18.01c | after | III:complement(1949478.. | |||
| 2006-10-23 | SPCC18.01c | before | III:complement(1949478.. | |||
| 2006-10-06 | SPBC30B4.08 | after | II:join(1321592.. | gene structure updated | PMID:16797182 | |
| 2006-10-06 | SPBC30B4.08 | before | II:join(1321592.. | gene structure updated | PMID:16797182 | |
| 2006-10-06 | SPCC18.01c | after | III:complement(1949478.. | |||
| 2006-10-06 | SPCC18.01c | before | III:complement(1949478.. | |||
| 2006-09-22 | SPBC409.12c | after | II:complement(join(1162796.. | N-terminal extended by 2 exons | pers. comm. C. Chahwan | |
| 2006-09-22 | SPBC409.12c | before | II:complement(1162796.. | N-terminal extended by 2 exons | pers. comm. C. Chahwan | |
| 2006-09-05 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-09-05 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-09-05 | SPAC12D12.09 | after | II:join(2315344.. | truncated penultimate exon to remove GIN and added new exon to insert KCIDIFGEF | pers. comm. Nicole Kosarek | |
| 2006-09-05 | SPAC12D12.09 | before | II:join(2315344.. | truncated penultimate exon to remove GIN and added new exon to insert KCIDIFGEF | pers. comm. Nicole Kosarek | |
| 2006-09-05 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-09-05 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-07-01 | SPAC1556.06 | after | I:join(3803451.. | |||
| 2006-07-01 | SPAC1556.06 | after | I:join(3805482.. | |||
| 2006-07-01 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-07-01 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-06-26 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-06-26 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-06-26 | SPAC21E11.05c | after | I:complement(join(4256629.. | |||
| 2006-06-26 | SPAC21E11.05c | before | I:complement(join(4256629.. | |||
| 2006-06-26 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | Improves Homology | pers. comm. Val Wood |
| 2006-06-26 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | Improves Homology | pers. comm. Val Wood |
| 2006-05-17 | SPAC1556.06 | after | I:join(3803451.. | |||
| 2006-05-17 | SPAC1556.06 | after | I:join(3805482.. | |||
| 2006-05-17 | SPAC21E11.05c | after | I:complement(join(4256629.. | Single base insertion allowed first 2 exons to be merged and extended (GAGT[G]GCA) | pers. comm. Trevor Pemberton (via Ivo Pedruzzi, | |
| 2006-05-17 | SPAC21E11.05c | before | I:complement(join(4255729.. | Single base insertion allowed first 2 exons to be merged and extended (GAGT[G]GCA) | pers. comm. Trevor Pemberton (via Ivo Pedruzzi, | |
| 2006-05-17 | SPAPB17E12.08 | after | I:join(1280751.. | |||
| 2006-05-17 | SPAPB17E12.08 | before | I:join(1279492.. | |||
| 2006-05-17 | SPAC12D12.09 | after | II:join(2315344.. | |||
| 2006-05-17 | SPAC12D12.09 | before | II:join(2313544.. | |||
| 2006-05-17 | SPBC30B4.08 | after | II:join(1321592.. | |||
| 2006-05-17 | SPBC30B4.08 | before | II:join(1320692.. | |||
| 2006-05-17 | SPBC409.12c | after | II:complement(1162796.. | |||
| 2006-05-17 | SPBC409.12c | before | II:complement(join(1161896.. | |||
| 2006-05-17 | SPBP22H7.09c | mis15 | after | II:complement(join(1449715.. | ||
| 2006-05-17 | SPBP22H7.09c | mis15 | before | II:complement(join(1448815.. | ||
| 2006-05-17 | SPCC1223.10c | after | III:complement(join(1861667.. | |||
| 2006-05-17 | SPCC1223.10c | eaf1 | before | III:complement(join(1860767.. | ||
| 2006-05-17 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-05-17 | SPCC4B3.05c | hem12 | before | III:join(1166571.. | ||
| 2006-02-19 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-02-19 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-02-19 | SPAC1D4.11c | after | I:complement(656760.. | lengthened to 690 a.a. | PMID:12565823 | |
| 2006-02-19 | SPAC1D4.11c | before | I:complement(657660.. | lengthened to 690 a.a. | PMID:12565823 | |
| 2006-02-19 | SPAC21E11.05c | after | I:complement(join(4255729.. | |||
| 2006-02-19 | SPAC21E11.05c | before | I:complement(join(4256629.. | |||
| 2006-02-19 | SPAC6G9.13c | bqt1 | after | I:complement(join(3272150.. | Additional C terminal exon | PMID:16615890 |
| 2006-02-19 | SPAC6G9.13c | bqt1 | before | I:complement(3273294.. | Additional C terminal exon | PMID:16615890 |
| 2006-02-19 | SPAC9.05 | after | I:join(1471060.. | second intron acceptor extended by 15 bp | pers. comm. Anke Schürer | |
| 2006-02-19 | SPAC9.05 | before | I:join(1471960.. | second intron acceptor extended by 15 bp | pers. comm. Anke Schürer | |
| 2006-02-19 | SPAPB17E12.08 | after | I:join(1279492.. | |||
| 2006-02-19 | SPAPB17E12.08 | before | I:join(1280751.. | |||
| 2006-02-19 | SPAC12D12.09 | after | II:join(2313544.. | |||
| 2006-02-19 | SPAC12D12.09 | before | II:join(2315344.. | |||
| 2006-02-19 | SPBC16E9.16c | after | II:complement(join(1947985.. | |||
| 2006-02-19 | SPBC16E9.16c | before | II:complement(join(1949785.. | |||
| 2006-02-19 | SPBC30B4.08 | after | II:join(1320692.. | |||
| 2006-02-19 | SPBC30B4.08 | before | II:join(1321592.. | |||
| 2006-02-19 | SPBC3B9.22c | dad4 | after | II:complement(join(4006057.. | added new C-terminal exon based on Pfam protein family | Pfam |
| 2006-02-19 | SPBC3B9.22c | dad4 | before | II:complement(4007982.. | added new C-terminal exon based on Pfam protein family | Pfam |
| 2006-02-19 | SPBC409.12c | after | II:complement(join(1161896.. | |||
| 2006-02-19 | SPBC409.12c | before | II:complement(1162796.. | |||
| 2006-02-19 | SPBCPT2R1.08c | after | II:4526885..4532644 | truncated to 1919 a.a.; removed truncated version of a malate transporter fused to gene, | pers. comm. Liew Li Phing | |
| 2006-02-19 | SPBCPT2R1.08c | before | II:4528142..4534444 | truncated to 1919 a.a.; removed truncated version of a malate transporter fused to gene, | pers. comm. Liew Li Phing | |
| 2006-02-19 | SPBP22H7.09c | mis15 | after | II:complement(join(1448815.. | ||
| 2006-02-19 | SPBP22H7.09c | mis15 | before | II:complement(join(1449715.. | ||
| 2006-02-19 | SPCC1223.10c | eaf1 | after | III:complement(join(1860767.. | ||
| 2006-02-19 | SPCC1223.10c | before | III:complement(join(1861667.. | |||
| 2006-02-19 | SPCC4B3.05c | hem12 | after | III:join(1166571.. | ||
| 2006-02-19 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-02-19 | SPCC4G3.05c | after | III:join(462720.. | added N terminal exon | pers. comm. Fred Kippert | |
| 2006-02-19 | SPCC4G3.05c | before | III:462996..464714 | added N terminal exon | pers. comm. Fred Kippert | |
| 2006-01-03 | SPAC17H9.20 | after | I:join(2037303.. | added intron at 37250.. | PMID:16207082 | |
| 2006-01-03 | SPAC17H9.20 | before | I:join(2037303.. | added intron at 37250.. | PMID:16207082 | |
| 2006-01-03 | SPAC31G5.06 | after | I:join(2997204.. | added N-teminal exon to extend prediction | pers. comm. Val Wood | |
| 2006-01-03 | SPAC31G5.06 | before | I:2997521..2997958 | added N-teminal exon to extend prediction | pers. comm. Val Wood | |
| 2006-01-03 | SPAC9E9.17c | after | I:complement(join(4438210.. | |||
| 2006-01-03 | SPAC9E9.17c | before | I:complement(join(4438210.. | |||
| 2006-01-03 | SPCC1223.15c | spc19 | after | III:complement(join(1847115.. | 4 amino acid extension at N-terminus | PMID:16079914 |
| 2006-01-03 | SPCC1223.15c | spc19 | before | III:complement(join(1847115.. | 4 amino acid extension at N-terminus | PMID:16079914 |
| 2005-07-05 | SPAC1093.04c | after | I:complement(join(4617361.. | |||
| 2005-07-05 | SPAC1093.04c | before | I:complement(join(4617361.. | |||
| 2005-07-05 | SPAC12G12.13c | after | I:322824..324878 | |||
| 2005-07-05 | SPAC12G12.13c | before | I:323028..324878 | |||
| 2005-07-05 | SPAC16A10.06c | nse2 | after | I:complement(join(3090483.. | ||
| 2005-07-05 | SPAC16A10.06c | before | I:complement(join(3090483.. | |||
| 2005-07-05 | SPAC16E8.10c | after | I:complement(join(3519794.. | |||
| 2005-07-05 | SPAC16E8.10c | before | I:complement(join(3519794.. | |||
| 2005-07-05 | SPAC26H5.02c | after | I:complement(join(4118187.. | second intron extended to 115 nt | pers. comm. Val Wood | |
| 2005-07-05 | SPAC26H5.02c | before | I:complement(join(4118248.. | second intron extended to 115 nt | pers. comm. Val Wood | |
| 2005-07-05 | SPAC3F10.11c | after | I:complement(2838168.. | |||
| 2005-07-05 | SPAC3F10.11c | before | I:complement(2838168.. | |||
| 2005-07-05 | SPBC20F10.04c | nse4 | after | II:complement(join(3291266.. | ||
| 2005-07-05 | SPBC20F10.04c | before | II:complement(join(3291517.. | |||
| 2005-07-05 | SPBC30D10.04 | after | II:complement(join(3092724.. | |||
| 2005-07-05 | SPBC30D10.04 | before | II:complement(3092724.. | |||
| 2005-07-05 | SPBC646.06c | agn2 | after | II:complement(933681.. | ||
| 2005-07-05 | SPBC646.06c | agn2 | before | II:complement(933759.. | ||
| 2005-07-05 | SPCC550.05 | after | III:join(1195097.. | |||
| 2005-07-05 | SPCC550.05 | before | III:1195097..1195708 | |||
| 2005-07-05 | SPCC553.07c | after | III:join(293444.. | |||
| 2005-07-05 | SPCC553.07c | before | III:join(293444.. | |||
| 2004-09-15 | SPAC1002.01 | after | I:join(1799247.. | |||
| 2004-09-15 | SPAC1002.01 | before | I:1799247..1799735 | |||
| 2004-09-15 | SPAC14C4.09 | agn1 | after | I:5245106..5246380 | ||
| 2004-09-15 | SPAC14C4.09 | before | I:5239924..5241132 | |||
| 2004-09-15 | SPAC16A10.04 | after | I:join(3087938.. | |||
| 2004-09-15 | SPAC16A10.04 | before | I:join(3087939.. | |||
| 2004-09-15 | SPAC27D7.12c | after | I:complement(4534416.. | extended N-terminal to use first MET as start | PMID:14623327 | |
| 2004-09-15 | SPAC27D7.12c | before | I:complement(4529168.. | extended N-terminal to use first MET as start | PMID:14623327 | |
| 2004-09-15 | SPAC29B12.08 | after | I:join(5429685.. | new N-terminal exon | pers. comm. Aengus Stewart | |
| 2004-09-15 | SPAC29B12.08 | before | I:5425074..5426723 | new N-terminal exon | pers. comm. Aengus Stewart | |
| 2004-09-15 | SPAC959.05c | after | I:complement(join(3396585.. | extended N-terminal to first methionine | pers. comm. Val Wood | |
| 2004-09-15 | SPAC959.05c | before | I:complement(join(3396586.. | extended N-terminal to first methionine | pers. comm. Val Wood | |
| 2004-09-15 | SPBC106.05c | tim11 | after | II:complement(join(384427.. | ||
| 2004-09-15 | SPBC106.05c | before | II:complement(join(384427.. | |||
| 2004-09-15 | SPBC15D4.02 | after | II:3015118..3016377 | trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better | pers. comm. Val Wood | |
| 2004-09-15 | SPBC15D4.02 | before | II:3014734..3016377 | trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better | pers. comm. Val Wood | |
| 2004-09-15 | SPBC16D10.07c | after | II:complement(join(3611446.. | |||
| 2004-09-15 | SPBC16D10.07c | before | II:complement(join(3611446.. | |||
| 2004-09-15 | SPBC25H2.10c | after | II:join(3268815.. | |||
| 2004-09-15 | SPBC25H2.10c | before | II:join(3268902.. | |||
| 2004-09-15 | SPBC30B4.01c | after | II:complement(1300391.. | |||
| 2004-09-15 | SPBC30B4.01c | before | II:complement(1300391.. | |||
| 2004-09-15 | SPBC428.01c | after | II:complement(join(440174.. | |||
| 2004-09-15 | SPBC428.01c | before | II:complement(join(440174.. | |||
| 2004-09-15 | SPCC1235.15 | after | III:join(215424.. | |||
| 2004-09-15 | SPCC1235.15 | before | III:join(215424.. | |||
| 2004-09-15 | SPCC622.17 | after | III:join(1436449.. | |||
| 2004-09-15 | SPCC622.17 | before | III:1436449..1437549 | |||
| 2004-09-15 | SPCC777.02 | after | III:join(1599881.. | |||
| 2004-09-15 | SPCC777.02 | before | III:join(1599881.. | |||
| 2003-08-14 | SPAC1093.03 | after | I:join(4609278.. | |||
| 2003-08-14 | SPAC1093.03 | before | I:4659816..4662520 | |||
| 2003-08-14 | SPAC11E3.03 | after | I:join(5281940.. | N terminal truncated, | PMID:12689592 | |
| 2003-08-14 | SPAC11E3.03 | before | I:join(5332334.. | N terminal truncated, | PMID:12689592 | |
| 2003-08-14 | SPAC16A10.04 | after | I:join(3087939.. | N-terminal exon replaced | PMID:12653963 | |
| 2003-08-14 | SPAC16A10.04 | before | I:join(3138406.. | N-terminal exon replaced | PMID:12653963 | |
| 2003-08-14 | SPAC186.04c | after | I:complement(5534225.. | |||
| 2003-08-14 | SPAC186.04c | before | I:complement(5584763.. | |||
| 2003-08-14 | SPAC1952.04c | after | I:complement(join(4967785.. | |||
| 2003-08-14 | SPAC1952.04c | before | I:complement(join(5018323.. | |||
| 2003-08-14 | SPAC19B12.06c | after | I:complement(join(4889750.. | added exon 18153.. | pers. comm. Val Wood | |
| 2003-08-14 | SPAC19B12.06c | before | I:complement(join(4940288.. | added exon 18153.. | pers. comm. Val Wood | |
| 2003-08-14 | SPAC212.05c | after | I:20824..21015 | |||
| 2003-08-14 | SPAC212.05c | before | I:complement(5634971.. | |||
| 2003-08-14 | SPAC22F3.03c | after | I:join(704689.. | 4th exon extended by altering acceptor in intron 3 cosmid coordinates 34092-33923 | pers. comm. Mike Catlett | |
| 2003-08-14 | SPAC22F3.03c | before | I:join(755227.. | 4th exon extended by altering acceptor in intron 3 cosmid coordinates 34092-33923 | pers. comm. Mike Catlett | |
| 2003-08-14 | SPAC23C4.08 | after | I:join(1042435.. | N-terminal exon removed | PMID:12653963 | |
| 2003-08-14 | SPAC23C4.08 | before | I:join(1092825.. | N-terminal exon removed | PMID:12653963 | |
| 2003-08-14 | SPAC29A4.14c | after | I:join(5115324.. | N-terminal extended | pers. comm. Val Wood | |
| 2003-08-14 | SPAC29A4.14c | before | I:join(5166209.. | N-terminal extended | pers. comm. Val Wood | |
| 2003-08-14 | SPAC2E12.05 | wtf1 | after | I:5059956..5061882 | ||
| 2003-08-14 | SPAC2E12.05 | before | I:5110970..5112025 | |||
| 2003-08-14 | SPAC31G5.07 | after | I:2998354..2999058 | N terminal extended to use longest ORF in the absence of homology | pers. comm. Henar Valdivieso Montero | |
| 2003-08-14 | SPAC31G5.07 | before | I:3049060..3049596 | N terminal extended to use longest ORF in the absence of homology | pers. comm. Henar Valdivieso Montero | |
| 2003-08-14 | SPBC1347.05c | after | II:complement(join(4071085.. | new C-terminal exon | pers. comm. Val Wood | |
| 2003-08-14 | SPBC1347.05c | before | II:complement(join(3989924.. | new C-terminal exon | pers. comm. Val Wood | |
| 2003-08-14 | SPBC19G7.18c | after | II:complement(join(2373872.. | |||
| 2003-08-14 | SPBC19G7.18c | before | II:complement(2292671.. | |||
| 2003-08-14 | SPBC530.06c | after | II:complement(join(800042.. | |||
| 2003-08-14 | SPBC530.06c | before | II:complement(join(718841.. | |||
| 2003-08-14 | SPBC577.05c | after | II:complement(join(758466.. | |||
| 2003-08-14 | SPBC577.05c | before | II:complement(join(677271.. | |||
| 2003-08-14 | SPBC6B1.09c | after | II:complement(join(2650545.. | additional intron 25664.. | pers. comm. Charly Chahwan | |
| 2003-08-14 | SPBC6B1.09c | before | II:complement(join(2569344.. | additional intron 25664.. | pers. comm. Charly Chahwan | |
| 2003-08-14 | SPBP23A10.04 | after | II:join(2002935.. | coordinates updated additional in-frame splice at 5325, | pers. comm. Hyun-Joo Yoon | |
| 2003-08-14 | SPBP23A10.04 | before | II:join(1921734.. | coordinates updated additional in-frame splice at 5325, | pers. comm. Hyun-Joo Yoon | |
| 2003-08-14 | SPCC320.13c | after | III:141662..142729 | trimmed to 2nd Met | PMID:12676091 | |
| 2003-08-14 | SPCC320.13c | before | III:141575..142729 | trimmed to 2nd Met | PMID:12676091 | |
| 2002-09-05 | SPAC1296.04 | after | I:join(766918.. | has 2 additional N-terminal exons | pers. comm. Val Wood | |
| 2002-09-05 | SPAC1296.04 | before | I:join(745694.. | has 2 additional N-terminal exons | pers. comm. Val Wood | |
| 2002-09-05 | SPAC23C11.10 | after | I:join(2202062.. | found 3 additional C-terminal exons by eye | pers. comm. Val Wood | |
| 2002-09-05 | SPAC23C11.10 | before | I:join(2180300.. | found 3 additional C-terminal exons by eye | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | after | I:complement(join(3995247.. | annotated as SPAC2F3.13c putative tRNA-ribosyltransferase, | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | after | I:complement(join(3995247.. | split to create SPAC2F3.13c and SPAC2F3.12c | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | before | I:complement(join(3972358.. | annotated as SPAC2F3.13c putative tRNA-ribosyltransferase, | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | before | I:complement(join(3972358.. | split to create SPAC2F3.13c and SPAC2F3.12c | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.17c | after | I:complement(join(3994120.. | |||
| 2002-09-05 | SPAC2F3.17c | before | I:complement(3966826.. | |||
| 2002-09-05 | SPAPYUG7.06 | after | I:4800372..4800977 | |||
| 2002-09-05 | SPAPYUG7.06 | before | I:4779741..4780316 | |||
| 2002-09-05 | SPBPB21E7.01c | after | I:complement(58324.. | |||
| 2002-09-05 | SPBPB21E7.01c | before | I:complement(58324.. | |||
| 2002-09-05 | SPBC1604.17c | after | II:join(3820646.. | pers. comm. Val Wood | ||
| 2002-09-05 | SPBC1604.17c | before | II:join(3820235.. | pers. comm. Val Wood | ||
| 2002-09-05 | SPBC6B1.09c | after | II:complement(join(2569344.. | prediction extended by 4 N- terminal exons, | pers. comm. Val Wood | |
| 2002-09-05 | SPBC6B1.09c | before | II:complement(join(2569344.. | prediction extended by 4 N- terminal exons, | pers. comm. Val Wood | |
| 2002-09-05 | SPCC1442.13c | after | III:complement(join(1792096.. | C terminal exon added; new exon extends G-patch domain | pers. comm. Val Wood | |
| 2002-09-05 | SPCC1442.13c | before | III:complement(1792246.. | C terminal exon added; new exon extends G-patch domain | pers. comm. Val Wood | |
| 2002-09-05 | SPCC622.21 | after | III:join(1402430.. | |||
| 2002-09-05 | SPCC622.21 | before | III:join(1402430.. | |||
| 2002-09-05 | SPCC777.02 | after | III:join(1599881.. | |||
| 2002-09-05 | SPCC777.02 | before | III:1600406..1602073 | |||
| 2002-03-22 | SPAC1006.05c | after | I:complement(5104714.. | |||
| 2002-03-22 | SPAC1006.05c | before | I:complement(5071493.. | |||
| 2002-03-22 | SPAC1610.03c | after | I:complement(join(1822269.. | |||
| 2002-03-22 | SPAC1610.03c | before | I:complement(join(1803017.. | |||
| 2002-03-22 | SPAC1D4.11c | after | I:complement(686436.. | |||
| 2002-03-22 | SPAC1D4.11c | before | I:complement(667184.. | |||
| 2002-03-22 | SPAPB15E9.01c | after | I:complement(4011667.. | |||
| 2002-03-22 | SPAPB15E9.01c | before | I:complement(3980427.. | |||
| 2002-03-22 | SPAPB17E12.14c | after | I:complement(1316592.. | |||
| 2002-03-22 | SPAPB17E12.14c | before | I:complement(1297340.. | |||
| 2002-03-22 | SPBC1348.14c | after | I:complement(38587.. | |||
| 2002-03-22 | SPBC1348.14c | after | I:complement(38587.. | |||
| 2002-03-22 | SPBC1348.14c | before | I:complement(38587.. |
| Date | Systematic id | Primary name | Before / after change | Coordinates | Comment | Reference |
|---|---|---|---|---|---|---|
| 2022-12-21 | SPNCRNA.105 | after | II:4071111..4071312 | |||
| 2022-12-21 | SPNCRNA.105 | before | II:4071111..4071304 | |||
| 2022-12-20 | SPNCRNA.1597 | after | II:3391413..3393613 | |||
| 2022-12-20 | SPNCRNA.1597 | before | II:3390915..3393891 | |||
| 2022-12-20 | SPNCRNA.1674 | after | II:4129796..4130288 | EMBL:AU011806 | ||
| 2022-12-20 | SPNCRNA.1674 | before | II:4129574..4130925 | |||
| 2022-12-20 | SPNCRNA.5748 | prl102 | after | II:2626082..2626661 | PMID:28031482, | |
| 2022-12-20 | SPNCRNA.5748 | before | II:2625945..2626738 | PMID:29914874 | ||
| 2022-12-19 | SPNCRNA.1502 | after | II:2319366..2319746 | |||
| 2022-12-19 | SPNCRNA.1502 | before | II:2319348..2319746 | |||
| 2022-12-19 | SPNCRNA.848 | after | I:2738681..2740459 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.848 | before | I:2738026..2740228 | |||
| 2022-12-19 | SPNCRNA.865 | after | I:2957775..2959658 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.865 | before | I:2956805..2959658 | |||
| 2022-12-19 | SPNCRNA.893 | after | I:3177931..3178309 | |||
| 2022-12-19 | SPNCRNA.893 | before | I:3177931..3179269 | |||
| 2022-12-19 | SPNCRNA.985 | after | I:4400686..4401605 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.985 | before | I:4400708..4401528 | |||
| 2022-12-12 | SPSNORNA.42 | snR90 | after | I:complement(join(4936907.. | ||
| 2022-12-12 | SPSNORNA.42 | snR90 | before | I:complement(4937170.. | ||
| 2022-08-26 | SPNCRNA.159 | after | I:776184..777243 | PMID:21511999 | ||
| 2022-08-26 | SPNCRNA.159 | before | I:776272..777066 | |||
| 2022-08-26 | SPNCRNA.159 | before | I:join(776272.. | |||
| 2022-05-25 | SPSNRNA.06 | snu6 | after | I:complement(join(2562276.. | Jennifer Porat flagged it | PMID:2909894 |
| 2022-05-25 | SPSNRNA.06 | snu6 | before | I:complement(join(2562276.. | Jennifer Porat flagged it | PMID:2909894 |
| 2022-05-25 | SPSNRNA.04 | snu4 | after | II:complement(467489.. | Jennifer Porat flagged it | PMID:2795654 |
| 2022-05-25 | SPSNRNA.04 | snu4 | before | II:complement(467233.. | Jennifer Porat flagged it | PMID:2795654 |
| 2022-05-24 | SPNCRNA.214 | ter1 | after | I:complement(join(3084610.. | PMID:19052544 | |
| 2022-05-24 | SPNCRNA.214 | ter1 | before | I:complement(3084610.. | ||
| 2021-01-21 | SPRPTCENB.11 | cnt2.1 | after | II:1620807..1627609 | ||
| 2021-01-21 | SPRPTCENB.11 | cnt2.1 | before | II:1620807..1624737 | ||
| 2020-05-05 | SPRRNA.01 | rnl | after | mitochondrial:1.. | PMID:29954949 | |
| 2020-05-05 | SPRRNA.01 | rnl | before | mitochondrial:1.. | ||
| 2020-05-05 | SPRRNA.02 | rns | after | mitochondrial:3133.. | PMID:29954949 | |
| 2020-05-05 | SPRRNA.02 | rns | before | mitochondrial:3132.. | ||
| 2020-04-30 | SPMITTRNAARG.01 | after | mitochondrial:9819.. | |||
| 2020-04-30 | SPMITTRNAARG.01 | before | mitochondrial:9818.. | |||
| 2020-04-30 | SPMITTRNAGLU.01 | after | mitochondrial:18406.. | |||
| 2020-04-30 | SPMITTRNAGLU.01 | before | mitochondrial:18404.. | |||
| 2020-04-30 | SPRRNA.01 | rnl | after | mitochondrial:1.. | ||
| 2020-04-30 | SPRRNA.01 | rnl | before | mitochondrial:1.. | ||
| 2020-04-30 | SPRRNA.02 | rns | after | mitochondrial:3132.. | ||
| 2020-04-30 | SPRRNA.02 | rns | before | mitochondrial:3131.. | ||
| 2020-01-09 | SPATRNAALA.06 | after | I:join(4796977.. | |||
| 2020-01-09 | SPATRNAALA.06 | before | I:4796977..4797059 | |||
| 2020-01-09 | SPATRNAARG.01 | after | I:join(3443055.. | |||
| 2020-01-09 | SPATRNAARG.01 | before | I:3443055..3443144 | |||
| 2020-01-09 | SPATRNAILE.02 | after | I:join(2578426.. | |||
| 2020-01-09 | SPATRNAILE.02 | before | I:2578426..2578524 | |||
| 2020-01-09 | SPATRNALEU.01 | after | I:complement(join(1527088.. | |||
| 2020-01-09 | SPATRNALEU.01 | before | I:complement(1527088.. | |||
| 2020-01-09 | SPATRNALEU.02 | after | I:complement(join(2802761.. | |||
| 2020-01-09 | SPATRNALEU.02 | before | I:complement(2802761.. | |||
| 2020-01-09 | SPATRNALEU.03 | after | I:join(3591948.. | |||
| 2020-01-09 | SPATRNALEU.03 | before | I:3591948..3592044 | |||
| 2020-01-09 | SPATRNALYS.01 | after | I:join(1704582.. | |||
| 2020-01-09 | SPATRNALYS.01 | before | I:1704582..1704664 | |||
| 2020-01-09 | SPATRNALYS.05 | after | I:join(3086310.. | |||
| 2020-01-09 | SPATRNALYS.05 | before | I:3086310..3086392 | |||
| 2020-01-09 | SPATRNAMET.02 | after | I:complement(join(1484979.. | |||
| 2020-01-09 | SPATRNAMET.02 | before | I:complement(1484979.. | |||
| 2020-01-09 | SPATRNAPRO.02 | spl1 | after | I:complement(join(1314924.. | ||
| 2020-01-09 | SPATRNAPRO.02 | spl1 | before | I:complement(1314924.. | ||
| 2020-01-09 | SPATRNASER.01 | after | I:join(1096369.. | |||
| 2020-01-09 | SPATRNASER.01 | before | I:1096369..1096466 | |||
| 2020-01-09 | SPATRNATYR.01 | after | I:join(1746464.. | |||
| 2020-01-09 | SPATRNATYR.01 | before | I:1746464..1746547 | |||
| 2020-01-09 | SPATRNAVAL.03 | after | I:complement(join(2214733.. | |||
| 2020-01-09 | SPATRNAVAL.03 | before | I:complement(2214733.. | |||
| 2020-01-09 | SPATRNAVAL.04 | after | I:complement(join(3710739.. | |||
| 2020-01-09 | SPATRNAVAL.04 | before | I:complement(3710739.. | |||
| 2020-01-09 | SPBTRNAMET.04 | after | II:join(658451.. | |||
| 2020-01-09 | SPBTRNAMET.04 | before | II:658451..658531 | |||
| 2020-01-09 | SPBTRNAVAL.06 | after | II:complement(join(1619174.. | |||
| 2020-01-09 | SPBTRNAVAL.06 | before | II:complement(1619174.. | |||
| 2020-01-09 | SPCTRNALYS.10 | after | III:join(1071093.. | |||
| 2020-01-09 | SPCTRNALYS.10 | before | III:1071093..1071175 | |||
| 2020-01-09 | SPCTRNASER.11 | sup9 | after | III:join(1689713.. | ||
| 2020-01-09 | SPCTRNASER.11 | sup9 | before | III:1689713..1689809 | ||
| 2019-11-08 | SPNCRNA.103 | sme2 | after | II:complement(339346.. | PMID:24920274 | |
| 2019-11-08 | SPNCRNA.103 | sme2 | before | II:complement(339346.. | PMID:24920274 | |
| 2018-08-05 | SPBC8E4.02c | prt2 | after | II:4442542..4445970 | ||
| 2018-08-05 | SPBC8E4.02c | prt2 | before | II:4443155..4443544 | ||
| 2017-07-11 | SPNCRNA.1702 | prl104 | after | I:complement(5533986.. | ||
| 2017-07-11 | SPNCRNA.1702 | prl104 | before | I:5533986..5534754 | ||
| 2017-07-11 | SPNCRNA.1706 | prl106 | after | III:complement(935629.. | ||
| 2017-07-11 | SPNCRNA.1706 | prl106 | before | III:935629..936790 | ||
| 2017-07-07 | SPNCRNA.1702 | prl104 | after | I:5533986..5534754 | ||
| 2017-07-07 | SPNCRNA.1702 | prl104 | before | I:5533986..5534794 | ||
| 2017-05-16 | SPSNORNA.41 | snR46 | after | III:complement(1717920.. | Switched from + strand to - strand | pers. comm. Francois Bachand |
| 2017-05-16 | SPSNORNA.41 | snR46 | before | III:1717920..1718087 | Switched from + strand to - strand | pers. comm. Francois Bachand |
| 2014-11-06 | SPNCRNA.287 | after | II:complement(21060.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.287 | before | II:21025..21701 | |||
| 2014-11-06 | SPNCRNA.291 | after | II:complement(103165.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.291 | before | II:103208..104381 | |||
| 2014-11-06 | SPNCRNA.293 | after | II:120577..121643 | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.293 | before | II:120652..121497 | |||
| 2014-11-06 | SPNCRNA.316 | after | II:complement(591798.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.316 | before | II:591646..592613 | |||
| 2014-10-21 | SPATRNASER.03 | after | I:join(4265149.. | |||
| 2014-10-21 | SPATRNASER.03 | before | I:4265149..4265245 | |||
| 2014-08-07 | SPSNORNA.25 | snoZ30 | after | II:2044411..2044505 | ||
| 2014-08-07 | SPSNORNA.25 | snoZ30 | before | II:2044273..2044572 | ||
| 2014-07-25 | SPSNRNA.02 | snu2 | after | I:complement(959370.. | ||
| 2014-07-25 | SPSNRNA.02 | snu2 | before | I:complement(959370.. | ||
| 2014-06-19 | SPSNRNA.02 | snu2 | after | I:complement(959370.. | represents the actual functional RNA | PMID:3244367, |
| 2014-06-19 | SPSNRNA.02 | snu2 | before | I:complement(959305.. | represents the actual functional RNA | PMID:3244367 |
| 2014-06-19 | SPSNRNA.03 | snu3 | after | I:complement(987570.. | represents the actual functional RNA | PMID:3194197, |
| 2014-06-19 | SPSNRNA.03 | snu3 | before | I:complement(987631.. | represents the actual functional RNA | PMID:3194197 |
| 2014-06-19 | SPSNRNA.06 | snu6 | after | I:complement(join(2562276.. | represents the actual functional RNA | PMID:2909894, |
| 2014-06-19 | SPSNRNA.06 | snu6 | before | I:complement(join(2562085.. | represents the actual functional RNA | PMID:2909894 |
| 2014-06-19 | SPSNRNA.01 | snu1 | after | II:3020205..3020353 | represents the actual functional RNA | PMID:2188102, |
| 2014-06-19 | SPSNRNA.01 | snu1 | before | II:3019819..3020472 | represents the actual functional RNA | PMID:2188102 |
| 2014-06-19 | SPSNRNA.04 | snu4 | after | II:complement(467233.. | represents the actual functional RNA | PMID:2795654, |
| 2014-06-19 | SPSNRNA.04 | snu4 | before | II:complement(467025.. | represents the actual functional RNA | PMID:2795654 |
| 2014-06-19 | SPSNRNA.05 | snu5 | after | II:3236867..3236986 | represents the actual functional RNA | PMID:2587274, |
| 2014-06-19 | SPSNRNA.05 | snu5 | before | II:3236617..3237051 | represents the actual functional RNA | PMID:2587274 |
| 2014-06-19 | SPSNRNA.07 | snu32 | after | II:complement(3958832.. | represents the actual functional RNA | PMID:1560765, |
| 2014-06-19 | SPSNRNA.07 | snu32 | before | II:complement(3958768.. | represents the actual functional RNA | PMID:1560765 |
| 2014-06-12 | SPNCRNA.98 | srp7 | after | I:4268662..4268916 | represents the actual functional RNA | PMID:2837764, |
| 2014-06-12 | SPNCRNA.98 | srp7 | before | I:4268566..4269064 | represents the actual functional RNA | PMID:2837764, |
| 2013-08-13 | SPNCRNA.84 | after | I:complement(3753160.. | |||
| 2013-08-13 | SPNCRNA.84 | before | I:complement(3753160.. | |||
| 2013-08-13 | SPNCRNA.95 | after | I:3789400..3789948 | EMBL:AU010014, | ||
| 2013-08-13 | SPNCRNA.95 | before | I:3789400..3789821 | EMBL:SPC0079 | ||
| 2013-08-09 | SPNCRNA.95 | after | I:3789400..3789821 | |||
| 2013-08-09 | SPNCRNA.95 | before | I:3789585..3789948 | |||
| 2013-02-07 | SPNCRNA.1572 | after | II:3008602..3011490 | |||
| 2013-02-07 | SPNCRNA.1572 | before | II:3008602..3011536 | |||
| 2012-08-06 | SPNCRNA.304 | after | II:complement(360439.. | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.304 | before | II:complement(360425.. | |||
| 2012-08-06 | SPNCRNA.322 | after | II:674049..676227 | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.322 | before | II:674078..676143 | |||
| 2012-08-06 | SPNCRNA.438 | after | II:complement(4194849.. | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.438 | before | II:complement(4194849.. | |||
| 2012-02-02 | SPBTRNASER.06 | after | II:join(3350594.. | |||
| 2012-02-02 | SPBTRNASER.06 | before | II:3350594..3350688 | |||
| 2011-08-29 | SPNCRNA.511 | after | III:2011026..2012559 | PMID:21511999 | ||
| 2011-08-29 | SPNCRNA.511 | before | III:2011061..2012433 | |||
| 2011-08-29 | SPNCRNA.519 | after | III:2362179..2362725 | PMID:21511999 | ||
| 2011-08-29 | SPNCRNA.519 | before | III:2362248..2362743 | |||
| 2011-08-29 | SPNCRNA.67 | prl67 | after | III:1431135..1433068 | PMID:21511999 | |
| 2011-08-29 | SPNCRNA.67 | prl67 | before | III:1432003..1432625 | ||
| 2011-08-23 | SPNCRNA.388 | after | II:2115592..2117167 | PMID:21511999 | ||
| 2011-08-23 | SPNCRNA.388 | before | II:2115667..2117167 | |||
| 2011-08-22 | SPBTRNAARG.05 | after | II:complement(join(1160893.. | |||
| 2011-08-22 | SPBTRNAARG.05 | before | II:complement(1160893.. | |||
| 2011-08-22 | SPBTRNALEU.05 | after | II:complement(join(1402444.. | |||
| 2011-08-22 | SPBTRNALEU.05 | before | II:complement(1402444.. | |||
| 2011-08-22 | SPBTRNALEU.06 | after | II:complement(join(1598745.. | |||
| 2011-08-22 | SPBTRNALEU.06 | before | II:complement(1598745.. | |||
| 2011-08-22 | SPBTRNALEU.07 | after | II:complement(join(1644083.. | |||
| 2011-08-22 | SPBTRNALEU.07 | before | II:complement(1644083.. | |||
| 2011-08-22 | SPBTRNALYS.07 | after | II:join(1599706.. | |||
| 2011-08-22 | SPBTRNALYS.07 | before | II:1599706..1599788 | |||
| 2011-08-22 | SPBTRNALYS.08 | after | II:join(1645044.. | |||
| 2011-08-22 | SPBTRNALYS.08 | before | II:1645044..1645126 | |||
| 2011-08-22 | SPBTRNALYS.09 | after | II:join(3814134.. | |||
| 2011-08-22 | SPBTRNALYS.09 | before | II:3814134..3814216 | |||
| 2011-08-22 | SPBTRNAMET.05 | after | II:complement(join(1598075.. | |||
| 2011-08-22 | SPBTRNAMET.05 | before | II:complement(1598075.. | |||
| 2011-08-22 | SPBTRNATYR.02 | after | II:join(1598511.. | |||
| 2011-08-22 | SPBTRNATYR.02 | before | II:1598511..1598594 | |||
| 2011-08-22 | SPBTRNATYR.03 | after | II:join(1643849.. | |||
| 2011-08-22 | SPBTRNATYR.03 | before | II:1643849..1643932 | |||
| 2011-08-22 | SPBTRNATYR.04 | after | II:join(3814558.. | |||
| 2011-08-22 | SPBTRNATYR.04 | before | II:3814558..3814641 | |||
| 2011-08-22 | SPBTRNAVAL.05 | after | II:complement(join(1600967.. | |||
| 2011-08-22 | SPBTRNAVAL.05 | before | II:complement(1600967.. | |||
| 2011-08-22 | SPBTRNAVAL.07 | after | II:join(1629159.. | |||
| 2011-08-22 | SPBTRNAVAL.07 | before | II:1629159..1629241 | |||
| 2011-08-22 | SPBTRNAVAL.08 | after | II:complement(join(1646305.. | |||
| 2011-08-22 | SPBTRNAVAL.08 | before | II:complement(1646305.. | |||
| 2011-08-22 | SPNCRNA.111 | after | II:complement(3978331.. | PMID:21511999 | ||
| 2011-08-22 | SPNCRNA.111 | before | II:complement(3978616.. | |||
| 2011-08-22 | SPCTRNALEU.12 | after | III:complement(join(1096085.. | |||
| 2011-08-22 | SPCTRNALEU.12 | before | III:complement(1096085.. | |||
| 2011-08-22 | SPCTRNALEU.13 | after | III:join(1102809.. | |||
| 2011-08-22 | SPCTRNALEU.13 | before | III:1102809..1102909 | |||
| 2011-08-22 | SPCTRNALYS.11 | after | III:complement(join(1139536.. | |||
| 2011-08-22 | SPCTRNALYS.11 | before | III:complement(1139536.. | |||
| 2011-08-22 | SPCTRNALYS.12 | after | III:join(1475034.. | |||
| 2011-08-22 | SPCTRNALYS.12 | before | III:1475034..1475116 | |||
| 2011-08-22 | SPCTRNASER.10 | after | III:join(1253193.. | |||
| 2011-08-22 | SPCTRNASER.10 | before | III:1253193..1253287 | |||
| 2011-08-22 | SPCTRNASER.13 | after | III:join(2072080.. | |||
| 2011-08-22 | SPCTRNASER.13 | before | III:2072080..2072174 | |||
| 2011-08-22 | SPCTRNAVAL.09 | after | III:join(1092934.. | |||
| 2011-08-22 | SPCTRNAVAL.09 | before | III:1092934..1093016 | |||
| 2011-08-22 | SPCTRNAVAL.10 | after | III:complement(join(1105978.. | |||
| 2011-08-22 | SPCTRNAVAL.10 | before | III:complement(1105978.. | |||
| 2011-08-22 | SPCTRNAVAL.12 | after | III:complement(join(1065778.. | |||
| 2011-08-22 | SPCTRNAVAL.12 | before | III:complement(1065778.. | |||
| 2011-03-24 | SPBTRNAASP.03 | after | II:1602188..1602260 | |||
| 2011-03-24 | SPBTRNAASP.03 | before | II:complement(1602347.. | |||
| 2010-05-20 | SPNCRNA.304 | after | II:complement(360425.. | |||
| 2010-05-20 | SPNCRNA.304 | before | II:360425..362854 | |||
| 2010-02-17 | SPSNORNA.29 | sno52 | after | I:complement(339548.. | ||
| 2010-02-17 | SPSNORNA.29 | sno52 | before | I:339548..339642 | ||
| 2010-01-29 | SPSNORNA.42 | snR90 | after | I:complement(4937170.. | ||
| 2010-01-29 | SPSNORNA.42 | snR90 | before | I:complement(4937237.. | ||
| 2010-01-29 | SPNCRNA.585 | after | III:complement(2010261.. | |||
| 2010-01-29 | SPNCRNA.585 | before | III:complement(2010261.. | |||
| 2009-10-23 | SPNCRNA.53 | prl53 | after | I:complement(4008054.. | EMBL:AB084861, | |
| 2009-10-23 | SPNCRNA.53 | prl53 | before | I:4008172..4008681 | ||
| 2009-08-19 | SPNCRNA.223 | after | I:complement(3534486.. | |||
| 2009-08-19 | SPNCRNA.223 | before | I:3534486..3536133 | |||
| 2008-12-10 | SPNCRNA.31 | prl31 | after | I:2975608..2976007 | ||
| 2008-12-10 | SPNCRNA.31 | prl31 | before | I:complement(2975608.. | ||
| 2008-09-22 | SPNCRNA.445 | snoR61 | after | II:complement(join(3874254.. | updated to extend 3’ and added splice and identified as snR6 | pers. comm. J. Matthews |
| 2008-09-22 | SPNCRNA.445 | before | II:complement(3874378.. | updated to extend 3’ and added splice and identified as snR6 | pers. comm. J. Matthews | |
| 2007-12-19 | SPNCRNA.25 | prl25 | after | II:complement(2567830.. | ||
| 2007-12-19 | SPNCRNA.25 | prl25 | before | II:2567830..2568256 | ||
| 2007-04-12 | SPNCRNA.92 | after | I:3875656..3876105 | |||
| 2007-04-12 | SPNCRNA.92 | before | I:complement(3875656.. | |||
| 2007-02-26 | SPNCRNA.82 | mrp1 | after | I:1234451..1234849 | upon realisation that this corresponded to RNase MRP | pers. comm. Val Wood, |
| 2007-02-26 | SPNCRNA.82 | before | I:1234705..1234837 | upon realisation that this corresponded to RNase MRP | pers. comm. Val Wood | |
| 2006-09-05 | SPRRNA.31 | after | II:784153..784398 | |||
| 2006-09-05 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-07-01 | SPRRNA.31 | after | II:784199..784398 | |||
| 2006-07-01 | SPRRNA.31 | before | II:784153..784398 | |||
| 2006-06-26 | SPRRNA.31 | after | II:784153..784398 | |||
| 2006-06-26 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-05-17 | SPNCRNA.82 | after | I:1235605..1235737 | |||
| 2006-05-17 | SPNCRNA.82 | mrp1 | before | I:1234451..1234849 | EMBL:EF424786, | |
| 2006-05-17 | SPRRNA.31 | after | II:784199..784398 | |||
| 2006-05-17 | SPRRNA.31 | before | II:783253..783498 | |||
| 2006-02-19 | SPNCRNA.82 | mrp1 | after | I:1234451..1234849 | EMBL:EF424786, | |
| 2006-02-19 | SPNCRNA.82 | before | I:1235605..1235737 | |||
| 2006-02-19 | SPRRNA.31 | after | II:783253..783498 | |||
| 2006-02-19 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-01-03 | SPATRNALYS.04 | after | I:complement(join(2685583.. | |||
| 2006-01-03 | SPATRNALYS.04 | before | I:complement(2685583.. | |||
| 2006-01-03 | SPSNRNA.06 | snu6 | after | I:complement(join(2562985.. | RFAM:RF00026 | |
| 2006-01-03 | SPSNRNA.06 | snu6 | before | I:complement(join(2562985.. | RFAM:00026 | |
| 2006-01-03 | SPNCRNA.131 | tos2 | after | III:1549249..1549797 | ||
| 2006-01-03 | SPNCRNA.131 | tos2 | before | III:1547624..1548172 | ||
| 2006-01-03 | SPNCRNA.132 | tos3 | after | III:1547677..1548889 | ||
| 2006-01-03 | SPNCRNA.132 | tos3 | before | III:1548532..1549744 | ||
| 2006-01-03 | SPNCRNA.69 | tos1 | after | III:1548828..1550437 | ||
| 2006-01-03 | SPNCRNA.69 | tos1 | before | III:1546984..1548593 | ||
| 2005-07-05 | SPNCRNA.86 | after | I:complement(1358711.. | EMBL:AU010322 | ||
| 2005-07-05 | SPNCRNA.86 | before | I:complement(join(1358711.. | |||
| 2005-07-05 | SPSNRNA.06 | snu6 | after | I:complement(join(2562985.. | EMBL:X14196, | |
| 2005-07-05 | SPSNRNA.06 | U6snRNA | before | I:complement(2562985.. | ||
| 2004-09-15 | SPNCRNA.03 | prl3 | after | I:complement(237974.. | ||
| 2004-09-15 | SPNCRNA.03 | before | I:complement(237974.. | |||
| 2003-08-14 | SPBTRNALEU.09 | after | II:complement(3210939.. | |||
| 2003-08-14 | SPBTRNALEU.09 | before | II:complement(2688856.. | |||
| 2003-08-14 | SPBTRNALEU.10 | after | II:3915843..3915921 | |||
| 2003-08-14 | SPBTRNALEU.10 | before | II:complement(3129738.. | |||
| 2003-08-14 | SPBTRNALYS.08 | after | II:1646844..1646926 | |||
| 2003-08-14 | SPBTRNALYS.08 | before | II:3734733..3734815 | |||
| 2003-08-14 | SPCTRNALEU.12 | after | III:complement(1096985.. | |||
| 2003-08-14 | SPCTRNALEU.12 | before | III:1069166..1069244 | |||
| 2003-08-14 | SPCTRNASER.09 | after | III:1066628..1066709 | |||
| 2003-08-14 | SPCTRNASER.09 | before | III:1690613..1690709 | |||
| 2003-08-14 | SPCTRNASER.10 | after | III:1254093..1254187 | |||
| 2003-08-14 | SPCTRNASER.10 | before | III:complement(1776892.. | |||
| 2003-08-14 | SPCTRNASER.11 | after | III:1690613..1690709 | |||
| 2003-08-14 | SPCTRNASER.11 | before | III:2072980..2073074 | |||
| 2002-09-05 | SPBTRNAPRO.07 | after | II:2860314..2860385 | |||
| 2002-09-05 | SPBTRNAPRO.07 | after | II:complement(3281118.. | |||
| 2002-09-05 | SPCTRNAGLY.10 | after | III:2038252..2038322 | |||
| 2002-09-05 | SPCTRNAGLY.10 | after | III:complement(113716.. |
| Date | Systematic id | Primary name | Before / after change | Coordinates | Comment | Reference |
|---|---|---|---|---|---|---|
| 2023-05-03 | SPAC1F8.07c | pdc101 | after | I:complement(join(101836.. | ||
| 2023-05-03 | SPAC1F8.07c | pdc101 | before | I:complement(join(101836.. | ||
| 2023-01-13 | SPBC17D1.06 | dbp3 | after | II:3338751..3340340 | ||
| 2023-01-13 | SPBC17D1.06 | dbp3 | before | II:3338604..3340340 | ||
| 2023-01-10 | SPAC227.11c | yos9 | after | I:complement(join(514552.. | ||
| 2023-01-10 | SPAC227.11c | yos9 | before | I:complement(join(514552.. | ||
| 2022-12-30 | SPBC1E8.04 | Tf2-10 | after | II:join(1965390.. | ||
| 2022-12-30 | SPBC1E8.04 | Tf2-10 | before | II:join(1965390.. | ||
| 2022-12-26 | SPBP16F5.03c | tra1 | after | II:complement(1894433.. | ||
| 2022-12-26 | SPBP16F5.03c | tra1 | before | II:complement(1894433.. | ||
| 2022-12-12 | SPAC9G1.07 | after | I:join(1983182.. | |||
| 2022-12-12 | SPAC9G1.07 | before | I:1983182..1984438 | |||
| 2022-12-12 | SPBC3B8.10 | ina17 | after | II:join(3390968.. | ||
| 2022-12-12 | SPBC3B8.10 | ina17 | before | II:join(3390968.. | ||
| 2022-12-12 | SPBP4H10.12 | after | II:join(2895800.. | |||
| 2022-12-12 | SPBP4H10.12 | before | II:join(2895855.. | |||
| 2022-12-02 | SPAPB1E7.05 | gde1 | after | I:join(3293630.. | ||
| 2022-12-02 | SPAPB1E7.05 | gde1 | before | I:3294111..3297341 | ||
| 2022-10-04 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1169936.. | ||
| 2022-10-04 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1169939.. | ||
| 2022-10-04 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | ||
| 2022-10-04 | SPBC16E9.16c | lsd90 | before | II:complement(join(1947985.. | ||
| 2022-10-04 | SPBC32F12.08c | duo1 | after | II:complement(join(2797658.. | ||
| 2022-10-04 | SPBC32F12.08c | duo1 | before | II:complement(join(2797652.. | ||
| 2022-10-04 | SPCC417.03 | after | III:join(1672003.. | |||
| 2022-10-04 | SPCC417.03 | before | III:join(1672003.. | |||
| 2022-09-16 | SPBC32H8.08c | omh5 | after | II:complement(join(1465811.. | ||
| 2022-09-16 | SPBC32H8.08c | omh5 | before | II:complement(join(1465811.. | ||
| 2022-08-25 | SPAC23E2.02 | lsd2 | after | I:join(446770.. | ||
| 2022-08-25 | SPAC23E2.02 | lsd2 | before | I:join(446491.. | ||
| 2022-08-25 | SPAC343.16 | lys2 | after | I:1675823..1677895 | ||
| 2022-08-25 | SPAC343.16 | lys2 | before | I:1675730..1677895 | ||
| 2022-08-25 | SPBC16H5.11c | skb1 | after | II:join(2277275.. | ||
| 2022-08-25 | SPBC16H5.11c | skb1 | before | II:join(2277215.. | ||
| 2022-08-25 | SPBC13A2.02 | nup82 | after | II:3400618..3403014 | ||
| 2022-08-25 | SPBC13A2.02 | nup82 | before | II:3400603..3403014 | ||
| 2022-08-25 | SPBC13G1.14c | rns1 | after | II:complement(join(3727332.. | ||
| 2022-08-25 | SPBC13G1.14c | rns1 | before | II:complement(join(3727332.. | ||
| 2022-08-25 | SPBC16A3.01 | spn3 | after | II:complement(join(4299042.. | ||
| 2022-08-25 | SPBC16A3.01 | spn3 | before | II:complement(join(4299042.. | ||
| 2022-08-25 | SPBC25D12.05 | trm1 | after | II:3723455..3725029 | ||
| 2022-08-25 | SPBC25D12.05 | trm1 | before | II:3723383..3725029 | ||
| 2022-08-25 | SPBC31F10.17c | after | II:complement(join(3788317.. | |||
| 2022-08-25 | SPBC31F10.17c | before | II:complement(join(3788317.. | |||
| 2022-08-25 | SPBC887.07 | mrpl38 | after | II:join(3551348.. | ||
| 2022-08-25 | SPBC887.07 | mrpl38 | before | II:join(3551318.. | ||
| 2022-08-25 | SPBP8B7.05c | nce103 | after | II:complement(3641216.. | ||
| 2022-08-25 | SPBP8B7.05c | nce103 | before | II:complement(3641216.. | ||
| 2022-08-25 | SPCC1259.12c | gid1 | after | III:complement(join(1056598.. | ||
| 2022-08-25 | SPCC1259.12c | gid1 | before | III:complement(join(1056598.. | ||
| 2022-08-25 | SPCC126.15c | sec65 | after | III:complement(join(2142679.. | ||
| 2022-08-25 | SPCC126.15c | sec65 | before | III:complement(join(2142679.. | ||
| 2022-08-25 | SPCC1620.10 | cwf26 | after | III:join(2163220.. | ||
| 2022-08-25 | SPCC1620.10 | cwf26 | before | III:join(2163205.. | ||
| 2022-08-25 | SPCC1682.01 | qcr9 | after | III:join(371284.. | ||
| 2022-08-25 | SPCC1682.01 | qcr9 | before | III:join(371230.. | ||
| 2022-08-25 | SPCC1682.05c | srp68 | after | III:complement(join(379065.. | ||
| 2022-08-25 | SPCC1682.05c | srp68 | before | III:complement(join(379065.. | ||
| 2022-08-25 | SPCC569.03 | after | III:complement(join(2430334.. | |||
| 2022-08-25 | SPCC569.03 | before | III:complement(join(2430334.. | |||
| 2022-08-25 | SPCC622.11 | lmb1 | after | III:join(1417271.. | ||
| 2022-08-25 | SPCC622.11 | lmb1 | before | III:join(1417100.. | ||
| 2022-08-25 | SPCC825.04c | naa40 | after | III:complement(1030256.. | ||
| 2022-08-25 | SPCC825.04c | naa40 | before | III:complement(1030256.. | ||
| 2022-08-25 | SPCP1E11.06 | apl4 | after | III:2402067..2404577 | ||
| 2022-08-25 | SPCP1E11.06 | apl4 | before | III:2401980..2404577 | ||
| 2022-08-25 | SPBC14C8.01c | cut2 | after | II:complement(2203316.. | ||
| 2022-08-25 | SPBC14C8.01c | cut2 | before | II:complement(2203316.. | ||
| 2022-08-25 | SPBC1703.06 | pof10 | after | II:join(2925563.. | ||
| 2022-08-25 | SPBC1703.06 | pof10 | before | II:join(2925512.. | ||
| 2022-08-25 | SPBC1709.17 | met7 | after | II:join(1132227.. | ||
| 2022-08-25 | SPBC1709.17 | met7 | before | II:join(1132170.. | ||
| 2022-08-25 | SPBC18E5.12c | mas2 | after | II:complement(2096528.. | ||
| 2022-08-25 | SPBC18E5.12c | mas2 | before | II:complement(2096528.. | ||
| 2022-08-25 | SPBC19G7.04 | after | II:join(2349611.. | |||
| 2022-08-25 | SPBC19G7.04 | before | II:join(2349593.. | |||
| 2022-08-25 | SPBC2A9.05c | tvp23 | after | II:complement(join(2956469.. | ||
| 2022-08-25 | SPBC2A9.05c | tvp23 | before | II:complement(join(2956469.. | ||
| 2022-08-25 | SPBC30B4.08 | eri1 | after | II:join(1320740.. | ||
| 2022-08-25 | SPBC30B4.08 | eri1 | before | II:join(1320692.. | ||
| 2022-08-25 | SPBC30D10.09c | hva22 | after | II:join(3083470.. | SPD:10/10A04 | |
| 2022-08-25 | SPBC30D10.09c | before | II:join(3083317.. | SPD:10/10A04 | ||
| 2022-08-25 | SPBC336.10c | tif512 | after | II:complement(2758761.. | ||
| 2022-08-25 | SPBC336.10c | tif512 | before | II:complement(2758761.. | ||
| 2022-08-25 | SPBC337.16 | cho1 | after | II:join(1058422.. | ||
| 2022-08-25 | SPBC337.16 | cho1 | before | II:join(1058347.. | ||
| 2022-08-25 | SPBC428.01c | nup107 | after | II:complement(join(439274.. | ||
| 2022-08-25 | SPBC428.01c | nup107 | before | II:complement(join(439274.. | ||
| 2022-08-25 | SPBC428.18 | cdt1 | after | II:477431..478699 | ||
| 2022-08-25 | SPBC428.18 | cdt1 | before | II:477365..478699 | ||
| 2022-08-25 | SPBC582.05c | brc1 | after | II:complement(join(426160.. | ||
| 2022-08-25 | SPBC582.05c | brc1 | before | II:complement(join(426160.. | ||
| 2022-08-25 | SPBC582.07c | rpn7 | after | II:complement(430551.. | ||
| 2022-08-25 | SPBC582.07c | rpn7 | before | II:complement(430551.. | ||
| 2022-08-25 | SPBC582.08 | alt1 | after | II:join(432595.. | SPD:36/36B08 | |
| 2022-08-25 | SPBC582.08 | before | II:join(432550.. | SPD:36/36B08 | ||
| 2022-08-25 | SPBC685.09 | orc2 | after | II:2782066..2783565 | ||
| 2022-08-25 | SPBC685.09 | orc2 | before | II:2781958..2783565 | ||
| 2022-08-25 | SPBC8D2.10c | rmt3 | after | II:complement(join(1376341.. | ||
| 2022-08-25 | SPBC8D2.10c | rmt3 | before | II:complement(join(1376341.. | ||
| 2022-08-25 | SPBC947.03c | naa38 | after | II:join(676761.. | ||
| 2022-08-25 | SPBC947.03c | naa38 | before | II:join(676629.. | ||
| 2022-08-25 | SPAC1071.09c | after | I:complement(3870660.. | |||
| 2022-08-25 | SPAC1071.09c | before | I:complement(3870660.. | |||
| 2022-08-25 | SPAC17H9.04c | dri1 | after | I:complement(2009905.. | remove MSKLPSPT | |
| 2022-08-25 | SPAC17H9.04c | dri1 | before | I:complement(2009905.. | remove MSKLPSPT | |
| 2022-08-25 | SPAC1952.03 | otu2 | after | I:join(4971189.. | ||
| 2022-08-25 | SPAC1952.03 | otu2 | before | I:join(4971117.. | ||
| 2022-08-25 | SPAC1952.15c | rec24 | after | I:complement(join(4996030.. | ||
| 2022-08-25 | SPAC1952.15c | rec24 | before | I:complement(join(4996030.. | ||
| 2022-08-25 | SPAC19A8.06 | pbr1 | after | I:complement(2475966.. | ||
| 2022-08-25 | SPAC19A8.06 | pbr1 | before | I:complement(2475966.. | ||
| 2022-08-25 | SPAC1B2.03c | elo2 | after | I:complement(join(2811438.. | remove MDLTGAH to get /score=2039.31 | |
| 2022-08-25 | SPAC1B2.03c | elo2 | before | I:complement(join(2811438.. | remove MDLTGAH to get /score=2039.31 | |
| 2022-08-25 | SPAC1B3.18c | mrps18 | after | I:complement(4967223.. | ||
| 2022-08-25 | SPAC1B3.18c | mrps18 | before | I:complement(4967223.. | ||
| 2022-08-25 | SPAC1F12.09 | gpi17 | after | I:join(3818803.. | ||
| 2022-08-25 | SPAC1F12.09 | gpi17 | before | I:join(3818668.. | ||
| 2022-08-25 | SPAC22F8.10c | sap145 | after | I:complement(4804630.. | ||
| 2022-08-25 | SPAC22F8.10c | sap145 | before | I:complement(4804630.. | ||
| 2022-08-25 | SPAC23C11.17 | mdm28 | after | I:join(2167206.. | remove MKYPRTHIQFPS | |
| 2022-08-25 | SPAC23C11.17 | mdm28 | before | I:join(2167170.. | remove MKYPRTHIQFPS | |
| 2022-08-25 | SPAC25B8.08 | after | I:4168263..4169984 | |||
| 2022-08-25 | SPAC25B8.08 | before | I:4168212..4169984 | |||
| 2022-08-25 | SPAC26A3.09c | rga2 | after | I:complement(3348569.. | ||
| 2022-08-25 | SPAC26A3.09c | rga2 | before | I:complement(3348569.. | ||
| 2022-08-25 | SPAC26F1.02 | pnn1 | after | I:complement(join(5181982.. | ||
| 2022-08-25 | SPAC26F1.02 | pnn1 | before | I:complement(join(5181982.. | ||
| 2022-08-25 | SPAC26F1.14c | aif1 | after | I:5146273..5148000 | ||
| 2022-08-25 | SPAC26F1.14c | aif1 | before | I:5146165..5148000 | ||
| 2022-08-25 | SPAC4G9.11c | cmb1 | after | I:complement(2275578.. | ||
| 2022-08-25 | SPAC4G9.11c | cmb1 | before | I:complement(2275578.. | ||
| 2022-08-25 | SPAC4H3.06 | after | I:join(3837449.. | |||
| 2022-08-25 | SPAC4H3.06 | before | I:join(3837431.. | |||
| 2022-08-25 | SPAC521.02 | wss1 | after | I:843296..844084 | ||
| 2022-08-25 | SPAC521.02 | wss1 | before | I:843233..844084 | ||
| 2022-08-25 | SPAC589.02c | med13 | after | I:complement(join(3095075.. | truncated 40 AA | |
| 2022-08-25 | SPAC589.02c | med13 | before | I:complement(join(3095075.. | truncated 40 AA | |
| 2022-08-25 | SPAC637.09 | rex1 | after | I:4555423..4557294 | ||
| 2022-08-25 | SPAC637.09 | rex1 | before | I:4555399..4557294 | ||
| 2022-08-25 | SPAC688.09 | rim2 | after | I:join(3127689.. | ||
| 2022-08-25 | SPAC688.09 | rim2 | before | I:join(3127647.. | ||
| 2022-08-25 | SPAP8A3.12c | tpp2 | after | I:complement(5336815.. | ||
| 2022-08-25 | SPAP8A3.12c | tpp2 | before | I:complement(5336815.. | ||
| 2022-08-25 | SPAPB18E9.01 | trm5 | after | I:join(3974340.. | ||
| 2022-08-25 | SPAPB18E9.01 | trm5 | before | I:join(3974310.. | ||
| 2022-04-03 | SPAC1002.01 | mrx11 | after | I:1798347..1798835 | remove final exon | |
| 2022-04-03 | SPAC1002.01 | mrx11 | before | I:join(1798347.. | remove final exon | |
| 2022-04-03 | SPAC1002.12c | after | I:complement(1818695.. | |||
| 2022-04-03 | SPAC1002.12c | before | I:complement(1818695.. | |||
| 2022-04-03 | SPAC1002.17c | urg2 | after | I:complement(1831012.. | change MSTTTTVSAIRTVEE to MSNITISSHPV | |
| 2022-04-03 | SPAC1002.17c | urg2 | before | I:complement(1831012.. | change MSTTTTVSAIRTVEE to MSNITISSHPV | |
| 2022-04-03 | SPAC1565.08 | cdc48 | after | I:join(1306457.. | ||
| 2022-04-03 | SPAC1565.08 | cdc48 | before | I:join(1306439.. | ||
| 2022-04-03 | SPAC167.04 | pam17 | after | I:complement(join(1554001.. | ||
| 2022-04-03 | SPAC167.04 | pam17 | before | I:complement(join(1554001.. | ||
| 2022-04-03 | SPAC17A5.02c | dbr1 | after | I:complement(join(1754033.. | trim to MRVGVQGC | |
| 2022-04-03 | SPAC17A5.02c | dbr1 | before | I:complement(join(1754033.. | trim to MRVGVQGC | |
| 2022-04-03 | SPAC1A6.10 | tcd1 | after | I:1090729..1092135 | truncate at MAG (AA20) | |
| 2022-04-03 | SPAC1A6.10 | tcd1 | before | I:1090678..1092135 | truncate at MAG (AA20) | |
| 2022-04-03 | SPAC227.11c | yos9 | after | I:complement(join(514552.. | ||
| 2022-04-03 | SPAC227.11c | yos9 | before | I:complement(join(514552.. | ||
| 2022-04-03 | SPAC2F7.08c | snf5 | after | I:complement(546664.. | ||
| 2022-04-03 | SPAC2F7.08c | snf5 | before | I:complement(546664.. | ||
| 2022-04-03 | SPAC30D11.03 | ddx27 | after | I:complement(join(1116057.. | trim to MET at AA41 | |
| 2022-04-03 | SPAC30D11.03 | ddx27 | before | I:complement(join(1116057.. | trim to MET at AA41 | |
| 2022-04-03 | SPAC3H1.05 | ste24 | after | I:join(1938990.. | new start MGIL | |
| 2022-04-03 | SPAC3H1.05 | ste24 | before | I:join(1938900.. | new start MGIL | |
| 2022-04-03 | SPAC3H1.12c | snt2 | after | I:complement(1961710.. | ||
| 2022-04-03 | SPAC3H1.12c | snt2 | before | I:complement(1961710.. | ||
| 2022-04-03 | SPAC4G8.07c | trm2 | after | I:complement(join(774000.. | ||
| 2022-04-03 | SPAC4G8.07c | trm2 | before | I:complement(join(774000.. | ||
| 2022-04-03 | SPAC56E4.04c | cut6 | after | I:complement(join(1246095.. | trim to MET at AA34 | |
| 2022-04-03 | SPAC56E4.04c | cut6 | before | I:complement(join(1246095.. | trim to MET at AA34 | |
| 2022-04-03 | SPAC56F8.04c | ppt1 | after | I:complement(1133226.. | ||
| 2022-04-03 | SPAC56F8.04c | ppt1 | before | I:complement(join(1133226.. | ||
| 2022-04-03 | SPAC57A7.12 | ssz1 | after | I:complement(join(1515089.. | ||
| 2022-04-03 | SPAC57A7.12 | ssz1 | before | I:complement(join(1515089.. | ||
| 2022-04-03 | SPAC630.14c | tup12 | after | I:complement(join(374683.. | ||
| 2022-04-03 | SPAC630.14c | tup12 | before | I:complement(join(374683.. | ||
| 2021-07-27 | SPAC4F10.02 | aap1 | after | I:join(4832911.. | PMID:34169534 | |
| 2021-07-27 | SPAC4F10.02 | aap1 | before | I:join(4832929.. | PMID:34169534 | |
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1169939.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.2 | crd1 | after | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.2 | crd1 | before | I:complement(join(1169939.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | after | I:complement(join(1170705.. | ||
| 2021-04-29 | SPAC22A12.08c.1 | crd1 | before | I:complement(join(1169939.. | ||
| 2020-05-01 | SPAC2E12.05 | wtf1 | after | I:join(5064781.. | pseudo->coding | PMID:28631610, |
| 2020-05-01 | SPAC2E12.05 | wtf1 | before | I:5064305..5066231 | pseudo->coding | PMID:28631610 |
| 2020-05-01 | SPBC1706.02c | wtf2 | after | II:complement(join(593185.. | PMID:28631610, | |
| 2020-05-01 | SPBC1706.02c | wtf2 | before | II:complement(join(593188.. | PMID:28631610, | |
| 2020-05-01 | SPCC162.04c | wtf13 | after | III:complement(join(1580123.. | PMID:28631610, | |
| 2020-05-01 | SPCC162.04c | wtf13 | before | III:complement(join(1580123.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.06c | wtf17 | after | III:complement(join(1805166.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.06c | wtf17 | before | III:complement(join(1805166.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.07c | wtf18 | after | III:complement(join(1807004.. | PMID:28631610, | |
| 2020-05-01 | SPCC285.07c | wtf18 | before | III:complement(join(1807004.. | PMID:28631610, | |
| 2020-05-01 | SPCC306.10 | wtf8 | after | III:join(427445.. | PMID:28631610 | |
| 2020-05-01 | SPCC306.10 | wtf8 | before | III:join(427445.. | ||
| 2020-05-01 | SPCC548.02c | wtf3 | after | III:complement(join(219185.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.02c | wtf3 | before | III:complement(join(219185.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.03c | wtf4 | after | III:complement(join(221199.. | PMID:28631610, | |
| 2020-05-01 | SPCC548.03c | wtf4 | before | III:complement(join(221199.. | PMID:28631610, | |
| 2020-05-01 | SPCC553.05c | wtf6 | after | III:complement(join(297140.. | introduces stop codon at position 25 | PMID:28631610, |
| 2020-05-01 | SPCC553.05c | wtf6 | before | III:complement(join(297354.. | introduces stop codon at position 25 | PMID:28631610, |
| 2020-05-01 | SPCC576.16c | wtf22 | after | III:complement(join(2109178.. | introduces stop codon at position 50 | PMID:28631610, |
| 2020-05-01 | SPCC576.16c | wtf22 | before | III:complement(join(2109181.. | introduces stop codon at position 50 | PMID:28631610 |
| 2020-05-01 | SPCC622.21 | wtf12 | after | III:join(1401530.. | introduces stop codon at position 274 | PMID:30991417, |
| 2020-05-01 | SPCC622.21 | wtf12 | before | III:join(1401530.. | introduces stop codon at position 274 | PMID:30991417 |
| 2020-05-01 | SPCC736.05 | wtf7 | after | III:join(320617.. | PMID:28631610, | |
| 2020-05-01 | SPCC736.05 | wtf7 | before | III:join(320608.. | PMID:28631610, | |
| 2020-05-01 | SPCC830.02 | wtf24 | after | III:join(2181204.. | introduces stop codon at position 145 | PMID:28631610, |
| 2020-05-01 | SPCC830.02 | wtf24 | before | III:join(2181204.. | introduces stop codon at position 145 | PMID:28631610, |
| 2020-04-30 | SPMIT.03 | cox1-I2b | after | mitochondrial:6965.. | ||
| 2020-04-30 | SPMIT.03 | cox1-I2b | before | mitochondrial:<6845.. | ||
| 2020-04-30 | SPMIT.01 | cox1 | after | mitochondrial:join(4885.. | ||
| 2020-04-30 | SPMIT.01 | cox1 | before | mitochondrial:join(4886.. | ||
| 2020-04-30 | SPMIT.03 | cox1-I2b | after | mitochondrial:<6845.. | ||
| 2020-04-30 | SPMIT.03 | before | mitochondrial:<6966.. | |||
| 2020-04-30 | SPMIT.04 | cox3 | after | mitochondrial:8961.. | ||
| 2020-04-30 | SPMIT.04 | cox3 | before | mitochondrial:8947.. | ||
| 2020-04-30 | SPMIT.05 | cob1 | after | mitochondrial:join(10175.. | ||
| 2020-04-30 | SPMIT.05 | cob1 | before | mitochondrial:join(10173.. | ||
| 2020-04-30 | SPMIT.06 | after | mitochondrial:<10859.. | |||
| 2020-04-30 | SPMIT.06 | before | mitochondrial:10857.. | |||
| 2020-04-30 | SPMIT.07 | atp6 | after | mitochondrial:14758.. | ||
| 2020-04-30 | SPMIT.07 | atp6 | before | mitochondrial:14756.. | ||
| 2020-04-30 | SPMIT.11 | cox2 | after | mitochondrial:18563.. | ||
| 2020-04-30 | SPMIT.11 | cox2 | before | mitochondrial:18561.. | ||
| 2019-10-16 | SPBPB8B6.04c | grt1 | after | II:complement(join(49143.. | ||
| 2019-10-16 | SPBPB8B6.04c | grt1 | before | II:complement(join(49152.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | after | II:complement(350783.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | before | II:complement(join(350692.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | after | II:complement(join(350692.. | ||
| 2018-08-08 | SPBC1271.09 | tgp1 | before | II:complement(350783.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | after | II:complement(350783.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | before | II:complement(352200.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | after | II:complement(352200.. | ||
| 2018-08-05 | SPBC1271.09 | tgp1 | before | II:complement(join(350692.. | ||
| 2018-02-19 | SPBPB8B6.04c | grt1 | after | II:complement(join(49152.. | ||
| 2018-02-19 | SPBPB8B6.04c | grt1 | before | II:complement(join(49143.. | ||
| 2017-09-14 | SPBC577.05c | rec27 | after | II:complement(join(757566.. | PMID:28469148 | |
| 2017-09-14 | SPBC577.05c | rec27 | before | II:complement(join(757566.. | PMID:28469148 | |
| 2017-05-02 | SPAC9G1.15c | mzt1 | after | I:complement(1985350.. | ||
| 2017-05-02 | SPAC9G1.15c | mzt1 | before | I:complement(1985350.. | ||
| 2017-04-17 | SPBC530.13 | lsc1 | after | II:join(824374.. | Frameshifted by Chr_II:825012!G→A | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-17 | SPBC530.13 | lsc1 | before | II:join(824374.. | Frameshifted by Chr_II:825012!G→A | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1071.01c | pta1 | after | I:complement(join(3855626.. | Frameshifted by Chr_I:3855790!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1071.01c | pta1 | before | I:complement(3855780.. | Frameshifted by Chr_I:3855790!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC12B10.09 | pet801 | after | I:join(4588487.. | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPAC12B10.09 | pet801 | before | I:join(4588250.. | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPAC1486.05 | nup189 | after | I:join(3197028.. | Frameshifted by Chr_I:3197528!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC1486.05 | nup189 | before | I:join(3197028.. | Frameshifted by Chr_I:3197528!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29A4.03c | mrps9 | after | I:join(5142407.. | Frameshifted by Chr_I:5142627!A→AG | PMID:26615217; pers. comm. Li-Lin Du, |
| 2017-04-12 | SPAC29A4.03c | before | I:join(5142407.. | Frameshifted by Chr_I:5142627!A→AG | PMID:26615217; pers. comm. Li-Lin Du, | |
| 2017-04-12 | SPAC29E6.03c | uso1 | after | I:complement(join(4405990.. | Frameshifted by Chr_I:4407494!T→TG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.03c | uso1 | before | I:complement(join(4405990.. | Frameshifted by Chr_I:4407494!T→TG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.04 | nnf1 | after | I:join(4409773.. | Frameshifted by Chr_I:4410191!CG→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC29E6.04 | nnf1 | before | I:join(4409773.. | Frameshifted by Chr_I:4410191!CG→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.06 | mvp1 | after | I:complement(join(3459233.. | Frameshifted by Chr_I:3460318!T→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.06 | mvp1 | before | I:complement(join(3459233.. | Frameshifted by Chr_I:3460318!T→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.09 | sod22 | after | I:complement(join(3450056.. | Frameshifted by Chr_I:3450130!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC3A11.09 | sod22 | before | I:complement(join(3450114.. | Frameshifted by Chr_I:3450130!GT→G | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC688.08 | srb8 | after | I:join(3123163.. | Frameshifted by Chr_I:3125118!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPAC688.08 | srb8 | before | I:join(3123163.. | Frameshifted by Chr_I:3125118!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | Frameshifted by Chr_II:3040332!C→CG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC13E7.01 | cwf22 | before | II:join(3037988.. | Frameshifted by Chr_II:3040332!C→CG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC14C8.09c | dbl3 | after | II:complement(join(2219430.. | Frameshifted by Chr_II:2219928!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC14C8.09c | dbl3 | before | II:complement(join(2219430.. | Frameshifted by Chr_II:2219928!A→AT | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16D10.10 | tad2 | after | II:join(3618117.. | Frameshifted by Chr_II:3619003!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16D10.10 | tad2 | before | II:join(3618117.. | Frameshifted by Chr_II:3619003!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | Frameshifted by Chr_II:1948953!GA→G and Chr_II:1950050!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC16E9.16c | lsd90 | before | II:complement(join(1947985.. | Frameshifted by Chr_II:1948953!GA→G and Chr_II:1950050!A→AG | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1A4.06c | tam41 | after | II:complement(join(1987044.. | Frameshifted by Chr_II:1987101!CG→C and Chr_II:1987117!TG→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1A4.06c | tam41 | before | II:complement(join(1987044.. | Frameshifted by Chr_II:1987101!CG→C and Chr_II:1987117!TG→T | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC1E8.03c | after | II:complement(join(1960166.. | Frameshifted by Chr_II:1960392!A→AG | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC1E8.03c | before | II:complement(1960384.. | Frameshifted by Chr_II:1960392!A→AG | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC23G7.06c | after | II:complement(join(2106448.. | Frameshifted by Chr_II:2108180!T→TA | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC23G7.06c | before | II:complement(join(2106448.. | Frameshifted by Chr_II:2108180!T→TA | PMID:26615217; pers. comm. Li-Lin Du | |
| 2017-04-12 | SPBC29A3.08 | pof4 | after | II:join(2053033.. | Frameshifted by Chr_II:2053516!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC29A3.08 | pof4 | before | II:join(2053033.. | Frameshifted by Chr_II:2053516!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC32F12.08c | duo1 | after | II:complement(join(2797652.. | Frameshifted by Chr_II:2798040!CT→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC32F12.08c | duo1 | before | II:complement(2798007.. | Frameshifted by Chr_II:2798040!CT→C | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC4F6.10 | vps901 | after | II:join(2708076.. | Frameshifted by Chr_II:2709414!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-12 | SPBC4F6.10 | vps901 | before | II:join(2708076.. | Frameshifted by Chr_II:2709414!G→GC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC17G8.01c | trl1 | after | I:complement(join(2341346.. | Frameshifted by Chr_I:2343703!G→GA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC17G8.01c | trl1 | before | I:complement(join(2341346.. | Frameshifted by Chr_I:2343703!G→GA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC3A12.04c | rpp1 | after | I:complement(join(1424660.. | Frameshifted by Chr_I:1424708!CA→C | PMID:26615217, |
| 2017-04-04 | SPAC3A12.04c | rpp1 | before | I:complement(join(1424697.. | Frameshifted by Chr_I:1424708!CA→C | PMID:26615217, |
| 2017-04-04 | SPAC823.04 | rrp36 | after | I:join(2587729.. | Frameshifted by Chr_I:2588066!C→CA and Chr_I:2588021!C→CA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAC823.04 | rrp36 | before | I:join(2587729.. | Frameshifted by Chr_I:2588066!C→CA and Chr_I:2588021!C→CA | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAP27G11.10c | nup184 | after | I:complement(join(1624885.. | Frameshifted by Chr_I:1625092!T→TC | PMID:26615217; pers. comm. Li-Lin Du |
| 2017-04-04 | SPAP27G11.10c | nup184 | before | I:complement(join(1625076.. | Frameshifted by Chr_I:1625092!T→TC | PMID:26615217; pers. comm. Li-Lin Du |
| 2016-04-19 | SPBC21B10.12 | rec6 | after | II:complement(join(1649038.. | PMID:26917764 | |
| 2016-04-19 | SPBC21B10.12 | rec6 | before | II:complement(join(1649038.. | PMID:26917764 | |
| 2016-03-17 | SPAC22F3.11c | snu23 | after | I:join(682874.. | based on ribosome profiling | PMID:22365419, |
| 2016-03-17 | SPAC22F3.11c | snu23 | before | I:join(682874.. | based on ribosome profiling | PMID:22365419, |
| 2016-03-17 | SPAC29A4.23 | after | I:join(5139024.. | Frameshifted; intron/exon boundary changes; coordinates changed | PMID:26494834 | |
| 2016-03-17 | SPAC29A4.23 | before | I:join(5139024.. | Frameshifted; intron/exon boundary changes; coordinates changed | PMID:26494834 | |
| 2016-03-17 | SPAPB24D3.05c | after | I:complement(join(2954983.. | |||
| 2016-03-17 | SPAPB24D3.05c | before | I:complement(join(2954983.. | |||
| 2016-02-09 | SPCC622.17 | apn1 | after | III:join(1435178.. | ||
| 2016-02-09 | SPCC622.17 | apn1 | before | III:join(1435178.. | ||
| 2015-10-14 | SPBC13G1.04c | abh1 | after | II:complement(join(3732806.. | N-terminal shortened to use downstream methionine | PMID:22365419 |
| 2015-10-14 | SPBC13G1.04c | abh1 | before | II:complement(join(3732806.. | N-terminal shortened to use downstream methionine | PMID:22365419 |
| 2015-09-01 | SPAC1486.05 | nup189 | after | I:join(3197028.. | ||
| 2015-09-01 | SPAC1486.05 | nup189 | before | I:join(3197028.. | ||
| 2015-04-14 | SPAC1486.05 | nup189 | after | I:join(3197028.. | pers. comm. Y. Hiraoka | |
| 2015-04-14 | SPAC1486.05 | nup189 | before | I:join(3197028.. | pers. comm. Y. Hiraoka | |
| 2014-07-08 | SPAC1D4.08 | pis1 | after | I:join(650488.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC1D4.08 | pis1 | before | I:join(650814.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC22F3.04 | mug62 | after | I:complement(join(698033.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-08 | SPAC22F3.04 | mug62 | before | I:complement(join(698033.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-07 | SPCC320.09 | hem15 | after | III:complement(join(149153.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-07 | SPCC320.09 | hem15 | before | III:complement(join(149153.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC146.01 | med15 | after | II:join(996797.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC146.01 | med15 | before | II:join(996843.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC27B12.10c | tom7 | after | II:complement(join(1343913.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC27B12.10c | tom7 | before | II:complement(join(1344032.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPBC839.02 | after | II:597611..599125 | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPBC839.02 | before | II:join(597611.. | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPCC162.07 | ent1 | after | III:complement(join(1571648.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPCC162.07 | ent1 | before | III:complement(join(1571648.. | based on ribosome profiling | PMID:24929437 |
| 2014-07-04 | SPCC417.03 | after | III:join(1672003.. | based on ribosome profiling | PMID:24929437 | |
| 2014-07-04 | SPCC417.03 | before | III:join(1672003.. | based on ribosome profiling | PMID:24929437 | |
| 2014-05-06 | SPBC17G9.09 | tif213 | after | II:2187712..2189052 | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | before | II:join(2187712.. | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | after | II:join(2187712.. | ||
| 2014-05-06 | SPBC17G9.09 | tif213 | before | II:2187712..2189052 | ||
| 2014-01-07 | SPAC5H10.06c | adh4 | after | I:complement(156548.. | N-terminal shortened to use downstream methionine; removed 43 amino acids; UTR exon annotated | PMID:24003116 |
| 2014-01-07 | SPAC5H10.06c | adh4 | before | I:complement(156548.. | N-terminal shortened to use downstream methionine; removed 43 amino acids; UTR exon annotated | PMID:24003116 |
| 2013-11-26 | SPBC3D6.04c | mad1 | after | II:complement(join(1274979.. | N-terminal shortened to use downstream methionine; removed 13 amino acids | pers. comm. Silke Hauf |
| 2013-11-26 | SPBC3D6.04c | mad1 | before | II:complement(join(1274979.. | N-terminal shortened to use downstream methionine; removed 13 amino acids | pers. comm. Silke Hauf |
| 2013-11-22 | SPBC25B2.07c | mmb1 | after | II:complement(2609038.. | N-terminal shortened to use downstream methionine | PMID:21856157 |
| 2013-11-22 | SPBC25B2.07c | mmb1 | before | II:complement(2609038.. | N-terminal shortened to use downstream methionine | PMID:21856157 |
| 2013-11-01 | SPAC9G1.15c | mzt1 | after | I:complement(1985350.. | N-terminal shortened to use downstream methionine | PMID:23885124, |
| 2013-11-01 | SPAC9G1.15c | mzt1 | before | I:complement(1985350.. | N-terminal shortened to use downstream methionine | PMID:23885124, |
| 2013-07-19 | SPAC4A8.08c | vrs2 | after | I:complement(join(2558600.. | ||
| 2013-07-19 | SPAC4A8.08c | vrs2 | before | I:complement(join(2558600.. | KEGG:MAP00290, | |
| 2012-12-07 | SPAC2F3.13c | after | I:complement(join(3949057.. | removed N terminal region overlapping with plp1 | ||
| 2012-12-07 | SPAC2F3.13c | before | I:complement(join(3947930.. | removed N terminal region overlapping with plp1 | ||
| 2012-11-01 | SPAC4A8.08c | vrs2 | after | I:complement(join(2558600.. | ||
| 2012-11-01 | SPAC4A8.08c | vrs2 | before | I:complement(join(2558600.. | ||
| 2012-06-27 | SPBC1E8.04 | Tf2-10 | after | II:join(1965390.. | ||
| 2012-06-27 | SPBC1E8.04 | Tf2-10-pseudo | before | II:1965390..1969387 | ||
| 2012-06-27 | SPCC1494.11c | Tf2-13 | after | III:complement(join(2320320.. | ||
| 2012-06-27 | SPCC1494.11c | Tf2-13-pseudo | before | III:complement(2320320.. | ||
| 2012-01-17 | SPBC1861.08c | lea1 | after | II:complement(join(4145289.. | ||
| 2012-01-17 | SPBC1861.08c | lea1 | before | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC1861.08c | lea1 | after | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC1861.08c | lea1 | before | II:complement(join(4145289.. | ||
| 2011-12-14 | SPBC29A3.06 | after | II:join(2048228.. | N terminal extended | ||
| 2011-12-14 | SPBC29A3.06 | before | II:join(2048336.. | N terminal extended | ||
| 2011-12-14 | SPBC30D10.16 | pha2 | after | II:complement(join(3064223.. | ||
| 2011-12-14 | SPBC30D10.16 | pha2 | before | II:complement(join(3064223.. | ||
| 2011-12-14 | SPBPB10D8.03 | after | II:87727..89029 | |||
| 2011-12-14 | SPBPB10D8.03 | before | II:join(87727.. | |||
| 2011-12-14 | SPCC1281.07c | after | III:complement(1397625.. | N terminal extended by 24 amino acids | ||
| 2011-12-14 | SPCC1281.07c | before | III:complement(1397625.. | N terminal extended by 24 amino acids | ||
| 2011-12-14 | SPCC4B3.05c | hem12 | after | III:join(1166559.. | N terminal extended by 4 amino acids based on homology | |
| 2011-12-14 | SPCC4B3.05c | hem12 | before | III:join(1166571.. | N terminal extended by 4 amino acids based on homology | |
| 2011-12-14 | SPCC622.17 | apn1 | after | III:join(1435178.. | ||
| 2011-12-14 | SPCC622.17 | apn1 | before | III:join(1435250.. | ||
| 2011-10-11 | SPMIT.03 | after | mitochondrial:<6966.. | |||
| 2011-10-11 | SPMIT.03 | before | mitochondrial:<6845.. | |||
| 2011-08-27 | SPAC23A1.20 | new11 | after | I:complement(join(4100755.. | ||
| 2011-08-27 | SPAC23A1.20 | new11 | before | I:complement(4100755.. | ||
| 2011-08-22 | SPAC24H6.06 | sld3 | after | I:complement(join(476549.. | ||
| 2011-08-22 | SPAC24H6.06 | sld3 | before | I:complement(join(476549.. | ||
| 2011-08-22 | SPAC4G9.22 | after | I:2292013..2292297 | |||
| 2011-08-22 | SPAC4G9.22 | before | I:2291983..2292297 | |||
| 2011-08-22 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | ||
| 2011-08-22 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | ||
| 2011-08-22 | SPBC1711.10c | npl4 | after | II:complement(join(2152459.. | ||
| 2011-08-22 | SPBC1711.10c | npl4 | before | II:complement(join(2152462.. | ||
| 2011-04-18 | SPCC622.17 | apn1 | after | III:join(1435250.. | ||
| 2011-04-18 | SPCC622.17 | apn1 | before | III:join(1435178.. | ||
| 2011-03-24 | SPAC1002.12c | after | I:complement(1818695.. | |||
| 2011-03-24 | SPAC1002.12c | before | I:complement(1818695.. | |||
| 2011-03-24 | SPAC1002.17c | urg2 | after | I:complement(1831012.. | ||
| 2011-03-24 | SPAC1002.17c | urg2 | before | I:complement(1831012.. | ||
| 2011-03-24 | SPAC105.01c | kha1 | after | I:complement(join(1740616.. | ||
| 2011-03-24 | SPAC105.01c | kha1 | before | I:complement(join(1740616.. | ||
| 2011-03-24 | SPAC1093.03 | after | I:join(4613627.. | |||
| 2011-03-24 | SPAC1093.03 | before | I:join(4613627.. | |||
| 2011-03-24 | SPAC10F6.10 | after | I:join(1225599.. | |||
| 2011-03-24 | SPAC10F6.10 | before | I:join(1225599.. | |||
| 2011-03-24 | SPAC10F6.11c | atg17 | after | I:complement(1227416.. | ||
| 2011-03-24 | SPAC10F6.11c | atg17 | before | I:complement(1227416.. | ||
| 2011-03-24 | SPAC11E3.03 | pcs1 | after | I:join(5286130.. | ||
| 2011-03-24 | SPAC11E3.03 | pcs1 | before | I:join(5286289.. | ||
| 2011-03-24 | SPAC1296.06 | tah18 | after | I:join(719447.. | ||
| 2011-03-24 | SPAC1296.06 | tah18 | before | I:join(719447.. | ||
| 2011-03-24 | SPAC12G12.15 | sif3 | after | I:complement(join(317431.. | ||
| 2011-03-24 | SPAC12G12.15 | sif3 | before | I:complement(join(317310.. | ||
| 2011-03-24 | SPAC13F5.04c | after | I:complement(join(2177582.. | |||
| 2011-03-24 | SPAC13F5.04c | before | I:complement(join(2177582.. | |||
| 2011-03-24 | SPAC13G6.05c | trs33 | after | I:complement(join(181077.. | ||
| 2011-03-24 | SPAC13G6.05c | trs33 | before | I:complement(join(181077.. | ||
| 2011-03-24 | SPAC13G6.06c | gcv2 | after | I:complement(182976.. | ||
| 2011-03-24 | SPAC13G6.06c | gcv2 | before | I:complement(182976.. | ||
| 2011-03-24 | SPAC13G7.07 | arb2 | after | I:join(2309026.. | ||
| 2011-03-24 | SPAC13G7.07 | arb2 | before | I:join(2309026.. | ||
| 2011-03-24 | SPAC140.01 | sdh2 | after | I:1895464..1896291 | ||
| 2011-03-24 | SPAC140.01 | sdh2 | before | I:1895533..1896291 | ||
| 2011-03-24 | SPAC144.06 | apl5 | after | I:join(4664387.. | ||
| 2011-03-24 | SPAC144.06 | apl5 | before | I:join(4664387.. | ||
| 2011-03-24 | SPAC14C4.02c | smc5 | after | I:complement(join(5226406.. | ||
| 2011-03-24 | SPAC14C4.02c | smc5 | before | I:complement(join(5226406.. | ||
| 2011-03-24 | SPAC14C4.08 | mug5 | after | I:5243053..5243610 | ||
| 2011-03-24 | SPAC14C4.08 | mug5 | before | I:5243071..5243610 | ||
| 2011-03-24 | SPAC15A10.06 | after | I:join(3688782.. | |||
| 2011-03-24 | SPAC15A10.06 | before | I:join(3689230.. | |||
| 2011-03-24 | SPAC15A10.07 | after | I:3691391..3691879 | |||
| 2011-03-24 | SPAC15A10.07 | before | I:3691307..3691879 | |||
| 2011-03-24 | SPAC1639.01c | after | I:complement(join(251726.. | |||
| 2011-03-24 | SPAC1639.01c | before | I:complement(join(251726.. | |||
| 2011-03-24 | SPAC1639.02c | trk2 | after | I:complement(join(256030.. | ||
| 2011-03-24 | SPAC1639.02c | trk2 | before | I:complement(join(256030.. | ||
| 2011-03-24 | SPAC167.04 | pam17 | after | I:complement(join(1554001.. | ||
| 2011-03-24 | SPAC167.04 | pam17 | before | I:complement(join(1554001.. | ||
| 2011-03-24 | SPAC167.09 | after | I:join(1558670.. | |||
| 2011-03-24 | SPAC167.09 | before | I:join(1558670.. | |||
| 2011-03-24 | SPAC1687.17c | after | I:complement(join(935249.. | |||
| 2011-03-24 | SPAC1687.17c | before | I:complement(join(935249.. | |||
| 2011-03-24 | SPAC16A10.03c | after | I:complement(join(3081568.. | |||
| 2011-03-24 | SPAC16A10.03c | before | I:complement(join(3081568.. | |||
| 2011-03-24 | SPAC16A10.05c | dad1 | after | I:complement(3089053.. | ||
| 2011-03-24 | SPAC16A10.05c | dad1 | before | I:complement(3089053.. | ||
| 2011-03-24 | SPAC16A10.06c | nse2 | after | I:complement(join(3089583.. | ||
| 2011-03-24 | SPAC16A10.06c | nse2 | before | I:complement(join(3089583.. | ||
| 2011-03-24 | SPAC16E8.07c | vph1 | after | I:complement(join(3510419.. | ||
| 2011-03-24 | SPAC16E8.07c | vph1 | before | I:complement(join(3510419.. | ||
| 2011-03-24 | SPAC16E8.11c | tfb1 | after | I:complement(join(3520542.. | ||
| 2011-03-24 | SPAC16E8.11c | tfb1 | before | I:complement(join(3520542.. | ||
| 2011-03-24 | SPAC1751.04 | after | I:join(384320.. | |||
| 2011-03-24 | SPAC1751.04 | before | I:join(384627.. | |||
| 2011-03-24 | SPAC1783.02c | vps66 | after | I:complement(join(2189507.. | ||
| 2011-03-24 | SPAC1783.02c | vps66 | before | I:complement(join(2189507.. | ||
| 2011-03-24 | SPAC17A2.08c | after | I:complement(join(3568267.. | |||
| 2011-03-24 | SPAC17A2.08c | before | I:complement(3568267.. | |||
| 2011-03-24 | SPAC17A5.07c | ulp2 | after | I:complement(join(1764336.. | ||
| 2011-03-24 | SPAC17A5.07c | ulp2 | before | I:complement(join(1764336.. | ||
| 2011-03-24 | SPAC17D4.04 | after | I:join(4729751.. | |||
| 2011-03-24 | SPAC17D4.04 | before | I:join(4729888.. | |||
| 2011-03-24 | SPAC17G6.15c | after | I:complement(join(3619344.. | |||
| 2011-03-24 | SPAC17G6.15c | before | I:complement(join(3619344.. | |||
| 2011-03-24 | SPAC17G6.16c | ysh1 | after | I:complement(join(3621007.. | ||
| 2011-03-24 | SPAC17G6.16c | ysh1 | before | I:complement(join(3621007.. | ||
| 2011-03-24 | SPAC17G8.05 | med20 | after | I:join(2350327.. | ||
| 2011-03-24 | SPAC17G8.05 | med20 | before | I:join(2350408.. | ||
| 2011-03-24 | SPAC17G8.09 | shg1 | after | I:join(2357361.. | ||
| 2011-03-24 | SPAC17G8.09 | shg1 | before | I:join(2357361.. | ||
| 2011-03-24 | SPAC17G8.15 | new1 | after | I:join(2348008.. | ||
| 2011-03-24 | SPAC17G8.15 | new1 | before | I:join(2348008.. | ||
| 2011-03-24 | SPAC1805.03c | trm13 | after | I:complement(join(2775340.. | ||
| 2011-03-24 | SPAC1805.03c | trm13 | before | I:complement(join(2775340.. | ||
| 2011-03-24 | SPAC186.04c | after | I:complement(5538574.. | |||
| 2011-03-24 | SPAC186.04c | before | I:complement(5538574.. | |||
| 2011-03-24 | SPAC18B11.03c | after | I:join(312182.. | |||
| 2011-03-24 | SPAC18B11.03c | before | I:312264..313586 | |||
| 2011-03-24 | SPAC18G6.04c | shm2 | after | I:complement(join(2217187.. | ||
| 2011-03-24 | SPAC18G6.04c | shm2 | before | I:complement(2217187.. | ||
| 2011-03-24 | SPAC1952.04c | after | I:complement(join(4972426.. | |||
| 2011-03-24 | SPAC1952.04c | before | I:complement(join(4972134.. | |||
| 2011-03-24 | SPAC1952.14c | mrpl25 | after | I:complement(join(4993896.. | ||
| 2011-03-24 | SPAC1952.14c | mrpl25 | before | I:complement(4993998.. | ||
| 2011-03-24 | SPAC1952.16 | rga9 | after | I:join(4997617.. | ||
| 2011-03-24 | SPAC1952.16 | rga9 | before | I:join(4997617.. | ||
| 2011-03-24 | SPAC19A8.04 | erg5 | after | I:complement(join(2480147.. | ||
| 2011-03-24 | SPAC19A8.04 | erg5 | before | I:complement(join(2480147.. | ||
| 2011-03-24 | SPAC19G12.07c | rsd1 | after | I:complement(join(4053810.. | ||
| 2011-03-24 | SPAC19G12.07c | rsd1 | before | I:complement(join(4053810.. | ||
| 2011-03-24 | SPAC19G12.17 | new10 | after | I:complement(join(4066258.. | ||
| 2011-03-24 | SPAC19G12.17 | new10 | before | I:complement(join(4066258.. | ||
| 2011-03-24 | SPAC1A6.03c | after | I:complement(join(1070061.. | |||
| 2011-03-24 | SPAC1A6.03c | before | I:complement(join(1070061.. | |||
| 2011-03-24 | SPAC1B1.04c | after | I:complement(join(3544727.. | |||
| 2011-03-24 | SPAC1B1.04c | before | I:complement(join(3544813.. | |||
| 2011-03-24 | SPAC1B3.04c | after | I:complement(join(4931313.. | |||
| 2011-03-24 | SPAC1B3.04c | before | I:complement(join(4931482.. | |||
| 2011-03-24 | SPAC1B3.05 | not3 | after | I:join(4934663.. | ||
| 2011-03-24 | SPAC1B3.05 | not3 | before | I:join(4934801.. | ||
| 2011-03-24 | SPAC1B3.13 | after | I:join(4951432.. | |||
| 2011-03-24 | SPAC1B3.13 | before | I:join(4951450.. | |||
| 2011-03-24 | SPAC1D4.01 | after | I:639411..640175 | |||
| 2011-03-24 | SPAC1D4.01 | before | I:639318..640175 | |||
| 2011-03-24 | SPAC20H4.05c | after | I:complement(join(2119362.. | |||
| 2011-03-24 | SPAC20H4.05c | before | I:complement(join(2119362.. | |||
| 2011-03-24 | SPAC212.06c | after | I:join(18072.. | |||
| 2011-03-24 | SPAC212.06c | before | I:join(18042.. | |||
| 2011-03-24 | SPAC212.12 | after | I:15855..16226 | |||
| 2011-03-24 | SPAC212.12 | before | I:15993..16226 | |||
| 2011-03-24 | SPAC222.16c | csn3 | after | I:complement(join(979679.. | ||
| 2011-03-24 | SPAC222.16c | csn3 | before | I:complement(join(979679.. | ||
| 2011-03-24 | SPAC227.11c | after | I:complement(join(514552.. | |||
| 2011-03-24 | SPAC227.11c | before | I:complement(join(514552.. | |||
| 2011-03-24 | SPAC22A12.13 | mug84 | after | I:1180254..1180841 | ||
| 2011-03-24 | SPAC22A12.13 | mug84 | before | I:1180479..1180841 | ||
| 2011-03-24 | SPAC22E12.17c | glo3 | after | I:complement(join(5053107.. | ||
| 2011-03-24 | SPAC22E12.17c | glo3 | before | I:complement(join(5053107.. | ||
| 2011-03-24 | SPAC22F3.11c | snu23 | after | I:join(682874.. | gene structure updated | PMID:21511999 |
| 2011-03-24 | SPAC22F3.11c | snu23 | before | I:join(682874.. | gene structure updated | PMID:21511999 |
| 2011-03-24 | SPAC22G7.07c | after | I:complement(747143.. | |||
| 2011-03-24 | SPAC22G7.07c | before | I:complement(747143.. | |||
| 2011-03-24 | SPAC22H10.02 | after | I:join(2371752.. | |||
| 2011-03-24 | SPAC22H10.02 | before | I:join(2371692.. | |||
| 2011-03-24 | SPAC22H10.03c | kap114 | after | I:complement(join(2373144.. | ||
| 2011-03-24 | SPAC22H10.03c | kap114 | before | I:complement(join(2373144.. | ||
| 2011-03-24 | SPAC23A1.18c | mrp51 | after | I:complement(4112685.. | ||
| 2011-03-24 | SPAC23A1.18c | mrp51 | before | I:complement(4112685.. | ||
| 2011-03-24 | SPAC23C11.04c | pnk1 | after | I:complement(join(2138064.. | ||
| 2011-03-24 | SPAC23C11.04c | pnk1 | before | I:complement(join(2138064.. | ||
| 2011-03-24 | SPAC23C4.17 | after | I:join(1058395.. | |||
| 2011-03-24 | SPAC23C4.17 | before | I:join(1058395.. | |||
| 2011-03-24 | SPAC23D3.09 | arp42 | after | I:complement(join(4353826.. | ||
| 2011-03-24 | SPAC23D3.09 | arp42 | before | I:complement(4353826.. | ||
| 2011-03-24 | SPAC23D3.16 | after | I:join(4365700.. | |||
| 2011-03-24 | SPAC23D3.16 | before | I:join(4365700.. | |||
| 2011-03-24 | SPAC23D3.17 | after | I:complement(join(4366509.. | |||
| 2011-03-24 | SPAC23D3.17 | before | I:complement(join(4366509.. | |||
| 2011-03-24 | SPAC23H4.17c | srb10 | after | I:join(1576854.. | ||
| 2011-03-24 | SPAC23H4.17c | srb10 | before | I:1576854..1577912 | ||
| 2011-03-24 | SPAC24C9.06c | after | I:complement(join(3048409.. | |||
| 2011-03-24 | SPAC24C9.06c | before | I:complement(3048409.. | |||
| 2011-03-24 | SPAC24C9.09 | after | I:3063767..3065191 | |||
| 2011-03-24 | SPAC24C9.09 | before | I:3063770..3065191 | |||
| 2011-03-24 | SPAC25B8.06c | after | I:complement(join(4164278.. | |||
| 2011-03-24 | SPAC25B8.06c | before | I:complement(join(4164278.. | |||
| 2011-03-24 | SPAC26F1.14c | aif1 | after | I:5146165..5148000 | ||
| 2011-03-24 | SPAC26F1.14c | aif1 | before | I:5146273..5148000 | ||
| 2011-03-24 | SPAC26H5.12 | rpo41 | after | I:4147739..4151203 | ||
| 2011-03-24 | SPAC26H5.12 | rpo41 | before | I:4147841..4151203 | ||
| 2011-03-24 | SPAC29B12.08 | after | I:join(5428407.. | |||
| 2011-03-24 | SPAC29B12.08 | before | I:join(5429038.. | |||
| 2011-03-24 | SPAC29B12.14c | after | I:complement(5439849.. | |||
| 2011-03-24 | SPAC29B12.14c | before | I:complement(5439849.. | |||
| 2011-03-24 | SPAC2C4.06c | after | I:complement(join(4269367.. | |||
| 2011-03-24 | SPAC2C4.06c | before | I:complement(join(4269367.. | |||
| 2011-03-24 | SPAC2C4.12c | after | I:complement(4279873.. | |||
| 2011-03-24 | SPAC2C4.12c | before | I:complement(4279873.. | |||
| 2011-03-24 | SPAC2F3.13c | after | I:complement(join(3947930.. | |||
| 2011-03-24 | SPAC2F3.13c | before | I:complement(join(3949057.. | |||
| 2011-03-24 | SPAC2F3.18c | after | I:complement(join(3942299.. | |||
| 2011-03-24 | SPAC2F3.18c | before | I:complement(join(3942299.. | |||
| 2011-03-24 | SPAC2G11.09 | after | I:join(823739.. | |||
| 2011-03-24 | SPAC2G11.09 | before | I:join(823755.. | |||
| 2011-03-24 | SPAC31A2.05c | mis4 | after | I:complement(join(391838.. | ||
| 2011-03-24 | SPAC31A2.05c | mis4 | before | I:complement(join(391838.. | ||
| 2011-03-24 | SPAC31A2.15c | dcc1 | after | I:complement(join(418475.. | ||
| 2011-03-24 | SPAC31A2.15c | dcc1 | before | I:complement(join(418537.. | ||
| 2011-03-24 | SPAC31G5.15 | psd3 | after | I:join(3014466.. | ||
| 2011-03-24 | SPAC31G5.15 | psd3 | before | I:join(3014466.. | ||
| 2011-03-24 | SPAC323.01c | pos5 | after | I:complement(join(3907586.. | ||
| 2011-03-24 | SPAC323.01c | pos5 | before | I:complement(join(3907586.. | ||
| 2011-03-24 | SPAC323.06c | uba5 | after | I:complement(join(3915615.. | ||
| 2011-03-24 | SPAC323.06c | uba5 | before | I:complement(join(3915615.. | ||
| 2011-03-24 | SPAC328.05 | after | I:join(3484678.. | |||
| 2011-03-24 | SPAC328.05 | before | I:join(3484695.. | |||
| 2011-03-24 | SPAC343.08c | mrp17 | after | I:complement(join(1653288.. | ||
| 2011-03-24 | SPAC343.08c | mrp17 | before | I:complement(join(1653288.. | ||
| 2011-03-24 | SPAC3A11.03 | after | I:join(3466834.. | |||
| 2011-03-24 | SPAC3A11.03 | before | I:join(3466462.. | |||
| 2011-03-24 | SPAC3A11.04 | after | I:complement(join(3465309.. | |||
| 2011-03-24 | SPAC3A11.04 | before | I:complement(join(3465309.. | |||
| 2011-03-24 | SPAC3C7.07c | after | I:complement(join(2077280.. | |||
| 2011-03-24 | SPAC3C7.07c | before | I:complement(join(2077280.. | |||
| 2011-03-24 | SPAC3F10.11c | abc2 | after | I:complement(2837268.. | ||
| 2011-03-24 | SPAC3F10.11c | abc2 | before | I:complement(2837268.. | ||
| 2011-03-24 | SPAC3G6.03c | after | I:complement(join(5383955.. | |||
| 2011-03-24 | SPAC3G6.03c | before | I:complement(join(5383955.. | |||
| 2011-03-24 | SPAC3H5.08c | after | I:join(3425966.. | |||
| 2011-03-24 | SPAC3H5.08c | before | I:join(3426306.. | |||
| 2011-03-24 | SPAC3H5.09c | after | I:3416722..3424821 | |||
| 2011-03-24 | SPAC3H5.09c | before | I:3416764..3424821 | |||
| 2011-03-24 | SPAC458.04c | dil1 | after | I:complement(join(4737605.. | ||
| 2011-03-24 | SPAC458.04c | dil1 | before | I:complement(join(4737605.. | ||
| 2011-03-24 | SPAC458.07 | tfa1 | after | I:join(4744584.. | ||
| 2011-03-24 | SPAC458.07 | tfa1 | before | I:join(4744584.. | ||
| 2011-03-24 | SPAC4A8.10 | after | I:join(2564279.. | |||
| 2011-03-24 | SPAC4A8.10 | before | I:2564629..2566800 | |||
| 2011-03-24 | SPAC4D7.02c | after | I:complement(join(5352606.. | |||
| 2011-03-24 | SPAC4D7.02c | before | I:complement(join(5352606.. | |||
| 2011-03-24 | SPAC4D7.07c | after | I:complement(5361908.. | |||
| 2011-03-24 | SPAC4D7.07c | before | I:complement(5361908.. | |||
| 2011-03-24 | SPAC4D7.09 | tif223 | after | I:join(5367548.. | ||
| 2011-03-24 | SPAC4D7.09 | tif223 | before | I:join(5367548.. | ||
| 2011-03-24 | SPAC4F8.06 | after | I:complement(2668334.. | |||
| 2011-03-24 | SPAC4F8.06 | before | I:complement(2668334.. | |||
| 2011-03-24 | SPAC4G9.20c | after | I:complement(join(2288689.. | |||
| 2011-03-24 | SPAC4G9.20c | before | I:complement(join(2288689.. | |||
| 2011-03-24 | SPAC4H3.06 | after | I:join(3837431.. | |||
| 2011-03-24 | SPAC4H3.06 | before | I:join(3837449.. | |||
| 2011-03-24 | SPAC4H3.07c | after | I:complement(join(3838713.. | |||
| 2011-03-24 | SPAC4H3.07c | before | I:complement(join(3838713.. | |||
| 2011-03-24 | SPAC57A10.04 | mug10 | after | I:join(1370179.. | ||
| 2011-03-24 | SPAC57A10.04 | mug10 | before | I:join(1370197.. | ||
| 2011-03-24 | SPAC630.14c | tup12 | after | I:complement(join(374683.. | ||
| 2011-03-24 | SPAC630.14c | tup12 | before | I:complement(join(374683.. | ||
| 2011-03-24 | SPAC631.02 | after | I:2107940..2110123 | |||
| 2011-03-24 | SPAC631.02 | before | I:join(2107470.. | |||
| 2011-03-24 | SPAC637.09 | after | I:4555399..4557294 | |||
| 2011-03-24 | SPAC637.09 | before | I:4555423..4557294 | |||
| 2011-03-24 | SPAC664.02c | arp8 | after | I:complement(join(1704981.. | ||
| 2011-03-24 | SPAC664.02c | arp8 | before | I:complement(join(1704981.. | ||
| 2011-03-24 | SPAC664.03 | after | I:join(1708822.. | |||
| 2011-03-24 | SPAC664.03 | before | I:join(1708822.. | |||
| 2011-03-24 | SPAC688.03c | after | I:complement(join(3114616.. | |||
| 2011-03-24 | SPAC688.03c | before | I:complement(join(3114616.. | |||
| 2011-03-24 | SPAC688.14 | set13 | after | I:join(3141463.. | ||
| 2011-03-24 | SPAC688.14 | set13 | before | I:join(3141484.. | ||
| 2011-03-24 | SPAC6B12.07c | after | I:complement(2421791.. | |||
| 2011-03-24 | SPAC6B12.07c | before | I:complement(2421791.. | |||
| 2011-03-24 | SPAC6C3.04 | cit1 | after | I:join(2327861.. | ||
| 2011-03-24 | SPAC6C3.04 | cit1 | before | I:2328675..2330096 | ||
| 2011-03-24 | SPAC6G10.08 | idp1 | after | I:3231536..3232855 | ||
| 2011-03-24 | SPAC6G10.08 | idp1 | before | I:3231599..3232855 | ||
| 2011-03-24 | SPAC6G9.03c | mug183 | after | I:complement(join(3246488.. | ||
| 2011-03-24 | SPAC6G9.03c | mug183 | before | I:complement(join(3246488.. | ||
| 2011-03-24 | SPAC6G9.08 | ubp6 | after | I:3259701..3261107 | ||
| 2011-03-24 | SPAC6G9.08 | ubp6 | before | I:3259704..3261107 | ||
| 2011-03-24 | SPAC750.01 | after | I:5555791..5556768 | |||
| 2011-03-24 | SPAC750.01 | before | I:5555716..5556768 | |||
| 2011-03-24 | SPAC7D4.05 | after | I:complement(join(2629373.. | |||
| 2011-03-24 | SPAC7D4.05 | before | I:complement(join(2629373.. | |||
| 2011-03-24 | SPAC806.04c | after | I:complement(join(241426.. | |||
| 2011-03-24 | SPAC806.04c | before | I:complement(join(241426.. | |||
| 2011-03-24 | SPAC806.06c | after | I:complement(245304.. | |||
| 2011-03-24 | SPAC806.06c | before | I:complement(245304.. | |||
| 2011-03-24 | SPAC806.08c | mod21 | after | I:complement(join(248680.. | ||
| 2011-03-24 | SPAC806.08c | mod21 | before | I:complement(248680.. | ||
| 2011-03-24 | SPAC821.07c | moc3 | after | I:complement(991752.. | ||
| 2011-03-24 | SPAC821.07c | moc3 | before | I:complement(991752.. | ||
| 2011-03-24 | SPAC823.09c | after | I:complement(join(2594633.. | |||
| 2011-03-24 | SPAC823.09c | before | I:complement(join(2594777.. | |||
| 2011-03-24 | SPAC869.11 | cat1 | after | I:complement(5489385.. | ||
| 2011-03-24 | SPAC869.11 | cat1 | before | I:complement(5489385.. | ||
| 2011-03-24 | SPAC8C9.11 | after | I:join(3659132.. | |||
| 2011-03-24 | SPAC8C9.11 | before | I:join(3659132.. | |||
| 2011-03-24 | SPAC9.12c | atp12 | after | I:complement(join(1487131.. | ||
| 2011-03-24 | SPAC9.12c | atp12 | before | I:complement(join(1487131.. | ||
| 2011-03-24 | SPAC959.05c | after | I:complement(join(3395685.. | |||
| 2011-03-24 | SPAC959.05c | before | I:complement(join(3395685.. | |||
| 2011-03-24 | SPAC959.09c | apc5 | after | I:complement(join(3401279.. | ||
| 2011-03-24 | SPAC959.09c | apc5 | before | I:complement(join(3401279.. | ||
| 2011-03-24 | SPAC977.04 | after | I:34349..34816 | |||
| 2011-03-24 | SPAC977.04 | before | I:34298..34816 | |||
| 2011-03-24 | SPACUNK4.17 | after | I:complement(2873032.. | |||
| 2011-03-24 | SPACUNK4.17 | before | I:complement(2873032.. | |||
| 2011-03-24 | SPAP27G11.05c | vps41 | after | I:complement(join(1615930.. | ||
| 2011-03-24 | SPAP27G11.05c | vps41 | before | I:complement(join(1615930.. | ||
| 2011-03-24 | SPAPB17E12.06 | after | I:join(1276673.. | |||
| 2011-03-24 | SPAPB17E12.06 | before | I:join(1276673.. | |||
| 2011-03-24 | SPAPB18E9.02c | ppk18 | after | I:complement(join(3976370.. | ||
| 2011-03-24 | SPAPB18E9.02c | ppk18 | before | I:complement(join(3976370.. | ||
| 2011-03-24 | SPAPB1A10.05 | after | I:1867135..1868019 | |||
| 2011-03-24 | SPAPB1A10.05 | before | I:1867162..1868019 | |||
| 2011-03-24 | SPAPB1A10.08 | after | I:join(1876259.. | |||
| 2011-03-24 | SPAPB1A10.08 | before | I:join(1876271.. | |||
| 2011-03-24 | SPAPB1A10.15 | arv1 | after | I:join(1892554.. | ||
| 2011-03-24 | SPAPB1A10.15 | arv1 | before | I:join(1892554.. | ||
| 2011-03-24 | SPAPB1E7.06c | eme1 | after | I:complement(join(3297520.. | ||
| 2011-03-24 | SPAPB1E7.06c | eme1 | before | I:complement(join(3297520.. | ||
| 2011-03-24 | SPAPB24D3.03 | after | I:2952416..2953642 | |||
| 2011-03-24 | SPAPB24D3.03 | before | I:2952485..2953642 | |||
| 2011-03-24 | SPAPYUG7.03c | mid2 | after | I:complement(4749139.. | ||
| 2011-03-24 | SPAPYUG7.03c | mid2 | before | I:complement(4749139.. | ||
| 2011-03-24 | SPBC106.04 | ada1 | after | II:join(380390.. | ||
| 2011-03-24 | SPBC106.04 | ada1 | before | II:join(380228.. | ||
| 2011-03-24 | SPBC106.15 | idi1 | after | II:join(406868.. | ||
| 2011-03-24 | SPBC106.15 | idi1 | before | II:join(406874.. | ||
| 2011-03-24 | SPBC1198.07c | after | II:complement(join(185289.. | |||
| 2011-03-24 | SPBC1198.07c | before | II:complement(join(185289.. | |||
| 2011-03-24 | SPBC1198.08 | after | II:join(187424.. | |||
| 2011-03-24 | SPBC1198.08 | before | II:join(187430.. | |||
| 2011-03-24 | SPBC11B10.01 | alg2 | after | II:join(1486152.. | ||
| 2011-03-24 | SPBC11B10.01 | alg2 | before | II:join(1486152.. | ||
| 2011-03-24 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | ||
| 2011-03-24 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | ||
| 2011-03-24 | SPBC11C11.01 | after | II:join(3344613.. | |||
| 2011-03-24 | SPBC11C11.01 | before | II:join(3344613.. | |||
| 2011-03-24 | SPBC11C11.04c | alp1 | after | II:complement(join(3353145.. | ||
| 2011-03-24 | SPBC11C11.04c | alp1 | before | II:complement(join(3353145.. | ||
| 2011-03-24 | SPBC1289.12 | usp109 | after | II:join(4405971.. | ||
| 2011-03-24 | SPBC1289.12 | usp109 | before | II:4406049..4407107 | ||
| 2011-03-24 | SPBC12D12.07c | trx2 | after | II:complement(join(2317984.. | ||
| 2011-03-24 | SPBC12D12.07c | trx2 | before | II:complement(join(2317984.. | ||
| 2011-03-24 | SPBC1347.05c | after | II:complement(join(4069285.. | |||
| 2011-03-24 | SPBC1347.05c | before | II:complement(join(4069285.. | |||
| 2011-03-24 | SPBC1347.07 | rex2 | after | II:join(4073591.. | ||
| 2011-03-24 | SPBC1347.07 | rex2 | before | II:join(4073912.. | ||
| 2011-03-24 | SPBC13E7.04 | atp16 | after | II:3046852..3047355 | ||
| 2011-03-24 | SPBC13E7.04 | atp16 | before | II:3046873..3047355 | ||
| 2011-03-24 | SPBC13E7.10c | brf1 | after | II:complement(join(3056760.. | ||
| 2011-03-24 | SPBC13E7.10c | brf1 | before | II:complement(join(3056760.. | ||
| 2011-03-24 | SPBC13G1.04c | after | II:complement(join(3732806.. | |||
| 2011-03-24 | SPBC13G1.04c | before | II:complement(join(3732806.. | |||
| 2011-03-24 | SPBC13G1.12 | did2 | after | II:join(3752361.. | ||
| 2011-03-24 | SPBC13G1.12 | did2 | before | II:join(3752588.. | ||
| 2011-03-24 | SPBC146.11c | mug97 | after | II:complement(1020296.. | ||
| 2011-03-24 | SPBC146.11c | mug97 | before | II:complement(1020296.. | ||
| 2011-03-24 | SPBC146.12 | coq6 | after | II:1022416..1023855 | ||
| 2011-03-24 | SPBC146.12 | coq6 | before | II:1022455..1023855 | ||
| 2011-03-24 | SPBC14C8.11c | after | II:complement(2222650.. | |||
| 2011-03-24 | SPBC14C8.11c | before | II:complement(2222650.. | |||
| 2011-03-24 | SPBC15C4.02 | after | II:join(2238826.. | |||
| 2011-03-24 | SPBC15C4.02 | before | II:join(2238671.. | |||
| 2011-03-24 | SPBC15D4.02 | after | II:3012934..3014577 | |||
| 2011-03-24 | SPBC15D4.02 | before | II:3013318..3014577 | |||
| 2011-03-24 | SPBC1604.04 | after | II:complement(join(3924320.. | |||
| 2011-03-24 | SPBC1604.04 | before | II:complement(join(3924320.. | |||
| 2011-03-24 | SPBC1652.01 | after | II:4253265..4254440 | |||
| 2011-03-24 | SPBC1652.01 | before | II:4253280..4254440 | |||
| 2011-03-24 | SPBC1685.16 | vma9 | after | II:join(501305.. | ||
| 2011-03-24 | SPBC1685.16 | vma9 | before | II:join(501695.. | ||
| 2011-03-24 | SPBC16C6.03c | after | II:complement(join(4332356.. | |||
| 2011-03-24 | SPBC16C6.03c | before | II:complement(4332698.. | |||
| 2011-03-24 | SPBC16D10.04c | dna2 | after | II:complement(join(3592359.. | ||
| 2011-03-24 | SPBC16D10.04c | dna2 | before | II:complement(join(3592359.. | ||
| 2011-03-24 | SPBC16E9.19 | after | II:join(1921511.. | |||
| 2011-03-24 | SPBC16E9.19 | before | II:1921868..1922173 | |||
| 2011-03-24 | SPBC1703.05 | after | II:join(2924013.. | |||
| 2011-03-24 | SPBC1703.05 | before | II:join(2924037.. | |||
| 2011-03-24 | SPBC1706.01 | tea4 | after | II:588729..591194 | ||
| 2011-03-24 | SPBC1706.01 | tea4 | before | II:588765..591194 | ||
| 2011-03-24 | SPBC1709.03 | after | II:join(1102314.. | |||
| 2011-03-24 | SPBC1709.03 | before | II:join(1102449.. | |||
| 2011-03-24 | SPBC1709.16c | after | II:complement(join(1130896.. | |||
| 2011-03-24 | SPBC1709.16c | before | II:complement(join(1130896.. | |||
| 2011-03-24 | SPBC1711.09c | after | II:complement(join(2150960.. | |||
| 2011-03-24 | SPBC1711.09c | before | II:complement(join(2150960.. | |||
| 2011-03-24 | SPBC1734.03 | after | II:1064200..1066401 | |||
| 2011-03-24 | SPBC1734.03 | before | II:1064341..1066401 | |||
| 2011-03-24 | SPBC1773.08c | omh4 | after | II:complement(297771.. | ||
| 2011-03-24 | SPBC1773.08c | omh4 | before | II:complement(297771.. | ||
| 2011-03-24 | SPBC1778.05c | after | II:complement(join(3105116.. | |||
| 2011-03-24 | SPBC1778.05c | before | II:complement(3105116.. | |||
| 2011-03-24 | SPBC1778.10c | ppk21 | after | II:complement(join(3114461.. | ||
| 2011-03-24 | SPBC1778.10c | ppk21 | before | II:complement(join(3114461.. | ||
| 2011-03-24 | SPBC17A3.03c | after | II:complement(join(1404360.. | |||
| 2011-03-24 | SPBC17A3.03c | before | II:complement(join(1404360.. | |||
| 2011-03-24 | SPBC17D1.07c | after | II:complement(join(3340725.. | |||
| 2011-03-24 | SPBC17D1.07c | before | II:complement(join(3340725.. | |||
| 2011-03-24 | SPBC18E5.12c | mas2 | after | II:complement(2096528.. | ||
| 2011-03-24 | SPBC18E5.12c | mas2 | before | II:complement(2096528.. | ||
| 2011-03-24 | SPBC18E5.14c | after | II:complement(2089944.. | |||
| 2011-03-24 | SPBC18E5.14c | before | II:complement(join(2089944.. | |||
| 2011-03-24 | SPBC18H10.09 | after | II:join(1786332.. | |||
| 2011-03-24 | SPBC18H10.09 | before | II:join(1786596.. | |||
| 2011-03-24 | SPBC18H10.10c | saf4 | after | II:complement(join(1788047.. | ||
| 2011-03-24 | SPBC18H10.10c | saf4 | before | II:complement(join(1788047.. | ||
| 2011-03-24 | SPBC18H10.19 | atg14 | after | II:join(1806262.. | ||
| 2011-03-24 | SPBC18H10.19 | atg14 | before | II:1807057..1807980 | ||
| 2011-03-24 | SPBC19C7.11 | after | II:join(2843141.. | |||
| 2011-03-24 | SPBC19C7.11 | before | II:2843141..2845579 | |||
| 2011-03-24 | SPBC21.03c | after | II:complement(join(3217985.. | |||
| 2011-03-24 | SPBC21.03c | before | II:complement(join(3217985.. | |||
| 2011-03-24 | SPBC211.01 | rsm10 | after | II:join(3870293.. | ||
| 2011-03-24 | SPBC211.01 | rsm10 | before | II:join(3870305.. | ||
| 2011-03-24 | SPBC215.06c | after | II:complement(join(4038119.. | |||
| 2011-03-24 | SPBC215.06c | before | II:complement(4038119.. | |||
| 2011-03-24 | SPBC215.12 | cwf10 | after | II:join(4052601.. | ||
| 2011-03-24 | SPBC215.12 | cwf10 | before | II:join(4052604.. | ||
| 2011-03-24 | SPBC21C3.03 | after | II:join(3802197.. | |||
| 2011-03-24 | SPBC21C3.03 | before | II:join(3802251.. | |||
| 2011-03-24 | SPBC21D10.11c | nfs1 | after | II:2422760..2424265 | ||
| 2011-03-24 | SPBC21D10.11c | nfs1 | before | II:2422769..2424265 | ||
| 2011-03-24 | SPBC25B2.07c | mug164 | after | II:complement(2609038.. | ||
| 2011-03-24 | SPBC25B2.07c | mug164 | before | II:complement(2609038.. | ||
| 2011-03-24 | SPBC25D12.06 | after | II:3725370..3727127 | |||
| 2011-03-24 | SPBC25D12.06 | before | II:3725430..3727127 | |||
| 2011-03-24 | SPBC27B12.01c | mmm1 | after | II:complement(join(1321952.. | ||
| 2011-03-24 | SPBC27B12.01c | mmm1 | before | II:complement(join(1321952.. | ||
| 2011-03-24 | SPBC27B12.02 | after | II:1323731..1324069 | |||
| 2011-03-24 | SPBC27B12.02 | before | II:1323740..1324069 | |||
| 2011-03-24 | SPBC27B12.05 | after | II:join(1328794.. | |||
| 2011-03-24 | SPBC27B12.05 | before | II:join(1329204.. | |||
| 2011-03-24 | SPBC29A10.04 | psm1 | after | II:join(2540743.. | ||
| 2011-03-24 | SPBC29A10.04 | psm1 | before | II:2540743..2544444 | ||
| 2011-03-24 | SPBC29A10.06c | after | II:complement(join(2547516.. | |||
| 2011-03-24 | SPBC29A10.06c | before | II:complement(join(2547516.. | |||
| 2011-03-24 | SPBC29A10.17 | after | II:join(2573829.. | |||
| 2011-03-24 | SPBC29A10.17 | before | II:join(2573866.. | |||
| 2011-03-24 | SPBC2A9.07c | after | II:complement(join(2959078.. | |||
| 2011-03-24 | SPBC2A9.07c | before | II:complement(2959078.. | |||
| 2011-03-24 | SPBC2A9.08c | sec22 | after | II:complement(join(2961668.. | ||
| 2011-03-24 | SPBC2A9.08c | sec22 | before | II:complement(join(2961668.. | ||
| 2011-03-24 | SPBC2F12.10 | after | II:complement(1719551.. | |||
| 2011-03-24 | SPBC2F12.10 | before | II:complement(1719551.. | |||
| 2011-03-24 | SPBC2G2.08 | ade9 | after | II:join(3448967.. | ||
| 2011-03-24 | SPBC2G2.08 | ade9 | before | II:join(3448976.. | ||
| 2011-03-24 | SPBC2G2.12 | hrs1 | after | II:3457165..3458856 | ||
| 2011-03-24 | SPBC2G2.12 | hrs1 | before | II:3457240..3458856 | ||
| 2011-03-24 | SPBC2G2.13c | after | II:complement(join(3458998.. | |||
| 2011-03-24 | SPBC2G2.13c | before | II:complement(join(3458998.. | |||
| 2011-03-24 | SPBC30D10.08 | mgm101 | after | II:complement(3084534.. | ||
| 2011-03-24 | SPBC30D10.08 | mgm101 | before | II:complement(3084534.. | ||
| 2011-03-24 | SPBC30D10.16 | pha2 | after | II:complement(join(3064223.. | ||
| 2011-03-24 | SPBC30D10.16 | pha2 | before | II:complement(join(3064223.. | ||
| 2011-03-24 | SPBC31E1.04 | pep12 | after | II:join(245718.. | ||
| 2011-03-24 | SPBC31E1.04 | pep12 | before | II:join(245718.. | ||
| 2011-03-24 | SPBC31F10.09c | nut2 | after | II:complement(3765847.. | ||
| 2011-03-24 | SPBC31F10.09c | nut2 | before | II:complement(3765847.. | ||
| 2011-03-24 | SPBC31F10.16 | after | II:join(3785848.. | |||
| 2011-03-24 | SPBC31F10.16 | before | II:join(3785848.. | |||
| 2011-03-24 | SPBC336.10c | tif512 | after | II:complement(2758761.. | ||
| 2011-03-24 | SPBC336.10c | tif512 | before | II:complement(2758761.. | ||
| 2011-03-24 | SPBC337.12 | after | II:join(1052080.. | |||
| 2011-03-24 | SPBC337.12 | before | II:join(1052080.. | |||
| 2011-03-24 | SPBC354.06 | mrps16 | after | II:join(555893.. | ||
| 2011-03-24 | SPBC354.06 | mrps16 | before | II:join(555893.. | ||
| 2011-03-24 | SPBC354.07c | after | II:complement(join(558335.. | |||
| 2011-03-24 | SPBC354.07c | before | II:complement(join(558335.. | |||
| 2011-03-24 | SPBC36B7.06c | mug20 | after | II:complement(join(2392551.. | ||
| 2011-03-24 | SPBC36B7.06c | mug20 | before | II:complement(join(2392551.. | ||
| 2011-03-24 | SPBC3E7.04c | after | II:complement(join(2662488.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBC3E7.04c | before | II:complement(join(2662663.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBC428.01c | nup107 | after | II:complement(join(439274.. | ||
| 2011-03-24 | SPBC428.01c | nup107 | before | II:complement(join(439274.. | ||
| 2011-03-24 | SPBC428.02c | eca39 | after | II:complement(442631.. | ||
| 2011-03-24 | SPBC428.02c | eca39 | before | II:complement(442631.. | ||
| 2011-03-24 | SPBC428.06c | rxt2 | after | II:complement(join(451989.. | ||
| 2011-03-24 | SPBC428.06c | rxt2 | before | II:complement(join(451989.. | ||
| 2011-03-24 | SPBC428.10 | after | II:461024..463561 | |||
| 2011-03-24 | SPBC428.10 | before | II:461306..463561 | |||
| 2011-03-24 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2011-03-24 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2011-03-24 | SPBC4F6.13c | after | II:complement(2714424.. | |||
| 2011-03-24 | SPBC4F6.13c | before | II:complement(2714424.. | |||
| 2011-03-24 | SPBC530.05 | after | II:796583..798871 | |||
| 2011-03-24 | SPBC530.05 | before | II:796640..798871 | |||
| 2011-03-24 | SPBC530.12c | pdf1 | after | II:complement(821281.. | ||
| 2011-03-24 | SPBC530.12c | pdf1 | before | II:complement(821281.. | ||
| 2011-03-24 | SPBC530.13 | lsc1 | after | II:join(824374.. | ||
| 2011-03-24 | SPBC530.13 | lsc1 | before | II:join(824374.. | ||
| 2011-03-24 | SPBC56F2.11 | met6 | after | II:complement(join(4089279.. | ||
| 2011-03-24 | SPBC56F2.11 | met6 | before | II:complement(4089357.. | ||
| 2011-03-24 | SPBC646.15c | after | II:complement(join(955201.. | |||
| 2011-03-24 | SPBC646.15c | before | II:complement(join(955128.. | |||
| 2011-03-24 | SPBC651.06 | mug166 | after | II:1247484..1248188 | PMID:21270388 | |
| 2011-03-24 | SPBC651.06 | mug166 | before | II:join(1247484.. | PMID:21270388 | |
| 2011-03-24 | SPBC660.08 | after | II:join(209802.. | |||
| 2011-03-24 | SPBC660.08 | before | II:209985..211172 | |||
| 2011-03-24 | SPBC660.11 | tcg1 | after | II:join(215144.. | ||
| 2011-03-24 | SPBC660.11 | tcg1 | before | II:join(215147.. | ||
| 2011-03-24 | SPBC713.11c | pmp3 | after | II:complement(join(887999.. | ||
| 2011-03-24 | SPBC713.11c | pmp3 | before | II:complement(887999.. | ||
| 2011-03-24 | SPBC725.10 | after | II:join(1224974.. | |||
| 2011-03-24 | SPBC725.10 | before | II:1224974..1225462 | |||
| 2011-03-24 | SPBC776.05 | after | II:join(3182005.. | |||
| 2011-03-24 | SPBC776.05 | before | II:join(3182005.. | |||
| 2011-03-24 | SPBC776.06c | after | II:complement(join(3183676.. | |||
| 2011-03-24 | SPBC776.06c | before | II:complement(3183803.. | |||
| 2011-03-24 | SPBC776.14 | plh1 | after | II:join(3204448.. | ||
| 2011-03-24 | SPBC776.14 | plh1 | before | II:join(3204448.. | ||
| 2011-03-24 | SPBC776.17 | after | II:join(3211353.. | |||
| 2011-03-24 | SPBC776.17 | before | II:3211353..3212117 | |||
| 2011-03-24 | SPBC800.02 | whi5 | after | II:join(253148.. | ||
| 2011-03-24 | SPBC800.02 | whi5 | before | II:join(253148.. | ||
| 2011-03-24 | SPBC83.01 | ucp8 | after | II:join(1510581.. | ||
| 2011-03-24 | SPBC83.01 | ucp8 | before | II:join(1510581.. | ||
| 2011-03-24 | SPBC83.06c | after | II:complement(1520212.. | |||
| 2011-03-24 | SPBC83.06c | before | II:complement(1520212.. | |||
| 2011-03-24 | SPBC83.11 | after | II:join(1529220.. | |||
| 2011-03-24 | SPBC83.11 | before | II:join(1529291.. | |||
| 2011-03-24 | SPBC887.02 | after | II:join(3541262.. | |||
| 2011-03-24 | SPBC887.02 | before | II:join(3541262.. | |||
| 2011-03-24 | SPBC887.04c | lub1 | after | II:complement(join(3546238.. | ||
| 2011-03-24 | SPBC887.04c | lub1 | before | II:complement(join(3546238.. | ||
| 2011-03-24 | SPBC887.07 | mrpl38 | after | II:join(3551318.. | ||
| 2011-03-24 | SPBC887.07 | mrpl38 | before | II:join(3551348.. | ||
| 2011-03-24 | SPBC902.05c | idh2 | after | II:complement(join(492162.. | ||
| 2011-03-24 | SPBC902.05c | idh2 | before | II:complement(join(492162.. | ||
| 2011-03-24 | SPBC9B6.06 | mrpl10 | after | II:1822936..1823700 | ||
| 2011-03-24 | SPBC9B6.06 | mrpl10 | before | II:1823038..1823700 | ||
| 2011-03-24 | SPBP18G5.02 | after | II:join(2401753.. | |||
| 2011-03-24 | SPBP18G5.02 | before | II:join(2401753.. | |||
| 2011-03-24 | SPBP19A11.07c | after | II:complement(join(2868453.. | |||
| 2011-03-24 | SPBP19A11.07c | before | II:complement(join(2868453.. | |||
| 2011-03-24 | SPBP23A10.16 | sdh4 | after | II:2036100..2036579 | ||
| 2011-03-24 | SPBP23A10.16 | sdh4 | before | II:2036019..2036579 | ||
| 2011-03-24 | SPBP35G2.06c | nup131 | after | II:complement(join(973049.. | ||
| 2011-03-24 | SPBP35G2.06c | nup131 | before | II:complement(join(973049.. | ||
| 2011-03-24 | SPBP35G2.08c | air1 | after | II:complement(join(979529.. | ||
| 2011-03-24 | SPBP35G2.08c | air1 | before | II:complement(join(979529.. | ||
| 2011-03-24 | SPBP35G2.14 | after | II:992872..996069 | |||
| 2011-03-24 | SPBP35G2.14 | before | II:992887..996069 | |||
| 2011-03-24 | SPBP4H10.15 | after | II:join(2903085.. | |||
| 2011-03-24 | SPBP4H10.15 | before | II:join(2903103.. | |||
| 2011-03-24 | SPBP8B7.05c | after | II:complement(3641216.. | |||
| 2011-03-24 | SPBP8B7.05c | before | II:complement(3641216.. | |||
| 2011-03-24 | SPBP8B7.10c | after | II:complement(join(3650627.. | |||
| 2011-03-24 | SPBP8B7.10c | before | II:complement(join(3650627.. | |||
| 2011-03-24 | SPBPB21E7.02c | after | II:complement(join(60553.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBPB21E7.02c | before | II:complement(join(60553.. | pseudo->coding | pers. comm. Val Wood | |
| 2011-03-24 | SPBPB2B2.05 | after | II:4466754..4467515 | |||
| 2011-03-24 | SPBPB2B2.05 | before | II:join(4466723.. | |||
| 2011-03-24 | SPCC1183.01 | sec15 | after | III:join(591852.. | ||
| 2011-03-24 | SPCC1183.01 | sec15 | before | III:join(591852.. | ||
| 2011-03-24 | SPCC1183.05c | lig4 | after | III:complement(join(599520.. | ||
| 2011-03-24 | SPCC1183.05c | lig4 | before | III:complement(join(599310.. | ||
| 2011-03-24 | SPCC1183.09c | pmp31 | after | III:complement(join(613283.. | ||
| 2011-03-24 | SPCC1183.09c | pmp31 | before | III:complement(join(613345.. | ||
| 2011-03-24 | SPCC1235.03 | after | III:join(179039.. | |||
| 2011-03-24 | SPCC1235.03 | before | III:179387..180586 | |||
| 2011-03-24 | SPCC1235.10c | sec6 | after | III:complement(join(196809.. | ||
| 2011-03-24 | SPCC1235.10c | sec6 | before | III:complement(join(196809.. | ||
| 2011-03-24 | SPCC1259.12c | after | III:complement(join(1056598.. | |||
| 2011-03-24 | SPCC1259.12c | before | III:complement(join(1056495.. | |||
| 2011-03-24 | SPCC126.09 | after | III:join(2131761.. | |||
| 2011-03-24 | SPCC126.09 | before | III:2132202..2133458 | |||
| 2011-03-24 | SPCC126.15c | sec65 | after | III:complement(join(2142679.. | ||
| 2011-03-24 | SPCC126.15c | sec65 | before | III:complement(join(2142679.. | ||
| 2011-03-24 | SPCC1442.12 | pps1 | after | III:join(1789596.. | ||
| 2011-03-24 | SPCC1442.12 | pps1 | before | III:join(1789596.. | ||
| 2011-03-24 | SPCC1450.08c | wtf16 | after | III:complement(join(1739338.. | ||
| 2011-03-24 | SPCC1450.08c | wtf16 | before | III:complement(join(1739338.. | ||
| 2011-03-24 | SPCC1450.15 | after | III:join(1761207.. | |||
| 2011-03-24 | SPCC1450.15 | before | III:join(1761516.. | |||
| 2011-03-24 | SPCC1450.16c | after | III:complement(join(1763350.. | |||
| 2011-03-24 | SPCC1450.16c | before | III:complement(1763497.. | |||
| 2011-03-24 | SPCC162.05 | coq3 | after | III:complement(1578220.. | ||
| 2011-03-24 | SPCC162.05 | coq3 | before | III:complement(1578220.. | ||
| 2011-03-24 | SPCC1620.12c | after | III:complement(join(2167799.. | |||
| 2011-03-24 | SPCC1620.12c | before | III:complement(2167799.. | |||
| 2011-03-24 | SPCC1672.04c | after | III:complement(join(568700.. | |||
| 2011-03-24 | SPCC1672.04c | before | III:complement(join(568700.. | |||
| 2011-03-24 | SPCC16C4.15 | rml2 | after | III:join(695922.. | ||
| 2011-03-24 | SPCC16C4.15 | rml2 | before | III:join(696054.. | ||
| 2011-03-24 | SPCC1739.03 | hrr1 | after | III:join(2029655.. | ||
| 2011-03-24 | SPCC1739.03 | hrr1 | before | III:join(2029655.. | ||
| 2011-03-24 | SPCC1739.04c | after | III:complement(join(2033032.. | |||
| 2011-03-24 | SPCC1739.04c | before | III:complement(join(2033032.. | |||
| 2011-03-24 | SPCC1795.08c | vid21 | after | III:join(981120.. | ||
| 2011-03-24 | SPCC1795.08c | vid21 | before | III:join(981120.. | ||
| 2011-03-24 | SPCC18.06c | caf1 | after | III:complement(1965839.. | ||
| 2011-03-24 | SPCC18.06c | caf1 | before | III:complement(1965839.. | ||
| 2011-03-24 | SPCC18.15 | after | III:join(1983372.. | |||
| 2011-03-24 | SPCC18.15 | before | III:join(1983372.. | |||
| 2011-03-24 | SPCC1884.02 | nic1 | after | III:43845..45071 | ||
| 2011-03-24 | SPCC1884.02 | nic1 | before | III:43854..45071 | ||
| 2011-03-24 | SPCC18B5.07c | nup61 | after | III:complement(join(731472.. | ||
| 2011-03-24 | SPCC18B5.07c | nup61 | before | III:complement(join(731472.. | ||
| 2011-03-24 | SPCC1919.14c | bdp1 | after | III:complement(join(2237547.. | ||
| 2011-03-24 | SPCC1919.14c | bdp1 | before | III:complement(join(2237547.. | ||
| 2011-03-24 | SPCC23B6.01c | after | III:complement(join(1264730.. | |||
| 2011-03-24 | SPCC23B6.01c | before | III:complement(join(1264730.. | |||
| 2011-03-24 | SPCC23B6.02c | after | III:complement(join(1268158.. | |||
| 2011-03-24 | SPCC23B6.02c | before | III:complement(join(1268069.. | |||
| 2011-03-24 | SPCC24B10.15 | after | III:927990..929387 | |||
| 2011-03-24 | SPCC24B10.15 | before | III:927999..929387 | |||
| 2011-03-24 | SPCC24B10.16c | after | III:complement(929755.. | |||
| 2011-03-24 | SPCC24B10.16c | before | III:complement(929755.. | |||
| 2011-03-24 | SPCC24B10.19c | after | III:complement(join(932963.. | |||
| 2011-03-24 | SPCC24B10.19c | before | III:complement(join(932963.. | |||
| 2011-03-24 | SPCC285.07c | wtf18 | after | III:complement(join(1807004.. | ||
| 2011-03-24 | SPCC285.07c | wtf18 | before | III:complement(join(1807004.. | ||
| 2011-03-24 | SPCC330.10 | pcm1 | after | III:129931..131013 | ||
| 2011-03-24 | SPCC330.10 | pcm1 | before | III:129844..131013 | ||
| 2011-03-24 | SPCC338.10c | cox5 | after | III:1357866..1358426 | ||
| 2011-03-24 | SPCC338.10c | cox5 | before | III:1357902..1358426 | ||
| 2011-03-24 | SPCC417.11c | after | III:complement(1698190.. | |||
| 2011-03-24 | SPCC417.11c | before | III:complement(1698190.. | |||
| 2011-03-24 | SPCC417.12 | after | III:1699682..1701301 | |||
| 2011-03-24 | SPCC417.12 | before | III:1699739..1701301 | |||
| 2011-03-24 | SPCC4B3.09c | after | III:join(1160510.. | |||
| 2011-03-24 | SPCC4B3.09c | before | III:join(1160411.. | |||
| 2011-03-24 | SPCC550.14 | vgl1 | after | III:1217142..1221017 | ||
| 2011-03-24 | SPCC550.14 | vgl1 | before | III:1217178..1221017 | ||
| 2011-03-24 | SPCC553.05c | after | III:complement(join(297354.. | SPD:51/51D01 | ||
| 2011-03-24 | SPCC553.05c | wtf6 | before | III:complement(join(297140.. | SPD:51/51D01 | |
| 2011-03-24 | SPCC553.11c | after | III:join(281902.. | |||
| 2011-03-24 | SPCC553.11c | before | III:join(281902.. | |||
| 2011-03-24 | SPCC569.03 | after | III:complement(join(2430334.. | |||
| 2011-03-24 | SPCC569.03 | before | III:complement(2430334.. | |||
| 2011-03-24 | SPCC584.14 | mug160 | after | III:1518916..1520220 | ||
| 2011-03-24 | SPCC584.14 | mug160 | before | III:1518925..1520220 | ||
| 2011-03-24 | SPCC594.04c | after | III:complement(362699.. | |||
| 2011-03-24 | SPCC594.04c | before | III:complement(362699.. | |||
| 2011-03-24 | SPCC613.08 | after | III:join(93146.. | |||
| 2011-03-24 | SPCC613.08 | before | III:join(93017.. | |||
| 2011-03-24 | SPCC63.03 | after | III:join(837605.. | |||
| 2011-03-24 | SPCC63.03 | before | III:join(837605.. | |||
| 2011-03-24 | SPCC63.10c | sec59 | after | III:complement(join(854651.. | ||
| 2011-03-24 | SPCC63.10c | sec59 | before | III:complement(join(854651.. | ||
| 2011-03-24 | SPCC645.02 | gep4 | after | III:join(1229724.. | ||
| 2011-03-24 | SPCC645.02 | gep4 | before | III:1229724..1230290 | ||
| 2011-03-24 | SPCC663.02 | wtf14 | after | III:join(1630438.. | ||
| 2011-03-24 | SPCC663.02 | wtf14 | before | III:join(1630438.. | ||
| 2011-03-24 | SPCC663.15c | after | III:complement(join(1660282.. | |||
| 2011-03-24 | SPCC663.15c | before | III:complement(1660282.. | |||
| 2011-03-24 | SPCC663.17 | wtf15 | after | III:join(1632825.. | ||
| 2011-03-24 | SPCC663.17 | wtf15 | before | III:1632825..1633709 | ||
| 2011-03-24 | SPCC736.05 | wtf7 | after | III:join(320608.. | ||
| 2011-03-24 | SPCC736.05 | wtf7 | before | III:join(320617.. | ||
| 2011-03-24 | SPCC757.04 | after | III:join(50527.. | |||
| 2011-03-24 | SPCC757.04 | before | III:join(50358.. | |||
| 2011-03-24 | SPCC757.10 | vph2 | after | III:join(68531.. | ||
| 2011-03-24 | SPCC757.10 | vph2 | before | III:join(68612.. | ||
| 2011-03-24 | SPCC777.02 | after | III:join(1599182.. | |||
| 2011-03-24 | SPCC777.02 | before | III:join(1598981.. | |||
| 2011-03-24 | SPCC777.13 | vps35 | after | III:join(1619556.. | ||
| 2011-03-24 | SPCC777.13 | vps35 | before | III:join(1619709.. | ||
| 2011-03-24 | SPCC790.03 | after | III:join(2245960.. | |||
| 2011-03-24 | SPCC790.03 | before | III:join(2245969.. | |||
| 2011-03-24 | SPCC970.01 | rad16 | after | III:complement(join(514906.. | ||
| 2011-03-24 | SPCC970.01 | rad16 | before | III:complement(join(514906.. | ||
| 2011-03-24 | SPCC970.09 | sec8 | after | III:complement(join(492370.. | ||
| 2011-03-24 | SPCC970.09 | sec8 | before | III:complement(join(492370.. | ||
| 2011-03-24 | SPCC970.12 | mis18 | after | III:complement(join(513931.. | ||
| 2011-03-24 | SPCC970.12 | mis18 | before | III:complement(join(514122.. | ||
| 2011-03-24 | SPCPB16A4.02c | after | III:complement(join(944872.. | |||
| 2011-03-24 | SPCPB16A4.02c | before | III:complement(join(944872.. | |||
| 2011-03-04 | SPAC1006.03c | red1 | after | I:complement(join(5071212.. | intron donor corrected | SPD:38/38H01 |
| 2011-03-04 | SPAC1006.03c | before | I:complement(join(5071212.. | intron donor corrected | SPD:38/38H01 | |
| 2011-03-04 | SPBC2G2.09c | crs1 | after | II:complement(join(3452323.. | ||
| 2011-03-04 | SPBC2G2.09c | crs1 | before | II:complement(join(3452323.. | ||
| 2011-03-04 | SPBC947.10 | dsc1 | after | II:complement(join(653091.. | N-terminal extended to use upstream methionine | pers. comm. E. Stewart |
| 2011-03-04 | SPBC947.10 | dsc1 | before | II:complement(join(653091.. | N-terminal extended to use upstream methionine | pers. comm. E. Stewart |
| 2011-02-04 | SPAC11D3.11c | after | I:complement(join(128025.. | |||
| 2011-02-04 | SPAC11D3.11c | before | I:complement(join(127165.. | |||
| 2011-02-04 | SPAC13F5.07c | after | I:complement(join(2184865.. | PMID:21270388 | ||
| 2011-02-04 | SPAC13F5.07c | before | I:complement(2184865.. | PMID:21270388 | ||
| 2011-02-04 | SPAC18B11.05 | gpi18 | after | I:complement(join(308381.. | PMID:21270388 | |
| 2011-02-04 | SPAC18B11.05 | gpi18 | before | I:complement(308381.. | PMID:21270388 | |
| 2011-02-04 | SPAC29A4.03c | after | I:join(5142407.. | PMID:21270388 | ||
| 2011-02-04 | SPAC29A4.03c | before | I:5142826..5143224 | PMID:21270388 | ||
| 2011-02-04 | SPAC3A11.03 | after | I:join(3466462.. | PMID:21270388 | ||
| 2011-02-04 | SPAC3A11.03 | before | I:join(3466462.. | PMID:21270388 | ||
| 2011-02-04 | SPAC688.04c | gst3 | after | I:complement(3116067.. | PMID:21270388 | |
| 2011-02-04 | SPAC688.04c | gst3 | before | I:complement(3116067.. | PMID:21270388 | |
| 2011-02-04 | SPAC688.11 | end4 | after | I:3135125..3138433 | PMID:21270388 | |
| 2011-02-04 | SPAC688.11 | end4 | before | I:3135155..3138433 | PMID:21270388 | |
| 2011-02-04 | SPAC823.04 | after | I:join(2587729.. | PMID:21270388 | ||
| 2011-02-04 | SPAC823.04 | before | I:join(2587729.. | PMID:21270388 | ||
| 2011-02-04 | SPACUNK4.14 | mdb1 | after | I:complement(join(2883184.. | PMID:21270388 | |
| 2011-02-04 | SPACUNK4.14 | mdb1 | before | I:complement(join(2883184.. | PMID:21270388 | |
| 2011-02-04 | SPAPB17E12.14c | after | I:complement(1286916.. | PMID:21270388 | ||
| 2011-02-04 | SPAPB17E12.14c | before | I:complement(1286916.. | PMID:21270388 | ||
| 2011-02-04 | SPBC16H5.12c | after | II:join(2274073.. | PMID:21270388 | ||
| 2011-02-04 | SPBC16H5.12c | before | II:join(2274403.. | PMID:21270388 | ||
| 2011-02-04 | SPBC1709.12 | rid1 | after | II:join(1122828.. | PMID:21270388 | |
| 2011-02-04 | SPBC1709.12 | rid1 | before | II:join(1122828.. | PMID:21270388 | |
| 2011-02-04 | SPBC1711.10c | npl4 | after | II:complement(join(2152462.. | PMID:21270388 | |
| 2011-02-04 | SPBC1711.10c | npl4 | before | II:complement(join(2152591.. | PMID:21270388 | |
| 2011-02-04 | SPBC25H2.11c | spt7 | after | II:join(3263377.. | PMID:21270388 | |
| 2011-02-04 | SPBC25H2.11c | spt7 | before | II:join(3263377.. | PMID:21270388 | |
| 2011-02-04 | SPBC29A10.17 | after | II:join(2573866.. | PMID:21270388 | ||
| 2011-02-04 | SPBC29A10.17 | before | II:join(2574032.. | PMID:21270388 | ||
| 2011-02-04 | SPBC4F6.10 | vps901 | after | II:join(2708076.. | PMID:21270388 | |
| 2011-02-04 | SPBC4F6.10 | vps901 | before | II:2708076..2709689 | PMID:21270388 | |
| 2011-02-04 | SPBP8B7.31 | after | II:join(3698333.. | PMID:21270388 | ||
| 2011-02-04 | SPBP8B7.31 | before | II:join(3698333.. | PMID:21270388 | ||
| 2011-02-04 | SPCC1322.16 | phb2 | after | III:join(1323844.. | PMID:21270388 | |
| 2011-02-04 | SPCC1322.16 | phb2 | before | III:join(1323871.. | PMID:21270388 | |
| 2011-02-04 | SPCC4G3.15c | not2 | after | III:join(441589.. | ||
| 2011-02-04 | SPCC4G3.15c | not2 | before | III:join(442039.. | ||
| 2011-02-04 | SPCC622.17 | apn1 | after | III:join(1435178.. | added 2 5’ exons | PMID:21193357 |
| 2011-02-04 | SPCC622.17 | apn1 | before | III:join(1435549.. | added 2 5’ exons | PMID:21193357 |
| 2010-12-09 | SPAC22G7.04 | ubp13 | after | I:join(732880.. | pers. comm. James Iben | |
| 2010-12-09 | SPAC22G7.04 | ubp13 | before | I:join(732880.. | pers. comm. James Iben | |
| 2010-10-15 | SPAC27F1.09c | prp10 | after | I:complement(join(4333170.. | added intron to match fully spliced | PMID:9837997 |
| 2010-10-15 | SPAC27F1.09c | prp10 | before | I:complement(join(4333170.. | added intron to match fully spliced | PMID:9837997 |
| 2010-10-15 | SPAPB24D3.05c | after | I:complement(join(2954983.. | |||
| 2010-10-15 | SPAPB24D3.05c | before | I:complement(join(2954989.. | |||
| 2010-10-15 | SPCC285.06c | wtf17 | after | III:complement(join(1805166.. | ||
| 2010-10-15 | SPCC285.06c | wtf17 | before | III:complement(join(1805165.. | ||
| 2010-09-28 | SPAPB24D3.05c | after | I:complement(join(2954989.. | |||
| 2010-09-28 | SPAPB24D3.05c | before | I:complement(2954989.. | |||
| 2010-09-28 | SPCC285.06c | wtf17 | after | III:complement(join(1805165.. | ||
| 2010-09-28 | SPCC285.06c | wtf17 | before | III:complement(join(1805169.. | ||
| 2010-05-20 | SPAC458.04c | dil1 | after | I:complement(join(4737605.. | pers. comm. Val Wood | |
| 2010-05-20 | SPAC458.04c | before | I:complement(join(4737605.. | pers. comm. Val Wood | ||
| 2010-05-20 | SPCC306.10 | wtf8 | after | III:join(427445.. | pseudo->coding | pers. comm. Val Wood |
| 2010-05-20 | SPCC306.10 | wtf8 | before | III:join(427445.. | pseudo->coding | pers. comm. Val Wood |
| 2010-05-20 | SPCC5E4.10c | after | III:complement(join(651622.. | pers. comm. K. Gould | ||
| 2010-05-20 | SPCC5E4.10c | before | III:complement(join(651622.. | pers. comm. K. Gould | ||
| 2010-01-29 | SPAC29B12.08 | after | I:join(5429038.. | replaced exon 5428786.. | pers. comm. Val Wood | |
| 2010-01-29 | SPAC29B12.08 | before | I:join(5428786.. | replaced exon 5428786.. | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.11 | after | II:join(33231.. | |||
| 2010-01-29 | SPBC1348.11 | before | II:33231..34820 | |||
| 2010-01-29 | SPBC1348.12 | after | II:join(35112.. | pseudo->coding | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.12 | before | II:35223..36658 | pseudo->coding | pers. comm. Val Wood | |
| 2010-01-29 | SPBC1348.13 | after | II:36892..37188 | |||
| 2010-01-29 | SPBC1348.13 | before | II:36901..37263 | |||
| 2010-01-29 | SPBC18E5.15 | after | II:join(2091892.. | |||
| 2010-01-29 | SPBC18E5.15 | before | II:join(2091892.. | |||
| 2010-01-29 | SPBC31A8.02 | after | II:1268093..1268452 | |||
| 2010-01-29 | SPBC31A8.02 | before | II:1268094..1268452 | |||
| 2010-01-29 | SPBC3E7.04c | after | II:complement(join(2662663.. | |||
| 2010-01-29 | SPBC3E7.04c | before | II:complement(join(2662488.. | |||
| 2010-01-29 | SPBPB21E7.02c | after | II:complement(join(60553.. | |||
| 2010-01-29 | SPBPB21E7.02c | before | II:complement(join(60553.. | |||
| 2010-01-29 | SPCP20C8.03 | after | III:join(32624.. | |||
| 2010-01-29 | SPCP20C8.03 | before | III:32624..33393 | |||
| 2009-10-23 | SPBC18H10.08c | ubp4 | after | II:complement(join(1784219.. | missing 2 N-terminal exons | pers. comm. I. Kouranti |
| 2009-10-23 | SPBC18H10.08c | ubp4 | before | II:complement(1784219.. | missing 2 N-terminal exons | pers. comm. I. Kouranti |
| 2009-10-23 | SPBC2A9.07c | after | II:complement(2959078.. | removed intron | pers. comm. Cathrine Arnason Boe | |
| 2009-10-23 | SPBC2A9.07c | before | II:complement(join(2959078.. | removed intron | pers. comm. Cathrine Arnason Boe | |
| 2009-10-23 | SPBP22H7.09c | mis15 | after | II:complement(join(1448815.. | ||
| 2009-10-23 | SPBP22H7.09c | mis15 | before | II:complement(join(1448815.. | ||
| 2009-09-04 | SPAC1F8.07c | after | I:complement(join(101836.. | |||
| 2009-09-04 | SPAC1F8.07c | before | I:complement(join(101836.. | |||
| 2009-08-19 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | PMID:21270388 | |
| 2009-08-19 | SPBC13E7.01 | cwf22 | before | II:join(3037988.. | PMID:21270388 | |
| 2009-08-19 | SPBC14C8.09c | after | II:complement(join(2219430.. | |||
| 2009-08-19 | SPBC14C8.09c | before | II:complement(join(2219430.. | |||
| 2009-08-19 | SPBC1A4.06c | after | II:complement(join(1987044.. | |||
| 2009-08-19 | SPBC1A4.06c | before | II:complement(join(1987044.. | |||
| 2009-08-19 | SPBC23G7.06c | after | II:complement(join(2106448.. | |||
| 2009-08-19 | SPBC23G7.06c | before | II:complement(join(2106448.. | |||
| 2009-08-19 | SPBC29A3.08 | pof4 | after | II:join(2053033.. | frameshifted; truncated to 2048336.. | PMID:16823372 |
| 2009-08-19 | SPBC29A3.08 | pof4 | before | II:2053033..2053632 | frameshifted; truncated to 2048336.. | PMID:16823372 |
| 2009-08-19 | SPBC337.02c | after | II:complement(join(1032857.. | |||
| 2009-08-19 | SPBC337.02c | before | II:complement(1032857.. | |||
| 2009-08-19 | SPCC1442.04c | after | III:complement(join(1773925.. | |||
| 2009-08-19 | SPCC1442.04c | before | III:complement(join(1773925.. | |||
| 2009-07-30 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2009-07-30 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2009-07-30 | SPBC800.02 | whi5 | after | II:join(253148.. | increased intron by 42bp | pers. comm. Rob de Bruin |
| 2009-07-30 | SPBC800.02 | whi5 | before | II:join(253148.. | increased intron by 42bp | pers. comm. Rob de Bruin |
| 2009-07-06 | SPCC16C4.01 | sif2 | after | III:join(658832.. | ||
| 2009-07-06 | SPCC16C4.01 | sif2 | before | III:join(658832.. | ||
| 2009-05-01 | SPBP23A10.07 | rpa2 | after | II:2008119..2011643 | truncated N-term to agree with orthologs; 2007960 -> 2008119 | pers. comm. Val Wood |
| 2009-05-01 | SPBP23A10.07 | rpa2 | before | II:2007960..2011643 | truncated N-term to agree with orthologs; 2007960 -> 2008119 | pers. comm. Val Wood |
| 2009-05-01 | SPCC548.04 | urm1 | after | III:join(223385.. | final exon 223687.. | pers. comm. Marc Feuermann, |
| 2009-05-01 | SPCC548.04 | before | III:join(223385.. | final exon 223687.. | pers. comm. Marc Feuermann, | |
| 2009-02-19 | SPAC1F8.07c | after | I:complement(join(101836.. | frameshifted | PMID:16823372, | |
| 2009-02-19 | SPAC1F8.07c | before | I:complement(101760.. | frameshifted | PMID:16823372 | |
| 2009-02-19 | SPAC22F3.11c | snu23 | after | I:join(682874.. | frameshifted | PMID:16823372, |
| 2009-02-19 | SPAC22F3.11c | snu23 | before | I:join(682874.. | frameshifted | PMID:16823372 |
| 2009-02-19 | SPAC23H3.04 | after | I:join(2499035.. | SPD:19/19C03 | ||
| 2009-02-19 | SPAC23H3.04 | before | I:join(2499035.. | |||
| 2009-02-19 | SPBC13E7.01 | cwf22 | after | II:join(3037988.. | frameshifted | PMID:16823372, |
| 2009-02-19 | SPBC13E7.01 | cwf22 | before | II:3037988..3040492 | frameshifted | PMID:16823372 |
| 2009-02-19 | SPBC14C8.09c | after | II:complement(join(2219430.. | merged with SPBC14C8.08c; frameshifted | PMID:16823372, | |
| 2009-02-19 | SPBC14C8.09c | before | II:complement(2219888.. | merged with SPBC14C8.08c; frameshifted | PMID:16823372 | |
| 2009-02-19 | SPBC1A4.06c | after | II:complement(join(1987044.. | frameshifted; C term exon changed from 1987076.. | PMID:16823372, | |
| 2009-02-19 | SPBC1A4.06c | before | II:complement(join(1987076.. | frameshifted; C term exon changed from 1987076.. | PMID:16823372 | |
| 2009-02-19 | SPBC23G7.06c | after | II:complement(join(2106448.. | frameshifted; now a single exon | PMID:16823372, | |
| 2009-02-19 | SPBC23G7.06c | before | II:complement(join(2106448.. | frameshifted; now a single exon | PMID:16823372 | |
| 2009-02-19 | SPBC29A3.06 | after | II:join(2048336.. | SPD:35/35A03 | ||
| 2009-02-19 | SPBC29A3.06 | before | II:2048336..2050006 | |||
| 2009-02-19 | SPBC725.12 | nbl1 | after | II:join(1227762.. | pers. comm. Kathy Gould, | |
| 2009-02-19 | SPBC725.12 | mug118 | before | II:join(1227762.. | pers. comm. Kathy Gould | |
| 2009-02-19 | SPCC1442.04c | after | III:complement(join(1773925.. | frameshifted | PMID:16823372, | |
| 2009-02-19 | SPCC1442.04c | before | III:complement(1774200.. | frameshifted | PMID:16823372 | |
| 2009-01-14 | SPAC31G5.12c | maf1 | after | I:complement(join(3008184.. | PMID:15590667 | |
| 2009-01-14 | SPAC31G5.12c | maf1 | before | I:complement(join(3008184.. | PMID:15590667 | |
| 2009-01-14 | SPAPB1E7.14 | iec5 | after | I:join(3321979.. | PMID:19040720 | |
| 2009-01-14 | SPAPB1E7.14 | before | I:join(3322106.. | PMID:19040720, | ||
| 2008-12-10 | SPAC23H3.04 | after | I:join(2499035.. | |||
| 2008-12-10 | SPAC23H3.04 | before | I:join(2499035.. | |||
| 2008-12-10 | SPAC688.04c | gst3 | after | I:complement(3116067.. | ||
| 2008-12-10 | SPAC688.04c | gst3 | before | I:complement(3116067.. | ||
| 2008-09-22 | SPBC11B10.10c | pht1 | after | II:complement(1502642.. | N terminal shortened to 2nd methionine; starting coordinate changed from 1503157 to 1503064 | pers. comm. L Buchanan and F Stewart |
| 2008-09-22 | SPBC11B10.10c | pht1 | before | II:complement(1502642.. | N terminal shortened to 2nd methionine; starting coordinate changed from 1503157 to 1503064 | pers. comm. L Buchanan and F Stewart |
| 2008-08-27 | SPAC959.05c | after | I:complement(join(3395685.. | merged with SPAC959.06c; splicing is tentative | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPAC959.05c | before | I:complement(join(3395685.. | merged with SPAC959.06c; splicing is tentative | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC18E5.14c | after | II:complement(join(2089944.. | merged with SPBC18E5.09c | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC18E5.14c | before | II:complement(2089944.. | merged with SPBC18E5.09c | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC31F10.08 | mde2 | after | II:join(3764820.. | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC31F10.08 | mde2 | before | II:3764820..3765449 | pers. comm. Charley Chahwan | |
| 2008-08-27 | SPBC651.06 | mug166 | after | II:join(1247484.. | merged with SPBC651.07 | pers. comm. Charley Chahwan |
| 2008-08-27 | SPBC651.06 | mug166 | before | II:1247484..1248188 | merged with SPBC651.07 | pers. comm. Charley Chahwan |
| 2008-07-16 | SPAC25H1.10c | atp19 | after | I:complement(join(2532904.. | PMID:18488015 | |
| 2008-07-16 | SPAC25H1.10c | atp19 | before | I:complement(join(2532905.. | PMID:xxxxtemp | |
| 2008-07-16 | SPAC6F6.16c | tpz1 | after | I:complement(join(2763686.. | merged with SPAC6F6.18c and five introns added | PMID:18535244 |
| 2008-07-16 | SPAC6F6.16c | before | I:complement(2763686.. | merged with SPAC6F6.18c and five introns added | PMID:18535244 | |
| 2008-07-16 | SPBC2G2.09c | crs1 | after | II:complement(join(3452323.. | added new C-terminal exon, | pers. comm. Charley Chahwan |
| 2008-07-16 | SPBC2G2.09c | crs1 | before | II:complement(join(3452584.. | added new C-terminal exon, | pers. comm. Charley Chahwan |
| 2008-07-16 | SPCC338.08 | ctp1 | after | III:complement(join(1358891.. | ||
| 2008-07-16 | SPCC338.08 | ctp1 | before | III:complement(join(1358891.. | ||
| 2008-07-16 | SPCC962.05 | ast1 | after | III:join(554521.. | pers. comm. Matthew O’Connell | |
| 2008-07-16 | SPCC962.05 | ast1 | after | III:join(554521.. | intron position moved | pers comm. M. O’Connell |
| 2008-07-16 | SPCC962.05 | before | III:join(554521.. | pers. comm. Matthew O’Connell | ||
| 2008-07-16 | SPCC962.05 | before | III:join(554521.. | intron position moved | pers comm. M. O’Connell | |
| 2008-05-12 | SPAC31G5.12c | maf1 | after | I:complement(join(3008184.. | ||
| 2008-05-12 | SPAC31G5.12c | maf1 | before | I:complement(join(3008184.. | ||
| 2008-04-18 | SPBC16C6.02c | vps1302 | after | II:complement(join(4322829.. | also adds new gene SPBC16C6.14, | PMID:18367542 |
| 2008-04-18 | SPBC16C6.02c | vps1302 | before | II:complement(join(4322221.. | also adds new gene SPBC16C6.14, | PMID:18367542 |
| 2008-02-22 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | Solexa intron data; altered 3rd intron branch acceptor to agree with published | PMID:18488015 |
| 2008-02-22 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | Solexa intron data; altered 3rd intron branch acceptor to agree with published | PMID:18488015 |
| 2008-02-22 | SPBC21C3.07c | before | II:complement(join(3807827.. | |||
| 2008-02-22 | SPBC21C3.07c | before | II:complement(join(3807920.. | Solexa transread data; added two 3’ exons | PMID:18488015 | |
| 2008-02-22 | SPBC428.20c | alp6 | after | II:complement(join(481076.. | ||
| 2008-02-22 | SPBC428.20c | alp6 | before | II:complement(join(481076.. | ||
| 2008-02-22 | SPCC338.08 | ctp1 | after | III:complement(join(1358891.. | ||
| 2008-02-22 | SPCC338.08 | ctp1 | before | III:complement(join(1358885.. | ||
| 2008-01-23 | SPAC1093.03 | after | I:join(4613627.. | Solexa intron data; improved distance between branch and acceptor, | PMID:18488015 | |
| 2008-01-23 | SPAC1093.03 | before | I:join(4613627.. | Solexa intron data; improved distance between branch and acceptor, | PMID:18488015 | |
| 2008-01-23 | SPAC1142.01 | after | I:3625574..3627544 | Solexa intron data; removed 5’ exon and trimmed to new Met, | PMID:18488015 | |
| 2008-01-23 | SPAC1142.01 | before | I:join(3625447.. | Solexa intron data; removed 5’ exon and trimmed to new Met, | PMID:18488015 | |
| 2008-01-23 | SPAC11D3.07c | after | I:complement(118195.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAC11D3.07c | before | I:complement(join(118195.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAC13G6.04 | tim8 | after | I:join(180423.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC13G6.04 | tim8 | before | I:join(180423.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC144.17c | after | I:complement(join(4687388.. | Solexa transread data; added 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPAC144.17c | before | I:complement(join(4687483.. | Solexa transread data; added 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1556.01c | rad50 | after | I:complement(join(3791831.. | Solexa transread data; added small 3’ intron and exon | PMID:18488015 |
| 2008-01-23 | SPAC1556.01c | rad50 | before | I:complement(join(3791855.. | Solexa transread data; added small 3’ intron and exon | PMID:18488015 |
| 2008-01-23 | SPAC1556.03 | azr1 | after | I:join(3799244.. | Solexa transread data; added new 5’ intron and exon/improved homology | PMID:18488015 |
| 2008-01-23 | SPAC1556.03 | azr1 | before | I:join(3799244.. | Solexa transread data; added new 5’ intron and exon/improved homology | PMID:18488015 |
| 2008-01-23 | SPAC15A10.10 | mde6 | after | I:join(3697508.. | Solexa transread data; added in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC15A10.10 | mde6 | before | I:join(3697508.. | Solexa transread data; added in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC15A10.12c | after | I:complement(join(3709206.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC15A10.12c | before | I:complement(3709451.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC1639.01c | after | I:complement(join(251726.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC1639.01c | before | I:complement(join(251726.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC16E8.12c | after | I:complement(join(3523136.. | Solexa transread data; added 2 5’ exons | PMID:18488015 | |
| 2008-01-23 | SPAC16E8.12c | before | I:complement(join(3523136.. | Solexa transread data; added 2 5’ exons | PMID:18488015 | |
| 2008-01-23 | SPAC1751.02c | rsm19 | after | I:complement(join(385755.. | Solexa intron data; remove 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPAC1751.02c | rsm19 | before | I:complement(join(385755.. | Solexa intron data; remove 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPAC17A5.02c | dbr1 | after | I:complement(join(1754033.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC17A5.02c | dbr1 | before | I:complement(join(1754109.. | Solexa transread data | PMID:18488015 |
| 2008-01-23 | SPAC1A6.03c | after | I:complement(join(1070061.. | Solexa transread data; new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1A6.03c | before | I:complement(1070139.. | Solexa transread data; new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1B3.10c | after | I:complement(4946090.. | Solexa intron data; removed 3’ exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1B3.10c | before | I:complement(join(4945933.. | Solexa intron data; removed 3’ exon, | PMID:18488015 | |
| 2008-01-23 | SPAC1F12.08 | after | I:join(3817464.. | Solexa transread data; added new intron, | PMID:18488015 | |
| 2008-01-23 | SPAC1F12.08 | before | I:join(3817464.. | Solexa transread data; added new intron, | PMID:18488015 | |
| 2008-01-23 | SPAC22E12.10c | etp1 | after | I:complement(join(5037208.. | Solexa transread data; added in-frame splice | PMID:18488015 |
| 2008-01-23 | SPAC22E12.10c | etp1 | before | I:complement(5037208.. | Solexa transread data; added in-frame splice | PMID:18488015 |
| 2008-01-23 | SPAC23C4.04c | after | I:join(1036033.. | Solexa transread data; added intron | PMID:18488015 | |
| 2008-01-23 | SPAC23C4.04c | before | I:1036033..1036347 | Solexa transread data; added intron | PMID:18488015 | |
| 2008-01-23 | SPAC23H3.04 | after | I:join(2499035.. | Solexa intron data; changed 5’ 1st and 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC23H3.04 | before | I:join(2499035.. | Solexa intron data; changed 5’ 1st and 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC24H6.01c | after | I:join(490016.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC24H6.01c | before | I:join(490016.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAC26H5.04 | after | I:4122149..4124518 | Solexa intron data | PMID:18488015 | |
| 2008-01-23 | SPAC26H5.04 | before | I:join(4122149.. | Solexa intron data | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.06c | after | I:complement(join(4269367.. | Solexa intron data; replaced 2 internal exons with a different single exon | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.06c | before | I:complement(join(4269367.. | Solexa intron data; replaced 2 internal exons with a different single exon | PMID:18488015 | |
| 2008-01-23 | SPAC2C4.11c | rbp28 | after | I:complement(join(4278729.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC2C4.11c | rbp28 | before | I:complement(4278729.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 |
| 2008-01-23 | SPAC2F3.18c | after | I:complement(join(3942299.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 | |
| 2008-01-23 | SPAC2F3.18c | before | I:complement(3942398.. | Solexa transread data; added small N term in-frame intron | PMID:18488015 | |
| 2008-01-23 | SPAC30.03c | tsn1 | after | I:complement(join(4394707.. | Solexa transread data; added in-frame intron to (previous) 2nd exon, | PMID:18488015 |
| 2008-01-23 | SPAC30.03c | tsn1 | before | I:complement(join(4394707.. | Solexa transread data; added in-frame intron to (previous) 2nd exon, | PMID:18488015 |
| 2008-01-23 | SPAC30C2.05 | erv14 | after | I:join(4639884.. | Solexa transread data; added new 5’ intron/exon, | PMID:18488015 |
| 2008-01-23 | SPAC30C2.05 | erv14 | before | I:join(4639916.. | Solexa transread data; added new 5’ intron/exon, | PMID:18488015 |
| 2008-01-23 | SPAC328.05 | after | I:join(3484695.. | Solexa intron data; removed in-frame splice (exon 5), | PMID:18488015 | |
| 2008-01-23 | SPAC328.05 | before | I:join(3484695.. | Solexa intron data; removed in-frame splice (exon 5), | PMID:18488015 | |
| 2008-01-23 | SPAC3A12.05c | taf2 | after | I:complement(join(1426213.. | Solexa intron data; improved distance between branch and acceptor | PMID:18488015 |
| 2008-01-23 | SPAC3A12.05c | taf2 | before | I:complement(join(1426213.. | Solexa intron data; improved distance between branch and acceptor | PMID:18488015 |
| 2008-01-23 | SPAC4F10.08 | mug126 | after | I:join(4844855.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC4F10.08 | mug126 | before | I:join(4844855.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC56F8.04c | coq2 | after | I:complement(join(1133226.. | Solexa transread data; added 5’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC56F8.04c | coq2 | before | I:complement(1133226.. | Solexa transread data; added 5’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPAC589.02c | med13 | after | I:complement(join(3095075.. | Solexa intron data; improved branch/acceptor for 1st intron | PMID:18488015 |
| 2008-01-23 | SPAC589.02c | med13 | before | I:complement(join(3095075.. | Solexa intron data; improved branch/acceptor for 1st intron | PMID:18488015 |
| 2008-01-23 | SPAC630.11 | vps55 | after | I:join(366801.. | Solexa transread data; changed internal intron acceptor, | PMID:18488015 |
| 2008-01-23 | SPAC630.11 | vps55 | before | I:join(366801.. | Solexa transread data; changed internal intron acceptor, | PMID:18488015 |
| 2008-01-23 | SPAC6F12.08c | after | I:complement(join(1322439.. | Solexa intron data; improved branch acceptor for intron 1 | PMID:18488015 | |
| 2008-01-23 | SPAC6F12.08c | before | I:complement(join(1322439.. | Solexa intron data; improved branch acceptor for intron 1 | PMID:18488015 | |
| 2008-01-23 | SPAC823.04 | after | I:join(2587729.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC823.04 | before | I:join(2587729.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC823.09c | after | I:complement(join(2594777.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC823.09c | before | I:complement(join(2594922.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPAC890.07c | rmt1 | after | I:complement(join(5016020.. | Solexa transread data; added small N terminal exon, | PMID:18488015 |
| 2008-01-23 | SPAC890.07c | rmt1 | before | I:complement(join(5016072.. | Solexa transread data; added small N terminal exon, | PMID:18488015 |
| 2008-01-23 | SPAC8C9.19 | after | I:join(3660430.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2008-01-23 | SPAC8C9.19 | before | I:join(3660430.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2008-01-23 | SPAC9.06c | after | I:complement(join(1473692.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC9.06c | before | I:complement(join(1473692.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAC9G1.13c | after | I:complement(join(1995208.. | Solexa intron data; added a new 3rd exon, | PMID:18488015 | |
| 2008-01-23 | SPAC9G1.13c | before | I:complement(join(1995208.. | Solexa intron data; added a new 3rd exon, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.03 | after | I:join(1271889.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.03 | before | I:join(1271889.. | Solexa intron data; removed in-frame splice, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.08 | after | I:join(1279573.. | Solexa transread data; changed first donor to make n-terminal exon longer, | PMID:18488015 | |
| 2008-01-23 | SPAPB17E12.08 | before | I:join(1279573.. | Solexa transread data; changed first donor to make n-terminal exon longer, | PMID:18488015 | |
| 2008-01-23 | SPAPB18E9.01 | trm5 | after | I:join(3974310.. | Solexa transread data; added small 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPAPB18E9.01 | trm5 | before | I:join(3974310.. | Solexa transread data; added small 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPAPB1A10.16 | after | I:join(1863972.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAPB1A10.16 | before | I:1863972..1864388 | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPAPB2B4.06 | after | I:join(2722735.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPAPB2B4.06 | before | I:join(2722735.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBC106.05c | tim11 | after | II:complement(join(383527.. | Solexa transread data; changed 5’ exon | PMID:18488015 |
| 2008-01-23 | SPBC106.05c | tim11 | before | II:complement(join(383527.. | Solexa transread data; changed 5’ exon | PMID:18488015 |
| 2008-01-23 | SPBC13G1.04c | after | II:complement(join(3732806.. | Solexa transread data; added new 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBC13G1.04c | before | II:complement(3732941.. | Solexa transread data; added new 3’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBC15D4.13c | after | II:complement(join(3032492.. | Solexa intron data; better donor for first intron | PMID:18488015 | |
| 2008-01-23 | SPBC15D4.13c | before | II:complement(join(3032492.. | Solexa intron data; better donor for first intron | PMID:18488015 | |
| 2008-01-23 | SPBC16C6.03c | after | II:complement(4332698.. | Solexa intron data; final exon, | PMID:18488015 | |
| 2008-01-23 | SPBC16C6.03c | before | II:complement(join(4332356.. | Solexa intron data; final exon, | PMID:18488015 | |
| 2008-01-23 | SPBC16D10.02 | trm11 | after | II:join(3588806.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPBC16D10.02 | trm11 | before | II:join(3588806.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 |
| 2008-01-23 | SPBC16D10.10 | after | II:join(3618117.. | Solexa transread data; changed 2 introns (existing 4 and 5) to create a new exon 5, | PMID:18488015 | |
| 2008-01-23 | SPBC16D10.10 | before | II:join(3618117.. | Solexa transread data; changed 2 introns (existing 4 and 5) to create a new exon 5, | PMID:18488015 | |
| 2008-01-23 | SPBC16E9.16c | lsd90 | after | II:complement(join(1947985.. | gene structure revised to remove introns, | PMID:18079165 |
| 2008-01-23 | SPBC16E9.16c | before | II:complement(join(1947985.. | gene structure revised to remove introns, | PMID:18079165 | |
| 2008-01-23 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | ||
| 2008-01-23 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | ||
| 2008-01-23 | SPBC19G7.10c | after | II:complement(join(2369064.. | |||
| 2008-01-23 | SPBC19G7.10c | before | II:complement(join(2369064.. | |||
| 2008-01-23 | SPBC21.03c | after | II:complement(join(3217985.. | Solexa intron data; changed 2 internal introns, | PMID:18488015 | |
| 2008-01-23 | SPBC21.03c | before | II:complement(join(3217985.. | Solexa intron data; changed 2 internal introns, | PMID:18488015 | |
| 2008-01-23 | SPBC21C3.07c | after | II:complement(join(3807714.. | |||
| 2008-01-23 | SPBC21C3.07c | after | II:complement(join(3807827.. | Solexa transread data; added two 3’ exons | PMID:18488015 | |
| 2008-01-23 | SPBC2A9.07c | after | II:complement(join(2959078.. | Solexa transread data; added in-frame intron, | PMID:18488015 | |
| 2008-01-23 | SPBC2A9.07c | before | II:complement(2959078.. | Solexa transread data; added in-frame intron, | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.15c | after | II:complement(join(2995324.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.15c | before | II:complement(join(2995324.. | Solexa transread data | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.16 | after | II:join(2996452.. | Solexa transread data; added new intron in second exon, | PMID:18488015 | |
| 2008-01-23 | SPBC2D10.16 | before | II:join(2996452.. | Solexa transread data; added new intron in second exon, | PMID:18488015 | |
| 2008-01-23 | SPBC31F10.12 | after | II:join(3773308.. | Solexa transread data; added new 5’ intron and exon | PMID:18488015 | |
| 2008-01-23 | SPBC31F10.12 | before | II:join(3773353.. | Solexa transread data; added new 5’ intron and exon | PMID:18488015 | |
| 2008-01-23 | SPBC32H8.08c | after | II:complement(join(1465811.. | Solexa intron data; removed 5’ intron/exon (unsupported) and trimmed to next met | PMID:18488015 | |
| 2008-01-23 | SPBC32H8.08c | before | II:complement(join(1465811.. | Solexa intron data; removed 5’ intron/exon (unsupported) and trimmed to next met | PMID:18488015 | |
| 2008-01-23 | SPBC4.02c | after | II:complement(join(1185617.. | |||
| 2008-01-23 | SPBC4.02c | before | II:complement(join(1185617.. | |||
| 2008-01-23 | SPBC582.04c | after | II:complement(join(423269.. | Solexa transread data; added in-frame intron to (existing) exon 3 | PMID:18488015 | |
| 2008-01-23 | SPBC582.04c | before | II:complement(join(423269.. | Solexa transread data; added in-frame intron to (existing) exon 3 | PMID:18488015 | |
| 2008-01-23 | SPBC725.04 | after | II:join(1208965.. | |||
| 2008-01-23 | SPBC725.04 | before | II:join(1208965.. | |||
| 2008-01-23 | SPBC8D2.17 | after | II:join(1390183.. | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBC8D2.17 | before | II:1390183..1391238 | Solexa transread data; added new 3’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBC947.03c | after | II:join(676629.. | Solexa transread data; added 5’ inton/exon, | PMID:18488015 | |
| 2008-01-23 | SPBC947.03c | before | II:676629..676931 | Solexa transread data; added 5’ inton/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP35G2.06c | nup131 | after | II:complement(join(973049.. | Solexa intron data; changed donor for intron 3 | PMID:18488015 |
| 2008-01-23 | SPBP35G2.06c | nup131 | before | II:complement(join(973049.. | Solexa intron data; changed donor for intron 3 | PMID:18488015 |
| 2008-01-23 | SPBP4H10.12 | after | II:join(2895855.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP4H10.12 | before | II:join(2895855.. | Solexa transread data; added new 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPBP4H10.15 | after | II:join(2903103.. | |||
| 2008-01-23 | SPBP4H10.15 | before | II:2903103..2905820 | |||
| 2008-01-23 | SPBPB2B2.18 | after | II:join(4502692.. | Solexa transread data; changed 5’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBPB2B2.18 | before | II:join(4502439.. | Solexa transread data; changed 5’ intron/exon | PMID:18488015 | |
| 2008-01-23 | SPBPJ4664.05 | after | II:join(705932.. | Solexa transread data; added new 5’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPBPJ4664.05 | before | II:706175..706666 | Solexa transread data; added new 5’ intron and exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1020.11c | after | III:join(757365.. | Solexa transread data; added 3’intron/exon | PMID:18488015 | |
| 2008-01-23 | SPCC1020.11c | before | III:join(757365.. | Solexa transread data; added 3’intron/exon | PMID:18488015 | |
| 2008-01-23 | SPCC1393.06c | after | III:complement(join(804627.. | Solexa intron data; changed first intron and added a new 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1393.06c | before | III:complement(join(804627.. | Solexa intron data; changed first intron and added a new 2nd exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1442.08c | cox12 | after | III:complement(join(1781505.. | Solexa transread data; added 2 small 5’ exons, | PMID:18488015 |
| 2008-01-23 | SPCC1442.08c | cox12 | before | III:complement(join(1781505.. | Solexa transread data; added 2 small 5’ exons, | PMID:18488015 |
| 2008-01-23 | SPCC1450.14c | ero12 | after | III:complement(1759295.. | Solexa intron data; deleted first exon, | PMID:18488015 |
| 2008-01-23 | SPCC1450.14c | ero12 | before | III:complement(join(1759295.. | Solexa intron data; deleted first exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.09c | tfg1 | after | III:complement(join(2161331.. | Solexa transread data; added 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.09c | tfg1 | before | III:complement(join(2161527.. | Solexa transread data; added 5’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC1620.10 | cwf26 | after | III:join(2163205.. | Solexa transread data; added 3’ exon encoding single methionine | PMID:18488015 |
| 2008-01-23 | SPCC1620.10 | cwf26 | before | III:2163205..2164122 | Solexa transread data; added 3’ exon encoding single methionine | PMID:18488015 |
| 2008-01-23 | SPCC16C4.01 | sif2 | after | III:join(658832.. | Solexa transread data; added 3’ intron which changed frame of final exon, | PMID:18488015 |
| 2008-01-23 | SPCC16C4.01 | sif2 | before | III:join(658832.. | Solexa transread data; added 3’ intron which changed frame of final exon, | PMID:18488015 |
| 2008-01-23 | SPCC16C4.16c | after | III:complement(join(697605.. | Solexa transread data; added 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPCC16C4.16c | before | III:complement(join(697862.. | Solexa transread data; added 3’ intron/exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1827.02c | after | III:complement(2377039.. | Solexa intron data; deleted first exon, | PMID:18488015 | |
| 2008-01-23 | SPCC1827.02c | before | III:complement(join(2377039.. | Solexa intron data; deleted first exon, | PMID:18488015 | |
| 2008-01-23 | SPCC338.08 | ctp1 | after | III:complement(join(1358885.. | in accordance with paper | pers. comm. Paul Russell; PMID:18378696 |
| 2008-01-23 | SPCC338.08 | ctp1 | before | III:complement(1358962.. | in accordance with paper | pers. comm. Paul Russell; PMID:18378696 |
| 2008-01-23 | SPCC63.10c | after | III:complement(join(854651.. | Solexa intron data; deleted 2nd and 3rd introns, | PMID:18488015 | |
| 2008-01-23 | SPCC63.10c | before | III:complement(join(854651.. | Solexa intron data; deleted 2nd and 3rd introns, | PMID:18488015 | |
| 2008-01-23 | SPCC736.12c | mmi1 | after | III:complement(join(337829.. | Solexa transread data; added 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC736.12c | mmi1 | before | III:complement(join(338026.. | Solexa transread data; added 3’ exon, | PMID:18488015 |
| 2008-01-23 | SPCC830.02 | wtf24 | after | III:join(2181204.. | ||
| 2008-01-23 | SPCC830.02 | wtf24 | before | III:join(2181204.. | ||
| 2007-12-19 | SPAC1639.01c | after | I:complement(join(251726.. | |||
| 2007-12-19 | SPAC1639.01c | before | I:complement(join(251726.. | |||
| 2007-12-19 | SPAC16A10.06c | nse2 | after | I:complement(join(3089583.. | Solexa intron data; revised intron structure/original intron absent from Solexa data | PMID:18488015 |
| 2007-12-19 | SPAC16A10.06c | nse2 | before | I:complement(join(3089583.. | Solexa intron data; revised intron structure/original intron absent from Solexa data | PMID:18488015 |
| 2007-12-19 | SPAC17C9.08 | pnu1 | after | I:complement(join(4484835.. | Solexa intron data; revised intron structure/original intron absent from Solexa data and unsupported from mRNA data so final exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC17C9.08 | pnu1 | before | I:complement(join(4484758.. | Solexa intron data; revised intron structure/original intron absent from Solexa data and unsupported from mRNA data so final exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC227.11c | after | I:complement(join(514552.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPAC227.11c | before | I:complement(join(514434.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPAC23D3.08 | usp108 | after | I:join(4352514.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC23D3.08 | usp108 | before | I:join(4352514.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC29E6.03c | uso1 | after | I:complement(join(4405990.. | Solexa intron data; changed internal splice site, | PMID:18488015 |
| 2007-12-19 | SPAC29E6.03c | uso1 | before | I:complement(join(4405871.. | Solexa intron data; changed internal splice site, | PMID:18488015 |
| 2007-12-19 | SPAC4C5.01 | after | I:join(1192545.. | Solexa intron data` altered intron 5 to improve donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC4C5.01 | before | I:join(1192545.. | Solexa intron data` altered intron 5 to improve donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC56F8.05c | mug64 | after | I:complement(join(1134697.. | Solexa intron data; revised intron structure/original intron absent from Solexa data. N terminal exon unsupported and had no branch site so exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC56F8.05c | mug64 | before | I:complement(join(1134697.. | Solexa intron data; revised intron structure/original intron absent from Solexa data. N terminal exon unsupported and had no branch site so exon deleted | PMID:18488015 |
| 2007-12-19 | SPAC631.02 | after | I:join(2107470.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC631.02 | before | I:2107940..2110123 | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC688.08 | srb8 | after | I:join(3123163.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC688.08 | srb8 | before | I:join(3123163.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPAC6G9.16c | after | I:complement(join(3278951.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC6G9.16c | before | I:complement(3278951.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPAC823.04 | after | I:join(2587729.. | Solexa intron data; changed first intron acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAC823.04 | before | I:join(2587859.. | Solexa intron data; changed first intron acceptor, | PMID:18488015 | |
| 2007-12-19 | SPAPB17E12.08 | after | I:join(1279573.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small N-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB17E12.08 | before | I:join(1279492.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small N-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB1A10.03 | nxt1 | after | I:join(1863363.. | Solexa intron data; SPAPB1A10.03 split to create SPAPB1A10.03 and SPAPB1A10.16; new coordinates 1863363.. | PMID:18488015 |
| 2007-12-19 | SPAPB1A10.03 | nxt1 | before | I:join(1863363.. | Solexa intron data; SPAPB1A10.03 split to create SPAPB1A10.03 and SPAPB1A10.16; new coordinates 1863363.. | PMID:18488015 |
| 2007-12-19 | SPAPB1A10.15 | after | I:join(1892554.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small C-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPAPB1A10.15 | before | I:join(1892554.. | Solexa intron data; revised intron structure/original intron absent from Solexa data so small C-term exon deleted | PMID:18488015 | |
| 2007-12-19 | SPBC11B10.03 | cog8 | after | II:1490611..1491747 | Solexa intron data; removed N-teminal exon, | PMID:18488015 |
| 2007-12-19 | SPBC11B10.03 | cog8 | before | II:join(1490376.. | Solexa intron data; removed N-teminal exon, | PMID:18488015 |
| 2007-12-19 | SPBC1604.17c | after | II:join(3900047.. | Solexa intron data; updated, | PMID:18488015 | |
| 2007-12-19 | SPBC1604.17c | before | II:join(3900047.. | Solexa intron data; updated, | PMID:18488015 | |
| 2007-12-19 | SPBC16A3.14 | after | II:complement(4271131.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC16A3.14 | before | II:complement(join(4270907.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC16D10.10 | after | II:join(3618117.. | Solexa intron data; exon 4 splice altered | PMID:18488015 | |
| 2007-12-19 | SPBC16D10.10 | before | II:join(3618117.. | Solexa intron data; exon 4 splice altered | PMID:18488015 | |
| 2007-12-19 | SPBC16H5.04 | after | II:complement(join(2293393.. | Solexa intron data; altered intron 2 donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPBC16H5.04 | before | II:complement(join(2293393.. | Solexa intron data; altered intron 2 donor and acceptor, | PMID:18488015 | |
| 2007-12-19 | SPBC19G7.06 | mbx1 | after | II:join(2359429.. | Christopher J. McInerny | |
| 2007-12-19 | SPBC19G7.06 | mbx1 | before | II:join(2359429.. | Christopher J. McInerny | |
| 2007-12-19 | SPBC21B10.02 | after | II:complement(1669719.. | Solexa intron data; intron unsupported by Solexa transcript data, | PMID:18488015 | |
| 2007-12-19 | SPBC21B10.02 | before | II:complement(join(1669624.. | Solexa intron data; intron unsupported by Solexa transcript data, | PMID:18488015 | |
| 2007-12-19 | SPBC21C3.07c | after | II:complement(join(3807920.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC21C3.07c | before | II:complement(join(3807714.. | Solexa intron data; removed final exon, | PMID:18488015 | |
| 2007-12-19 | SPBC29A3.07c | after | II:complement(join(2050258.. | Solexa intron data; final exon deleted, | PMID:18488015 | |
| 2007-12-19 | SPBC29A3.07c | before | II:complement(join(2050069.. | Solexa intron data; final exon deleted, | PMID:18488015 | |
| 2007-12-19 | SPBC354.07c | after | II:complement(join(558335.. | Solexa transcript data; additional exon added | PMID:18488015 | |
| 2007-12-19 | SPBC354.07c | before | II:complement(join(558335.. | Solexa transcript data; additional exon added | PMID:18488015 | |
| 2007-12-19 | SPBPB2B2.07c | after | II:complement(join(4474145.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPBPB2B2.07c | before | II:complement(4474434.. | Solexa transcript data | PMID:18488015 | |
| 2007-12-19 | SPCC1442.13c | after | III:complement(1791346.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2007-12-19 | SPCC1442.13c | before | III:complement(join(1791196.. | Solexa intron data; deleted final exon, | PMID:18488015 | |
| 2007-12-19 | SPCC1450.09c | after | III:complement(1741588.. | Solexa intron data; original intron absent from Solexa data; C terminal exon unsupported so exon deleted | PMID:18488015 | |
| 2007-12-19 | SPCC1450.09c | before | III:complement(join(1741451.. | Solexa intron data; original intron absent from Solexa data; C terminal exon unsupported so exon deleted | PMID:18488015 | |
| 2007-12-19 | SPCC1494.02c | taf13 | after | III:complement(join(2318335.. | Solexa intron data; 2 C-terminal exons removed, | PMID:18488015 |
| 2007-12-19 | SPCC1494.02c | taf13 | before | III:complement(join(2317988.. | Solexa intron data; 2 C-terminal exons removed, | PMID:18488015 |
| 2007-12-19 | SPCC18.18c | fum1 | after | III:complement(join(1988631.. | Solexa transcript data | PMID:18488015 |
| 2007-12-19 | SPCC18.18c | fum1 | before | III:complement(1988631.. | Solexa transcript data | PMID:18488015 |
| 2007-12-19 | SPCC622.14 | after | III:join(1427098.. | Solexa intron data; altered donor for intron 3, | PMID:18488015 | |
| 2007-12-19 | SPCC622.14 | before | III:join(1427098.. | Solexa intron data; altered donor for intron 3, | PMID:18488015 | |
| 2007-12-19 | SPCC736.05 | wtf7 | after | III:join(320617.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-12-19 | SPCC736.05 | wtf7 | before | III:join(320617.. | Solexa intron data; removed final exon, | PMID:18488015 |
| 2007-11-09 | SPCC1020.11c | after | III:join(757365.. | Solexa transcript data | PMID:18488015 | |
| 2007-11-09 | SPCC1020.11c | before | III:757494..757802 | Solexa transcript data | PMID:18488015 | |
| 2007-11-09 | SPCC1529.01 | after | III:join(237554.. | Solexa transcript data; new exon added | PMID:18488015 | |
| 2007-11-09 | SPCC1529.01 | before | III:join(237554.. | Solexa transcript data; new exon added | PMID:18488015 | |
| 2007-09-19 | SPBC725.04 | after | II:join(1208965.. | |||
| 2007-09-19 | SPBC725.04 | before | II:join(1208965.. | |||
| 2007-09-04 | SPAC22F8.07c | rtf1 | after | I:complement(join(4797267.. | Two in-frame splices added | EMBL:AJ627891 |
| 2007-09-04 | SPAC22F8.07c | rtf1 | before | I:complement(join(4797267.. | Two in-frame splices added | EMBL:AJ627891 |
| 2007-07-05 | SPAC23C4.04c | after | I:1036033..1036347 | altered to include stop codon and trimmed to methionine | pers. comm. Val Wood | |
| 2007-07-05 | SPAC23C4.04c | before | I:1036027..1036344 | altered to include stop codon and trimmed to methionine | pers. comm. Val Wood | |
| 2007-07-05 | SPAC9E9.02 | after | I:complement(4435617.. | altered to include stop codon | pers. comm. Val Wood | |
| 2007-07-05 | SPAC9E9.02 | before | I:complement(4435620.. | altered to include stop codon | pers. comm. Val Wood | |
| 2007-07-05 | SPCC338.03c | after | III:1368919..1369344 | |||
| 2007-07-05 | SPCC338.03c | before | III:1368919..1369341 | |||
| 2007-06-20 | SPAC11D3.11c | after | I:complement(join(127165.. | |||
| 2007-06-20 | SPAC11D3.11c | before | I:complement(join(127165.. | |||
| 2007-06-20 | SPAPB24D3.05c | after | I:complement(2954989.. | |||
| 2007-06-20 | SPAPB24D3.05c | before | I:complement(join(2954989.. | |||
| 2007-06-20 | SPBCPT2R1.07c | after | II:complement(4523274.. | |||
| 2007-06-20 | SPBCPT2R1.07c | before | II:complement(join(4523274.. | |||
| 2007-06-20 | SPCC18B5.02c | after | III:complement(717851.. | |||
| 2007-06-20 | SPCC18B5.02c | before | III:complement(join(717851.. | |||
| 2007-05-31 | SPAC29E6.04 | after | I:join(4409773.. | Sequence frameshifted at 4410192, | PMID:17035632 | |
| 2007-05-31 | SPAC29E6.04 | before | I:4409773..4410210 | Sequence frameshifted at 4410192, | PMID:17035632 | |
| 2007-04-12 | SPAC13G7.07 | after | I:join(2309026.. | changed second exon 3’ boundary and added C-terminal exons | PMID:17310250 | |
| 2007-04-12 | SPAC13G7.07 | before | I:join(2309026.. | changed second exon 3’ boundary and added C-terminal exons | PMID:17310250 | |
| 2007-03-12 | SPAC4H3.06 | after | I:join(3837449.. | |||
| 2007-03-12 | SPAC4H3.06 | before | I:join(3837431.. | |||
| 2007-01-11 | SPBP22H7.09c | mis15 | after | II:complement(join(1449715.. | updated sequence coordinates | PMID:15369671 |
| 2007-01-11 | SPBP22H7.09c | mis15 | before | II:complement(join(1449715.. | updated sequence coordinates | PMID:15369671 |
| 2006-12-18 | SPAPB17E12.08 | after | I:join(1280392.. | Improved homology | pers. comm. Val Wood | |
| 2006-12-18 | SPAPB17E12.08 | before | I:join(1280751.. | Improved homology | pers. comm. Val Wood | |
| 2006-12-18 | SPCC1223.10c | eaf1 | after | III:complement(join(1861667.. | Added exons | PMID:17150956 |
| 2006-12-18 | SPCC1223.10c | before | III:complement(join(1861667.. | Added exons | PMID:17150956 | |
| 2006-10-23 | SPCC18.01c | after | III:complement(1949478.. | |||
| 2006-10-23 | SPCC18.01c | before | III:complement(1949478.. | |||
| 2006-10-06 | SPBC30B4.08 | after | II:join(1321592.. | gene structure updated | PMID:16797182 | |
| 2006-10-06 | SPBC30B4.08 | before | II:join(1321592.. | gene structure updated | PMID:16797182 | |
| 2006-10-06 | SPCC18.01c | after | III:complement(1949478.. | |||
| 2006-10-06 | SPCC18.01c | before | III:complement(1949478.. | |||
| 2006-09-22 | SPBC409.12c | after | II:complement(join(1162796.. | N-terminal extended by 2 exons | pers. comm. C. Chahwan | |
| 2006-09-22 | SPBC409.12c | before | II:complement(1162796.. | N-terminal extended by 2 exons | pers. comm. C. Chahwan | |
| 2006-09-05 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-09-05 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-09-05 | SPAC12D12.09 | after | II:join(2315344.. | truncated penultimate exon to remove GIN and added new exon to insert KCIDIFGEF | pers. comm. Nicole Kosarek | |
| 2006-09-05 | SPAC12D12.09 | before | II:join(2315344.. | truncated penultimate exon to remove GIN and added new exon to insert KCIDIFGEF | pers. comm. Nicole Kosarek | |
| 2006-09-05 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-09-05 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-07-01 | SPAC1556.06 | after | I:join(3803451.. | |||
| 2006-07-01 | SPAC1556.06 | after | I:join(3805482.. | |||
| 2006-07-01 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-07-01 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-06-26 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-06-26 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-06-26 | SPAC21E11.05c | after | I:complement(join(4256629.. | |||
| 2006-06-26 | SPAC21E11.05c | before | I:complement(join(4256629.. | |||
| 2006-06-26 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | Improves Homology | pers. comm. Val Wood |
| 2006-06-26 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | Improves Homology | pers. comm. Val Wood |
| 2006-05-17 | SPAC1556.06 | after | I:join(3803451.. | |||
| 2006-05-17 | SPAC1556.06 | after | I:join(3805482.. | |||
| 2006-05-17 | SPAC21E11.05c | after | I:complement(join(4256629.. | Single base insertion allowed first 2 exons to be merged and extended (GAGT[G]GCA) | pers. comm. Trevor Pemberton (via Ivo Pedruzzi, | |
| 2006-05-17 | SPAC21E11.05c | before | I:complement(join(4255729.. | Single base insertion allowed first 2 exons to be merged and extended (GAGT[G]GCA) | pers. comm. Trevor Pemberton (via Ivo Pedruzzi, | |
| 2006-05-17 | SPAPB17E12.08 | after | I:join(1280751.. | |||
| 2006-05-17 | SPAPB17E12.08 | before | I:join(1279492.. | |||
| 2006-05-17 | SPAC12D12.09 | after | II:join(2315344.. | |||
| 2006-05-17 | SPAC12D12.09 | before | II:join(2313544.. | |||
| 2006-05-17 | SPBC30B4.08 | after | II:join(1321592.. | |||
| 2006-05-17 | SPBC30B4.08 | before | II:join(1320692.. | |||
| 2006-05-17 | SPBC409.12c | after | II:complement(1162796.. | |||
| 2006-05-17 | SPBC409.12c | before | II:complement(join(1161896.. | |||
| 2006-05-17 | SPBP22H7.09c | mis15 | after | II:complement(join(1449715.. | ||
| 2006-05-17 | SPBP22H7.09c | mis15 | before | II:complement(join(1448815.. | ||
| 2006-05-17 | SPCC1223.10c | after | III:complement(join(1861667.. | |||
| 2006-05-17 | SPCC1223.10c | eaf1 | before | III:complement(join(1860767.. | ||
| 2006-05-17 | SPCC4B3.05c | hem12 | after | III:join(1167471.. | ||
| 2006-05-17 | SPCC4B3.05c | hem12 | before | III:join(1166571.. | ||
| 2006-02-19 | SPAC1556.06 | before | I:join(3803451.. | |||
| 2006-02-19 | SPAC1556.06 | before | I:join(3805482.. | |||
| 2006-02-19 | SPAC1D4.11c | after | I:complement(656760.. | lengthened to 690 a.a. | PMID:12565823 | |
| 2006-02-19 | SPAC1D4.11c | before | I:complement(657660.. | lengthened to 690 a.a. | PMID:12565823 | |
| 2006-02-19 | SPAC21E11.05c | after | I:complement(join(4255729.. | |||
| 2006-02-19 | SPAC21E11.05c | before | I:complement(join(4256629.. | |||
| 2006-02-19 | SPAC6G9.13c | bqt1 | after | I:complement(join(3272150.. | Additional C terminal exon | PMID:16615890 |
| 2006-02-19 | SPAC6G9.13c | bqt1 | before | I:complement(3273294.. | Additional C terminal exon | PMID:16615890 |
| 2006-02-19 | SPAC9.05 | after | I:join(1471060.. | second intron acceptor extended by 15 bp | pers. comm. Anke Schürer | |
| 2006-02-19 | SPAC9.05 | before | I:join(1471960.. | second intron acceptor extended by 15 bp | pers. comm. Anke Schürer | |
| 2006-02-19 | SPAPB17E12.08 | after | I:join(1279492.. | |||
| 2006-02-19 | SPAPB17E12.08 | before | I:join(1280751.. | |||
| 2006-02-19 | SPAC12D12.09 | after | II:join(2313544.. | |||
| 2006-02-19 | SPAC12D12.09 | before | II:join(2315344.. | |||
| 2006-02-19 | SPBC16E9.16c | after | II:complement(join(1947985.. | |||
| 2006-02-19 | SPBC16E9.16c | before | II:complement(join(1949785.. | |||
| 2006-02-19 | SPBC30B4.08 | after | II:join(1320692.. | |||
| 2006-02-19 | SPBC30B4.08 | before | II:join(1321592.. | |||
| 2006-02-19 | SPBC3B9.22c | dad4 | after | II:complement(join(4006057.. | added new C-terminal exon based on Pfam protein family | Pfam |
| 2006-02-19 | SPBC3B9.22c | dad4 | before | II:complement(4007982.. | added new C-terminal exon based on Pfam protein family | Pfam |
| 2006-02-19 | SPBC409.12c | after | II:complement(join(1161896.. | |||
| 2006-02-19 | SPBC409.12c | before | II:complement(1162796.. | |||
| 2006-02-19 | SPBCPT2R1.08c | after | II:4526885..4532644 | truncated to 1919 a.a.; removed truncated version of a malate transporter fused to gene, | pers. comm. Liew Li Phing | |
| 2006-02-19 | SPBCPT2R1.08c | before | II:4528142..4534444 | truncated to 1919 a.a.; removed truncated version of a malate transporter fused to gene, | pers. comm. Liew Li Phing | |
| 2006-02-19 | SPBP22H7.09c | mis15 | after | II:complement(join(1448815.. | ||
| 2006-02-19 | SPBP22H7.09c | mis15 | before | II:complement(join(1449715.. | ||
| 2006-02-19 | SPCC1223.10c | eaf1 | after | III:complement(join(1860767.. | ||
| 2006-02-19 | SPCC1223.10c | before | III:complement(join(1861667.. | |||
| 2006-02-19 | SPCC4B3.05c | hem12 | after | III:join(1166571.. | ||
| 2006-02-19 | SPCC4B3.05c | hem12 | before | III:join(1167471.. | ||
| 2006-02-19 | SPCC4G3.05c | after | III:join(462720.. | added N terminal exon | pers. comm. Fred Kippert | |
| 2006-02-19 | SPCC4G3.05c | before | III:462996..464714 | added N terminal exon | pers. comm. Fred Kippert | |
| 2006-01-03 | SPAC17H9.20 | after | I:join(2037303.. | added intron at 37250.. | PMID:16207082 | |
| 2006-01-03 | SPAC17H9.20 | before | I:join(2037303.. | added intron at 37250.. | PMID:16207082 | |
| 2006-01-03 | SPAC31G5.06 | after | I:join(2997204.. | added N-teminal exon to extend prediction | pers. comm. Val Wood | |
| 2006-01-03 | SPAC31G5.06 | before | I:2997521..2997958 | added N-teminal exon to extend prediction | pers. comm. Val Wood | |
| 2006-01-03 | SPAC9E9.17c | after | I:complement(join(4438210.. | |||
| 2006-01-03 | SPAC9E9.17c | before | I:complement(join(4438210.. | |||
| 2006-01-03 | SPCC1223.15c | spc19 | after | III:complement(join(1847115.. | 4 amino acid extension at N-terminus | PMID:16079914 |
| 2006-01-03 | SPCC1223.15c | spc19 | before | III:complement(join(1847115.. | 4 amino acid extension at N-terminus | PMID:16079914 |
| 2005-07-05 | SPAC1093.04c | after | I:complement(join(4617361.. | |||
| 2005-07-05 | SPAC1093.04c | before | I:complement(join(4617361.. | |||
| 2005-07-05 | SPAC12G12.13c | after | I:322824..324878 | |||
| 2005-07-05 | SPAC12G12.13c | before | I:323028..324878 | |||
| 2005-07-05 | SPAC16A10.06c | nse2 | after | I:complement(join(3090483.. | ||
| 2005-07-05 | SPAC16A10.06c | before | I:complement(join(3090483.. | |||
| 2005-07-05 | SPAC16E8.10c | after | I:complement(join(3519794.. | |||
| 2005-07-05 | SPAC16E8.10c | before | I:complement(join(3519794.. | |||
| 2005-07-05 | SPAC26H5.02c | after | I:complement(join(4118187.. | second intron extended to 115 nt | pers. comm. Val Wood | |
| 2005-07-05 | SPAC26H5.02c | before | I:complement(join(4118248.. | second intron extended to 115 nt | pers. comm. Val Wood | |
| 2005-07-05 | SPAC3F10.11c | after | I:complement(2838168.. | |||
| 2005-07-05 | SPAC3F10.11c | before | I:complement(2838168.. | |||
| 2005-07-05 | SPBC20F10.04c | nse4 | after | II:complement(join(3291266.. | ||
| 2005-07-05 | SPBC20F10.04c | before | II:complement(join(3291517.. | |||
| 2005-07-05 | SPBC30D10.04 | after | II:complement(join(3092724.. | |||
| 2005-07-05 | SPBC30D10.04 | before | II:complement(3092724.. | |||
| 2005-07-05 | SPBC646.06c | agn2 | after | II:complement(933681.. | ||
| 2005-07-05 | SPBC646.06c | agn2 | before | II:complement(933759.. | ||
| 2005-07-05 | SPCC550.05 | after | III:join(1195097.. | |||
| 2005-07-05 | SPCC550.05 | before | III:1195097..1195708 | |||
| 2005-07-05 | SPCC553.07c | after | III:join(293444.. | |||
| 2005-07-05 | SPCC553.07c | before | III:join(293444.. | |||
| 2004-09-15 | SPAC1002.01 | after | I:join(1799247.. | |||
| 2004-09-15 | SPAC1002.01 | before | I:1799247..1799735 | |||
| 2004-09-15 | SPAC14C4.09 | agn1 | after | I:5245106..5246380 | ||
| 2004-09-15 | SPAC14C4.09 | before | I:5239924..5241132 | |||
| 2004-09-15 | SPAC16A10.04 | after | I:join(3087938.. | |||
| 2004-09-15 | SPAC16A10.04 | before | I:join(3087939.. | |||
| 2004-09-15 | SPAC27D7.12c | after | I:complement(4534416.. | extended N-terminal to use first MET as start | PMID:14623327 | |
| 2004-09-15 | SPAC27D7.12c | before | I:complement(4529168.. | extended N-terminal to use first MET as start | PMID:14623327 | |
| 2004-09-15 | SPAC29B12.08 | after | I:join(5429685.. | new N-terminal exon | pers. comm. Aengus Stewart | |
| 2004-09-15 | SPAC29B12.08 | before | I:5425074..5426723 | new N-terminal exon | pers. comm. Aengus Stewart | |
| 2004-09-15 | SPAC959.05c | after | I:complement(join(3396585.. | extended N-terminal to first methionine | pers. comm. Val Wood | |
| 2004-09-15 | SPAC959.05c | before | I:complement(join(3396586.. | extended N-terminal to first methionine | pers. comm. Val Wood | |
| 2004-09-15 | SPBC106.05c | tim11 | after | II:complement(join(384427.. | ||
| 2004-09-15 | SPBC106.05c | before | II:complement(join(384427.. | |||
| 2004-09-15 | SPBC15D4.02 | after | II:3015118..3016377 | trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better | pers. comm. Val Wood | |
| 2004-09-15 | SPBC15D4.02 | before | II:3014734..3016377 | trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better | pers. comm. Val Wood | |
| 2004-09-15 | SPBC16D10.07c | after | II:complement(join(3611446.. | |||
| 2004-09-15 | SPBC16D10.07c | before | II:complement(join(3611446.. | |||
| 2004-09-15 | SPBC25H2.10c | after | II:join(3268815.. | |||
| 2004-09-15 | SPBC25H2.10c | before | II:join(3268902.. | |||
| 2004-09-15 | SPBC30B4.01c | after | II:complement(1300391.. | |||
| 2004-09-15 | SPBC30B4.01c | before | II:complement(1300391.. | |||
| 2004-09-15 | SPBC428.01c | after | II:complement(join(440174.. | |||
| 2004-09-15 | SPBC428.01c | before | II:complement(join(440174.. | |||
| 2004-09-15 | SPCC1235.15 | after | III:join(215424.. | |||
| 2004-09-15 | SPCC1235.15 | before | III:join(215424.. | |||
| 2004-09-15 | SPCC622.17 | after | III:join(1436449.. | |||
| 2004-09-15 | SPCC622.17 | before | III:1436449..1437549 | |||
| 2004-09-15 | SPCC777.02 | after | III:join(1599881.. | |||
| 2004-09-15 | SPCC777.02 | before | III:join(1599881.. | |||
| 2003-08-14 | SPAC1093.03 | after | I:join(4609278.. | |||
| 2003-08-14 | SPAC1093.03 | before | I:4659816..4662520 | |||
| 2003-08-14 | SPAC11E3.03 | after | I:join(5281940.. | N terminal truncated, | PMID:12689592 | |
| 2003-08-14 | SPAC11E3.03 | before | I:join(5332334.. | N terminal truncated, | PMID:12689592 | |
| 2003-08-14 | SPAC16A10.04 | after | I:join(3087939.. | N-terminal exon replaced | PMID:12653963 | |
| 2003-08-14 | SPAC16A10.04 | before | I:join(3138406.. | N-terminal exon replaced | PMID:12653963 | |
| 2003-08-14 | SPAC186.04c | after | I:complement(5534225.. | |||
| 2003-08-14 | SPAC186.04c | before | I:complement(5584763.. | |||
| 2003-08-14 | SPAC1952.04c | after | I:complement(join(4967785.. | |||
| 2003-08-14 | SPAC1952.04c | before | I:complement(join(5018323.. | |||
| 2003-08-14 | SPAC19B12.06c | after | I:complement(join(4889750.. | added exon 18153.. | pers. comm. Val Wood | |
| 2003-08-14 | SPAC19B12.06c | before | I:complement(join(4940288.. | added exon 18153.. | pers. comm. Val Wood | |
| 2003-08-14 | SPAC212.05c | after | I:20824..21015 | |||
| 2003-08-14 | SPAC212.05c | before | I:complement(5634971.. | |||
| 2003-08-14 | SPAC22F3.03c | after | I:join(704689.. | 4th exon extended by altering acceptor in intron 3 cosmid coordinates 34092-33923 | pers. comm. Mike Catlett | |
| 2003-08-14 | SPAC22F3.03c | before | I:join(755227.. | 4th exon extended by altering acceptor in intron 3 cosmid coordinates 34092-33923 | pers. comm. Mike Catlett | |
| 2003-08-14 | SPAC23C4.08 | after | I:join(1042435.. | N-terminal exon removed | PMID:12653963 | |
| 2003-08-14 | SPAC23C4.08 | before | I:join(1092825.. | N-terminal exon removed | PMID:12653963 | |
| 2003-08-14 | SPAC29A4.14c | after | I:join(5115324.. | N-terminal extended | pers. comm. Val Wood | |
| 2003-08-14 | SPAC29A4.14c | before | I:join(5166209.. | N-terminal extended | pers. comm. Val Wood | |
| 2003-08-14 | SPAC2E12.05 | wtf1 | after | I:5059956..5061882 | ||
| 2003-08-14 | SPAC2E12.05 | before | I:5110970..5112025 | |||
| 2003-08-14 | SPAC31G5.07 | after | I:2998354..2999058 | N terminal extended to use longest ORF in the absence of homology | pers. comm. Henar Valdivieso Montero | |
| 2003-08-14 | SPAC31G5.07 | before | I:3049060..3049596 | N terminal extended to use longest ORF in the absence of homology | pers. comm. Henar Valdivieso Montero | |
| 2003-08-14 | SPBC1347.05c | after | II:complement(join(4071085.. | new C-terminal exon | pers. comm. Val Wood | |
| 2003-08-14 | SPBC1347.05c | before | II:complement(join(3989924.. | new C-terminal exon | pers. comm. Val Wood | |
| 2003-08-14 | SPBC19G7.18c | after | II:complement(join(2373872.. | |||
| 2003-08-14 | SPBC19G7.18c | before | II:complement(2292671.. | |||
| 2003-08-14 | SPBC530.06c | after | II:complement(join(800042.. | |||
| 2003-08-14 | SPBC530.06c | before | II:complement(join(718841.. | |||
| 2003-08-14 | SPBC577.05c | after | II:complement(join(758466.. | |||
| 2003-08-14 | SPBC577.05c | before | II:complement(join(677271.. | |||
| 2003-08-14 | SPBC6B1.09c | after | II:complement(join(2650545.. | additional intron 25664.. | pers. comm. Charly Chahwan | |
| 2003-08-14 | SPBC6B1.09c | before | II:complement(join(2569344.. | additional intron 25664.. | pers. comm. Charly Chahwan | |
| 2003-08-14 | SPBP23A10.04 | after | II:join(2002935.. | coordinates updated additional in-frame splice at 5325, | pers. comm. Hyun-Joo Yoon | |
| 2003-08-14 | SPBP23A10.04 | before | II:join(1921734.. | coordinates updated additional in-frame splice at 5325, | pers. comm. Hyun-Joo Yoon | |
| 2003-08-14 | SPCC320.13c | after | III:141662..142729 | trimmed to 2nd Met | PMID:12676091 | |
| 2003-08-14 | SPCC320.13c | before | III:141575..142729 | trimmed to 2nd Met | PMID:12676091 | |
| 2002-09-05 | SPAC1296.04 | after | I:join(766918.. | has 2 additional N-terminal exons | pers. comm. Val Wood | |
| 2002-09-05 | SPAC1296.04 | before | I:join(745694.. | has 2 additional N-terminal exons | pers. comm. Val Wood | |
| 2002-09-05 | SPAC23C11.10 | after | I:join(2202062.. | found 3 additional C-terminal exons by eye | pers. comm. Val Wood | |
| 2002-09-05 | SPAC23C11.10 | before | I:join(2180300.. | found 3 additional C-terminal exons by eye | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | after | I:complement(join(3995247.. | annotated as SPAC2F3.13c putative tRNA-ribosyltransferase, | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | after | I:complement(join(3995247.. | split to create SPAC2F3.13c and SPAC2F3.12c | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | before | I:complement(join(3972358.. | annotated as SPAC2F3.13c putative tRNA-ribosyltransferase, | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.13c | before | I:complement(join(3972358.. | split to create SPAC2F3.13c and SPAC2F3.12c | pers. comm. Val Wood | |
| 2002-09-05 | SPAC2F3.17c | after | I:complement(join(3994120.. | |||
| 2002-09-05 | SPAC2F3.17c | before | I:complement(3966826.. | |||
| 2002-09-05 | SPAPYUG7.06 | after | I:4800372..4800977 | |||
| 2002-09-05 | SPAPYUG7.06 | before | I:4779741..4780316 | |||
| 2002-09-05 | SPBPB21E7.01c | after | I:complement(58324.. | |||
| 2002-09-05 | SPBPB21E7.01c | before | I:complement(58324.. | |||
| 2002-09-05 | SPBC1604.17c | after | II:join(3820646.. | pers. comm. Val Wood | ||
| 2002-09-05 | SPBC1604.17c | before | II:join(3820235.. | pers. comm. Val Wood | ||
| 2002-09-05 | SPBC6B1.09c | after | II:complement(join(2569344.. | prediction extended by 4 N- terminal exons, | pers. comm. Val Wood | |
| 2002-09-05 | SPBC6B1.09c | before | II:complement(join(2569344.. | prediction extended by 4 N- terminal exons, | pers. comm. Val Wood | |
| 2002-09-05 | SPCC1442.13c | after | III:complement(join(1792096.. | C terminal exon added; new exon extends G-patch domain | pers. comm. Val Wood | |
| 2002-09-05 | SPCC1442.13c | before | III:complement(1792246.. | C terminal exon added; new exon extends G-patch domain | pers. comm. Val Wood | |
| 2002-09-05 | SPCC622.21 | after | III:join(1402430.. | |||
| 2002-09-05 | SPCC622.21 | before | III:join(1402430.. | |||
| 2002-09-05 | SPCC777.02 | after | III:join(1599881.. | |||
| 2002-09-05 | SPCC777.02 | before | III:1600406..1602073 | |||
| 2002-03-22 | SPAC1006.05c | after | I:complement(5104714.. | |||
| 2002-03-22 | SPAC1006.05c | before | I:complement(5071493.. | |||
| 2002-03-22 | SPAC1610.03c | after | I:complement(join(1822269.. | |||
| 2002-03-22 | SPAC1610.03c | before | I:complement(join(1803017.. | |||
| 2002-03-22 | SPAC1D4.11c | after | I:complement(686436.. | |||
| 2002-03-22 | SPAC1D4.11c | before | I:complement(667184.. | |||
| 2002-03-22 | SPAPB15E9.01c | after | I:complement(4011667.. | |||
| 2002-03-22 | SPAPB15E9.01c | before | I:complement(3980427.. | |||
| 2002-03-22 | SPAPB17E12.14c | after | I:complement(1316592.. | |||
| 2002-03-22 | SPAPB17E12.14c | before | I:complement(1297340.. | |||
| 2002-03-22 | SPBC1348.14c | after | I:complement(38587.. | |||
| 2002-03-22 | SPBC1348.14c | after | I:complement(38587.. | |||
| 2002-03-22 | SPBC1348.14c | before | I:complement(38587.. |
| Date | Systematic id | Primary name | Before / after change | Coordinates | Comment | Reference |
|---|---|---|---|---|---|---|
| 2022-12-21 | SPNCRNA.105 | after | II:4071111..4071312 | |||
| 2022-12-21 | SPNCRNA.105 | before | II:4071111..4071304 | |||
| 2022-12-20 | SPNCRNA.1597 | after | II:3391413..3393613 | |||
| 2022-12-20 | SPNCRNA.1597 | before | II:3390915..3393891 | |||
| 2022-12-20 | SPNCRNA.1674 | after | II:4129796..4130288 | EMBL:AU011806 | ||
| 2022-12-20 | SPNCRNA.1674 | before | II:4129574..4130925 | |||
| 2022-12-20 | SPNCRNA.5748 | prl102 | after | II:2626082..2626661 | PMID:28031482, | |
| 2022-12-20 | SPNCRNA.5748 | before | II:2625945..2626738 | PMID:29914874 | ||
| 2022-12-19 | SPNCRNA.1502 | after | II:2319366..2319746 | |||
| 2022-12-19 | SPNCRNA.1502 | before | II:2319348..2319746 | |||
| 2022-12-19 | SPNCRNA.848 | after | I:2738681..2740459 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.848 | before | I:2738026..2740228 | |||
| 2022-12-19 | SPNCRNA.865 | after | I:2957775..2959658 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.865 | before | I:2956805..2959658 | |||
| 2022-12-19 | SPNCRNA.893 | after | I:3177931..3178309 | |||
| 2022-12-19 | SPNCRNA.893 | before | I:3177931..3179269 | |||
| 2022-12-19 | SPNCRNA.985 | after | I:4400686..4401605 | PMID:18488015 | ||
| 2022-12-19 | SPNCRNA.985 | before | I:4400708..4401528 | |||
| 2022-12-12 | SPSNORNA.42 | snR90 | after | I:complement(join(4936907.. | ||
| 2022-12-12 | SPSNORNA.42 | snR90 | before | I:complement(4937170.. | ||
| 2022-08-26 | SPNCRNA.159 | after | I:776184..777243 | PMID:21511999 | ||
| 2022-08-26 | SPNCRNA.159 | before | I:776272..777066 | |||
| 2022-08-26 | SPNCRNA.159 | before | I:join(776272.. | |||
| 2022-05-25 | SPSNRNA.06 | snu6 | after | I:complement(join(2562276.. | Jennifer Porat flagged it | PMID:2909894 |
| 2022-05-25 | SPSNRNA.06 | snu6 | before | I:complement(join(2562276.. | Jennifer Porat flagged it | PMID:2909894 |
| 2022-05-25 | SPSNRNA.04 | snu4 | after | II:complement(467489.. | Jennifer Porat flagged it | PMID:2795654 |
| 2022-05-25 | SPSNRNA.04 | snu4 | before | II:complement(467233.. | Jennifer Porat flagged it | PMID:2795654 |
| 2022-05-24 | SPNCRNA.214 | ter1 | after | I:complement(join(3084610.. | PMID:19052544 | |
| 2022-05-24 | SPNCRNA.214 | ter1 | before | I:complement(3084610.. | ||
| 2021-01-21 | SPRPTCENB.11 | cnt2.1 | after | II:1620807..1627609 | ||
| 2021-01-21 | SPRPTCENB.11 | cnt2.1 | before | II:1620807..1624737 | ||
| 2020-05-05 | SPRRNA.01 | rnl | after | mitochondrial:1.. | PMID:29954949 | |
| 2020-05-05 | SPRRNA.01 | rnl | before | mitochondrial:1.. | ||
| 2020-05-05 | SPRRNA.02 | rns | after | mitochondrial:3133.. | PMID:29954949 | |
| 2020-05-05 | SPRRNA.02 | rns | before | mitochondrial:3132.. | ||
| 2020-04-30 | SPMITTRNAARG.01 | after | mitochondrial:9819.. | |||
| 2020-04-30 | SPMITTRNAARG.01 | before | mitochondrial:9818.. | |||
| 2020-04-30 | SPMITTRNAGLU.01 | after | mitochondrial:18406.. | |||
| 2020-04-30 | SPMITTRNAGLU.01 | before | mitochondrial:18404.. | |||
| 2020-04-30 | SPRRNA.01 | rnl | after | mitochondrial:1.. | ||
| 2020-04-30 | SPRRNA.01 | rnl | before | mitochondrial:1.. | ||
| 2020-04-30 | SPRRNA.02 | rns | after | mitochondrial:3132.. | ||
| 2020-04-30 | SPRRNA.02 | rns | before | mitochondrial:3131.. | ||
| 2020-01-09 | SPATRNAALA.06 | after | I:join(4796977.. | |||
| 2020-01-09 | SPATRNAALA.06 | before | I:4796977..4797059 | |||
| 2020-01-09 | SPATRNAARG.01 | after | I:join(3443055.. | |||
| 2020-01-09 | SPATRNAARG.01 | before | I:3443055..3443144 | |||
| 2020-01-09 | SPATRNAILE.02 | after | I:join(2578426.. | |||
| 2020-01-09 | SPATRNAILE.02 | before | I:2578426..2578524 | |||
| 2020-01-09 | SPATRNALEU.01 | after | I:complement(join(1527088.. | |||
| 2020-01-09 | SPATRNALEU.01 | before | I:complement(1527088.. | |||
| 2020-01-09 | SPATRNALEU.02 | after | I:complement(join(2802761.. | |||
| 2020-01-09 | SPATRNALEU.02 | before | I:complement(2802761.. | |||
| 2020-01-09 | SPATRNALEU.03 | after | I:join(3591948.. | |||
| 2020-01-09 | SPATRNALEU.03 | before | I:3591948..3592044 | |||
| 2020-01-09 | SPATRNALYS.01 | after | I:join(1704582.. | |||
| 2020-01-09 | SPATRNALYS.01 | before | I:1704582..1704664 | |||
| 2020-01-09 | SPATRNALYS.05 | after | I:join(3086310.. | |||
| 2020-01-09 | SPATRNALYS.05 | before | I:3086310..3086392 | |||
| 2020-01-09 | SPATRNAMET.02 | after | I:complement(join(1484979.. | |||
| 2020-01-09 | SPATRNAMET.02 | before | I:complement(1484979.. | |||
| 2020-01-09 | SPATRNAPRO.02 | spl1 | after | I:complement(join(1314924.. | ||
| 2020-01-09 | SPATRNAPRO.02 | spl1 | before | I:complement(1314924.. | ||
| 2020-01-09 | SPATRNASER.01 | after | I:join(1096369.. | |||
| 2020-01-09 | SPATRNASER.01 | before | I:1096369..1096466 | |||
| 2020-01-09 | SPATRNATYR.01 | after | I:join(1746464.. | |||
| 2020-01-09 | SPATRNATYR.01 | before | I:1746464..1746547 | |||
| 2020-01-09 | SPATRNAVAL.03 | after | I:complement(join(2214733.. | |||
| 2020-01-09 | SPATRNAVAL.03 | before | I:complement(2214733.. | |||
| 2020-01-09 | SPATRNAVAL.04 | after | I:complement(join(3710739.. | |||
| 2020-01-09 | SPATRNAVAL.04 | before | I:complement(3710739.. | |||
| 2020-01-09 | SPBTRNAMET.04 | after | II:join(658451.. | |||
| 2020-01-09 | SPBTRNAMET.04 | before | II:658451..658531 | |||
| 2020-01-09 | SPBTRNAVAL.06 | after | II:complement(join(1619174.. | |||
| 2020-01-09 | SPBTRNAVAL.06 | before | II:complement(1619174.. | |||
| 2020-01-09 | SPCTRNALYS.10 | after | III:join(1071093.. | |||
| 2020-01-09 | SPCTRNALYS.10 | before | III:1071093..1071175 | |||
| 2020-01-09 | SPCTRNASER.11 | sup9 | after | III:join(1689713.. | ||
| 2020-01-09 | SPCTRNASER.11 | sup9 | before | III:1689713..1689809 | ||
| 2019-11-08 | SPNCRNA.103 | sme2 | after | II:complement(339346.. | PMID:24920274 | |
| 2019-11-08 | SPNCRNA.103 | sme2 | before | II:complement(339346.. | PMID:24920274 | |
| 2018-08-05 | SPBC8E4.02c | prt2 | after | II:4442542..4445970 | ||
| 2018-08-05 | SPBC8E4.02c | prt2 | before | II:4443155..4443544 | ||
| 2017-07-11 | SPNCRNA.1702 | prl104 | after | I:complement(5533986.. | ||
| 2017-07-11 | SPNCRNA.1702 | prl104 | before | I:5533986..5534754 | ||
| 2017-07-11 | SPNCRNA.1706 | prl106 | after | III:complement(935629.. | ||
| 2017-07-11 | SPNCRNA.1706 | prl106 | before | III:935629..936790 | ||
| 2017-07-07 | SPNCRNA.1702 | prl104 | after | I:5533986..5534754 | ||
| 2017-07-07 | SPNCRNA.1702 | prl104 | before | I:5533986..5534794 | ||
| 2017-05-16 | SPSNORNA.41 | snR46 | after | III:complement(1717920.. | Switched from + strand to - strand | pers. comm. Francois Bachand |
| 2017-05-16 | SPSNORNA.41 | snR46 | before | III:1717920..1718087 | Switched from + strand to - strand | pers. comm. Francois Bachand |
| 2014-11-06 | SPNCRNA.287 | after | II:complement(21060.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.287 | before | II:21025..21701 | |||
| 2014-11-06 | SPNCRNA.291 | after | II:complement(103165.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.291 | before | II:103208..104381 | |||
| 2014-11-06 | SPNCRNA.293 | after | II:120577..121643 | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.293 | before | II:120652..121497 | |||
| 2014-11-06 | SPNCRNA.316 | after | II:complement(591798.. | PMID:21511999 | ||
| 2014-11-06 | SPNCRNA.316 | before | II:591646..592613 | |||
| 2014-10-21 | SPATRNASER.03 | after | I:join(4265149.. | |||
| 2014-10-21 | SPATRNASER.03 | before | I:4265149..4265245 | |||
| 2014-08-07 | SPSNORNA.25 | snoZ30 | after | II:2044411..2044505 | ||
| 2014-08-07 | SPSNORNA.25 | snoZ30 | before | II:2044273..2044572 | ||
| 2014-07-25 | SPSNRNA.02 | snu2 | after | I:complement(959370.. | ||
| 2014-07-25 | SPSNRNA.02 | snu2 | before | I:complement(959370.. | ||
| 2014-06-19 | SPSNRNA.02 | snu2 | after | I:complement(959370.. | represents the actual functional RNA | PMID:3244367, |
| 2014-06-19 | SPSNRNA.02 | snu2 | before | I:complement(959305.. | represents the actual functional RNA | PMID:3244367 |
| 2014-06-19 | SPSNRNA.03 | snu3 | after | I:complement(987570.. | represents the actual functional RNA | PMID:3194197, |
| 2014-06-19 | SPSNRNA.03 | snu3 | before | I:complement(987631.. | represents the actual functional RNA | PMID:3194197 |
| 2014-06-19 | SPSNRNA.06 | snu6 | after | I:complement(join(2562276.. | represents the actual functional RNA | PMID:2909894, |
| 2014-06-19 | SPSNRNA.06 | snu6 | before | I:complement(join(2562085.. | represents the actual functional RNA | PMID:2909894 |
| 2014-06-19 | SPSNRNA.01 | snu1 | after | II:3020205..3020353 | represents the actual functional RNA | PMID:2188102, |
| 2014-06-19 | SPSNRNA.01 | snu1 | before | II:3019819..3020472 | represents the actual functional RNA | PMID:2188102 |
| 2014-06-19 | SPSNRNA.04 | snu4 | after | II:complement(467233.. | represents the actual functional RNA | PMID:2795654, |
| 2014-06-19 | SPSNRNA.04 | snu4 | before | II:complement(467025.. | represents the actual functional RNA | PMID:2795654 |
| 2014-06-19 | SPSNRNA.05 | snu5 | after | II:3236867..3236986 | represents the actual functional RNA | PMID:2587274, |
| 2014-06-19 | SPSNRNA.05 | snu5 | before | II:3236617..3237051 | represents the actual functional RNA | PMID:2587274 |
| 2014-06-19 | SPSNRNA.07 | snu32 | after | II:complement(3958832.. | represents the actual functional RNA | PMID:1560765, |
| 2014-06-19 | SPSNRNA.07 | snu32 | before | II:complement(3958768.. | represents the actual functional RNA | PMID:1560765 |
| 2014-06-12 | SPNCRNA.98 | srp7 | after | I:4268662..4268916 | represents the actual functional RNA | PMID:2837764, |
| 2014-06-12 | SPNCRNA.98 | srp7 | before | I:4268566..4269064 | represents the actual functional RNA | PMID:2837764, |
| 2013-08-13 | SPNCRNA.84 | after | I:complement(3753160.. | |||
| 2013-08-13 | SPNCRNA.84 | before | I:complement(3753160.. | |||
| 2013-08-13 | SPNCRNA.95 | after | I:3789400..3789948 | EMBL:AU010014, | ||
| 2013-08-13 | SPNCRNA.95 | before | I:3789400..3789821 | EMBL:SPC0079 | ||
| 2013-08-09 | SPNCRNA.95 | after | I:3789400..3789821 | |||
| 2013-08-09 | SPNCRNA.95 | before | I:3789585..3789948 | |||
| 2013-02-07 | SPNCRNA.1572 | after | II:3008602..3011490 | |||
| 2013-02-07 | SPNCRNA.1572 | before | II:3008602..3011536 | |||
| 2012-08-06 | SPNCRNA.304 | after | II:complement(360439.. | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.304 | before | II:complement(360425.. | |||
| 2012-08-06 | SPNCRNA.322 | after | II:674049..676227 | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.322 | before | II:674078..676143 | |||
| 2012-08-06 | SPNCRNA.438 | after | II:complement(4194849.. | PMID:21511999 | ||
| 2012-08-06 | SPNCRNA.438 | before | II:complement(4194849.. | |||
| 2012-02-02 | SPBTRNASER.06 | after | II:join(3350594.. | |||
| 2012-02-02 | SPBTRNASER.06 | before | II:3350594..3350688 | |||
| 2011-08-29 | SPNCRNA.511 | after | III:2011026..2012559 | PMID:21511999 | ||
| 2011-08-29 | SPNCRNA.511 | before | III:2011061..2012433 | |||
| 2011-08-29 | SPNCRNA.519 | after | III:2362179..2362725 | PMID:21511999 | ||
| 2011-08-29 | SPNCRNA.519 | before | III:2362248..2362743 | |||
| 2011-08-29 | SPNCRNA.67 | prl67 | after | III:1431135..1433068 | PMID:21511999 | |
| 2011-08-29 | SPNCRNA.67 | prl67 | before | III:1432003..1432625 | ||
| 2011-08-23 | SPNCRNA.388 | after | II:2115592..2117167 | PMID:21511999 | ||
| 2011-08-23 | SPNCRNA.388 | before | II:2115667..2117167 | |||
| 2011-08-22 | SPBTRNAARG.05 | after | II:complement(join(1160893.. | |||
| 2011-08-22 | SPBTRNAARG.05 | before | II:complement(1160893.. | |||
| 2011-08-22 | SPBTRNALEU.05 | after | II:complement(join(1402444.. | |||
| 2011-08-22 | SPBTRNALEU.05 | before | II:complement(1402444.. | |||
| 2011-08-22 | SPBTRNALEU.06 | after | II:complement(join(1598745.. | |||
| 2011-08-22 | SPBTRNALEU.06 | before | II:complement(1598745.. | |||
| 2011-08-22 | SPBTRNALEU.07 | after | II:complement(join(1644083.. | |||
| 2011-08-22 | SPBTRNALEU.07 | before | II:complement(1644083.. | |||
| 2011-08-22 | SPBTRNALYS.07 | after | II:join(1599706.. | |||
| 2011-08-22 | SPBTRNALYS.07 | before | II:1599706..1599788 | |||
| 2011-08-22 | SPBTRNALYS.08 | after | II:join(1645044.. | |||
| 2011-08-22 | SPBTRNALYS.08 | before | II:1645044..1645126 | |||
| 2011-08-22 | SPBTRNALYS.09 | after | II:join(3814134.. | |||
| 2011-08-22 | SPBTRNALYS.09 | before | II:3814134..3814216 | |||
| 2011-08-22 | SPBTRNAMET.05 | after | II:complement(join(1598075.. | |||
| 2011-08-22 | SPBTRNAMET.05 | before | II:complement(1598075.. | |||
| 2011-08-22 | SPBTRNATYR.02 | after | II:join(1598511.. | |||
| 2011-08-22 | SPBTRNATYR.02 | before | II:1598511..1598594 | |||
| 2011-08-22 | SPBTRNATYR.03 | after | II:join(1643849.. | |||
| 2011-08-22 | SPBTRNATYR.03 | before | II:1643849..1643932 | |||
| 2011-08-22 | SPBTRNATYR.04 | after | II:join(3814558.. | |||
| 2011-08-22 | SPBTRNATYR.04 | before | II:3814558..3814641 | |||
| 2011-08-22 | SPBTRNAVAL.05 | after | II:complement(join(1600967.. | |||
| 2011-08-22 | SPBTRNAVAL.05 | before | II:complement(1600967.. | |||
| 2011-08-22 | SPBTRNAVAL.07 | after | II:join(1629159.. | |||
| 2011-08-22 | SPBTRNAVAL.07 | before | II:1629159..1629241 | |||
| 2011-08-22 | SPBTRNAVAL.08 | after | II:complement(join(1646305.. | |||
| 2011-08-22 | SPBTRNAVAL.08 | before | II:complement(1646305.. | |||
| 2011-08-22 | SPNCRNA.111 | after | II:complement(3978331.. | PMID:21511999 | ||
| 2011-08-22 | SPNCRNA.111 | before | II:complement(3978616.. | |||
| 2011-08-22 | SPCTRNALEU.12 | after | III:complement(join(1096085.. | |||
| 2011-08-22 | SPCTRNALEU.12 | before | III:complement(1096085.. | |||
| 2011-08-22 | SPCTRNALEU.13 | after | III:join(1102809.. | |||
| 2011-08-22 | SPCTRNALEU.13 | before | III:1102809..1102909 | |||
| 2011-08-22 | SPCTRNALYS.11 | after | III:complement(join(1139536.. | |||
| 2011-08-22 | SPCTRNALYS.11 | before | III:complement(1139536.. | |||
| 2011-08-22 | SPCTRNALYS.12 | after | III:join(1475034.. | |||
| 2011-08-22 | SPCTRNALYS.12 | before | III:1475034..1475116 | |||
| 2011-08-22 | SPCTRNASER.10 | after | III:join(1253193.. | |||
| 2011-08-22 | SPCTRNASER.10 | before | III:1253193..1253287 | |||
| 2011-08-22 | SPCTRNASER.13 | after | III:join(2072080.. | |||
| 2011-08-22 | SPCTRNASER.13 | before | III:2072080..2072174 | |||
| 2011-08-22 | SPCTRNAVAL.09 | after | III:join(1092934.. | |||
| 2011-08-22 | SPCTRNAVAL.09 | before | III:1092934..1093016 | |||
| 2011-08-22 | SPCTRNAVAL.10 | after | III:complement(join(1105978.. | |||
| 2011-08-22 | SPCTRNAVAL.10 | before | III:complement(1105978.. | |||
| 2011-08-22 | SPCTRNAVAL.12 | after | III:complement(join(1065778.. | |||
| 2011-08-22 | SPCTRNAVAL.12 | before | III:complement(1065778.. | |||
| 2011-03-24 | SPBTRNAASP.03 | after | II:1602188..1602260 | |||
| 2011-03-24 | SPBTRNAASP.03 | before | II:complement(1602347.. | |||
| 2010-05-20 | SPNCRNA.304 | after | II:complement(360425.. | |||
| 2010-05-20 | SPNCRNA.304 | before | II:360425..362854 | |||
| 2010-02-17 | SPSNORNA.29 | sno52 | after | I:complement(339548.. | ||
| 2010-02-17 | SPSNORNA.29 | sno52 | before | I:339548..339642 | ||
| 2010-01-29 | SPSNORNA.42 | snR90 | after | I:complement(4937170.. | ||
| 2010-01-29 | SPSNORNA.42 | snR90 | before | I:complement(4937237.. | ||
| 2010-01-29 | SPNCRNA.585 | after | III:complement(2010261.. | |||
| 2010-01-29 | SPNCRNA.585 | before | III:complement(2010261.. | |||
| 2009-10-23 | SPNCRNA.53 | prl53 | after | I:complement(4008054.. | EMBL:AB084861, | |
| 2009-10-23 | SPNCRNA.53 | prl53 | before | I:4008172..4008681 | ||
| 2009-08-19 | SPNCRNA.223 | after | I:complement(3534486.. | |||
| 2009-08-19 | SPNCRNA.223 | before | I:3534486..3536133 | |||
| 2008-12-10 | SPNCRNA.31 | prl31 | after | I:2975608..2976007 | ||
| 2008-12-10 | SPNCRNA.31 | prl31 | before | I:complement(2975608.. | ||
| 2008-09-22 | SPNCRNA.445 | snoR61 | after | II:complement(join(3874254.. | updated to extend 3’ and added splice and identified as snR6 | pers. comm. J. Matthews |
| 2008-09-22 | SPNCRNA.445 | before | II:complement(3874378.. | updated to extend 3’ and added splice and identified as snR6 | pers. comm. J. Matthews | |
| 2007-12-19 | SPNCRNA.25 | prl25 | after | II:complement(2567830.. | ||
| 2007-12-19 | SPNCRNA.25 | prl25 | before | II:2567830..2568256 | ||
| 2007-04-12 | SPNCRNA.92 | after | I:3875656..3876105 | |||
| 2007-04-12 | SPNCRNA.92 | before | I:complement(3875656.. | |||
| 2007-02-26 | SPNCRNA.82 | mrp1 | after | I:1234451..1234849 | upon realisation that this corresponded to RNase MRP | pers. comm. Val Wood, |
| 2007-02-26 | SPNCRNA.82 | before | I:1234705..1234837 | upon realisation that this corresponded to RNase MRP | pers. comm. Val Wood | |
| 2006-09-05 | SPRRNA.31 | after | II:784153..784398 | |||
| 2006-09-05 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-07-01 | SPRRNA.31 | after | II:784199..784398 | |||
| 2006-07-01 | SPRRNA.31 | before | II:784153..784398 | |||
| 2006-06-26 | SPRRNA.31 | after | II:784153..784398 | |||
| 2006-06-26 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-05-17 | SPNCRNA.82 | after | I:1235605..1235737 | |||
| 2006-05-17 | SPNCRNA.82 | mrp1 | before | I:1234451..1234849 | EMBL:EF424786, | |
| 2006-05-17 | SPRRNA.31 | after | II:784199..784398 | |||
| 2006-05-17 | SPRRNA.31 | before | II:783253..783498 | |||
| 2006-02-19 | SPNCRNA.82 | mrp1 | after | I:1234451..1234849 | EMBL:EF424786, | |
| 2006-02-19 | SPNCRNA.82 | before | I:1235605..1235737 | |||
| 2006-02-19 | SPRRNA.31 | after | II:783253..783498 | |||
| 2006-02-19 | SPRRNA.31 | before | II:784199..784398 | |||
| 2006-01-03 | SPATRNALYS.04 | after | I:complement(join(2685583.. | |||
| 2006-01-03 | SPATRNALYS.04 | before | I:complement(2685583.. | |||
| 2006-01-03 | SPSNRNA.06 | snu6 | after | I:complement(join(2562985.. | RFAM:RF00026 | |
| 2006-01-03 | SPSNRNA.06 | snu6 | before | I:complement(join(2562985.. | RFAM:00026 | |
| 2006-01-03 | SPNCRNA.131 | tos2 | after | III:1549249..1549797 | ||
| 2006-01-03 | SPNCRNA.131 | tos2 | before | III:1547624..1548172 | ||
| 2006-01-03 | SPNCRNA.132 | tos3 | after | III:1547677..1548889 | ||
| 2006-01-03 | SPNCRNA.132 | tos3 | before | III:1548532..1549744 | ||
| 2006-01-03 | SPNCRNA.69 | tos1 | after | III:1548828..1550437 | ||
| 2006-01-03 | SPNCRNA.69 | tos1 | before | III:1546984..1548593 | ||
| 2005-07-05 | SPNCRNA.86 | after | I:complement(1358711.. | EMBL:AU010322 | ||
| 2005-07-05 | SPNCRNA.86 | before | I:complement(join(1358711.. | |||
| 2005-07-05 | SPSNRNA.06 | snu6 | after | I:complement(join(2562985.. | EMBL:X14196, | |
| 2005-07-05 | SPSNRNA.06 | U6snRNA | before | I:complement(2562985.. | ||
| 2004-09-15 | SPNCRNA.03 | prl3 | after | I:complement(237974.. | ||
| 2004-09-15 | SPNCRNA.03 | before | I:complement(237974.. | |||
| 2003-08-14 | SPBTRNALEU.09 | after | II:complement(3210939.. | |||
| 2003-08-14 | SPBTRNALEU.09 | before | II:complement(2688856.. | |||
| 2003-08-14 | SPBTRNALEU.10 | after | II:3915843..3915921 | |||
| 2003-08-14 | SPBTRNALEU.10 | before | II:complement(3129738.. | |||
| 2003-08-14 | SPBTRNALYS.08 | after | II:1646844..1646926 | |||
| 2003-08-14 | SPBTRNALYS.08 | before | II:3734733..3734815 | |||
| 2003-08-14 | SPCTRNALEU.12 | after | III:complement(1096985.. | |||
| 2003-08-14 | SPCTRNALEU.12 | before | III:1069166..1069244 | |||
| 2003-08-14 | SPCTRNASER.09 | after | III:1066628..1066709 | |||
| 2003-08-14 | SPCTRNASER.09 | before | III:1690613..1690709 | |||
| 2003-08-14 | SPCTRNASER.10 | after | III:1254093..1254187 | |||
| 2003-08-14 | SPCTRNASER.10 | before | III:complement(1776892.. | |||
| 2003-08-14 | SPCTRNASER.11 | after | III:1690613..1690709 | |||
| 2003-08-14 | SPCTRNASER.11 | before | III:2072980..2073074 | |||
| 2002-09-05 | SPBTRNAPRO.07 | after | II:2860314..2860385 | |||
| 2002-09-05 | SPBTRNAPRO.07 | after | II:complement(3281118.. | |||
| 2002-09-05 | SPCTRNAGLY.10 | after | III:2038252..2038322 | |||
| 2002-09-05 | SPCTRNAGLY.10 | after | III:complement(113716.. |
| Genome overview | Graphic and basic information about each chromosome |
| Sequencing status | Contig size, gap status and progress, including centromeres and telomeres |
| Sequence updates | Changes to the genome sequence since July 2003 |
| Sequence updates pending | Pending changes, mainly from the Broad Institute, some supported by data from other sources |
| Gene coordinate changes | Changes to coordinates of individual genes since publication |
| New and removed genes | Genes identified or removed since publication |
| Gene characterisation | Current counts of protein coding gene status, as published in small scale experiments |
| Historical gene characterisation | Changes in gene characterisation statistics over time |
| Genome statistics | Information on the status of the genome (Note: Last updated January 2017) |
| Priority unstudied genes | Unstudied nuclear-encoded protein-coding genes conserved 1:1 in human |
| Unmapped genes | List of genes identified genetically but not cloned or physically mapped |
Note: Many older S. pombe sequence submissions to the DNA databases (International Nucleotide Sequence Database Collaboration databases, i.e. ENA, GenBank, DDBJ) contain one or more errors, and we do not have the resources to maintain past sequences or flag every error in PomBase.
The S. pombe mating type loci are located on Chromosome 2. The reference strain 972 h- encodes the M-specific mating genes II:2114008-2115135 at the expressed mat1 locus. The silent region mat3M is located at coordinates II:2129208-2137121. Note that the silent mat2P region and cenH element are deleted in the reference strain.
A contig of the h90 configuration of the mat2P-mat3M region was created by Xavier Marsellach and Lorena Aguilar (Azorín lab) using available data and S. pombe var. kambucha as a scaffold. The contig can be viewed in the genome browser. Replacing the Chromosome 2 region spanning coordinates 2129208-2137121 with the separate contig sequence yields the Chromosome 2 contig of an h90 strain.
For a description of how the mating type specific genes are organized and annotated in PomBase, see this FAQ item.
For a detailed description of the S. pombe mating type region, please see the online tutorial provided by the Nielsen lab (external link).
| Systematic id | Primary name | Date added | Comment | Reference |
|---|---|---|---|---|
| SPAC144.19 | prl46 | 2020-09-09 | PMID:32594847 | |
| SPCC4G3.20 | 2016-04-10 | PMID:24929437 | ||
| SPAPB1A11.06 | 2016-03-17 | previously SPNCRNA.31 | PMID:26494834 | |
| SPCC1840.13 | 2016-03-17 | PMID:24929437 | ||
| SPAC29A4.23 | 2015-11-28 | PMID:26494834 | ||
| SPAC11D3.20 | 2015-11-28 | PMID:26494834 | ||
| SPBC3B8.10 | ina17 | 2015-11-28 | PMID:25883323, | |
| SPAC110.06 | 2014-07-04 | identified by ribosome profiling. F1F0 ATPase synthase peripheral stalk assembly factor Ina17 (predicted) | PMID:24929437, | |
| SPAC823.17 | 2014-07-04 | identified by ribosome profiling | PMID:24929437 | |
| SPBC713.14c | 2014-07-04 | identified by ribosome profiling | PMID:24929437 | |
| SPCC18.20 | 2011-05-09 | PMID:21511999 | ||
| SPAC1071.13 | 2011-03-24 | PMID:21511999 | ||
| SPBC1685.17 | 2011-03-24 | PMID:24929437 | ||
| SPAC9G1.14 | 2011-03-24 | PMID:21511999 | ||
| SPACUNK4.20 | 2011-03-24 | PMID:21511999 | ||
| SPAPB15E9.06 | 2011-03-24 | PMID:21511999 | ||
| SPAPJ695.02 | 2011-03-24 | PMID:21511999 | ||
| SPBC1348.15 | 2011-03-24 | PMID:21511999 | ||
| SPBC13G1.16 | 2011-03-24 | PMID:30925937 | ||
| SPBC16E9.20 | 2011-03-24 | PMID:21511999 | ||
| SPBC19G7.19 | 2011-03-24 | PMID:21511999 | ||
| SPBC21B10.14 | ymr31 | 2011-03-24 | PMID:21511999 | |
| SPBC21B10.15 | 2011-03-24 | PMID:21511999 | ||
| SPBC25H2.18 | cox20 | 2011-03-24 | PMID:21511999 | |
| SPBC2A9.14 | 2011-03-24 | PMID:21511999 | ||
| SPBC2F12.17 | cox7 | 2011-03-24 | PMID:21511999 | |
| SPAC977.18 | 2011-03-24 | PMID:21511999 | ||
| SPAC959.11 | 2011-03-24 | PMID:21511999 | ||
| SPAC922.09 | 2011-03-24 | PMID:21511999 | ||
| SPAC8E11.12 | 2011-03-24 | PMID:21511999 | ||
| SPAC4H3.17 | 2011-03-24 | PMID:21511999 | ||
| SPAC4H3.16 | 2011-03-24 | PMID:21511999 | ||
| SPAC3F10.19 | spd2 | 2011-03-24 | PMID:21511999 | |
| SPAC343.21 | 2011-03-24 | PMID:21511999 | ||
| SPAC2H10.04 | 2011-03-24 | PMID:21511999 | ||
| SPAC29A4.22 | 2011-03-24 | PMID:21511999 | ||
| SPAC25B8.20 | 2011-03-24 | PMID:21511999, | ||
| SPAC1B2.06 | 2011-03-24 | PMID:21511999 | ||
| SPAC19A8.16 | prl65 | 2011-03-24 | PMID:21511999 | |
| SPAC1834.13 | 2011-03-24 | PMID:21511999 | ||
| SPAC17A5.19 | 2011-03-24 | PMID:21511999 | ||
| SPAC1399.06 | 2011-03-24 | PMID:21511999 | ||
| SPAC11D3.19 | 2011-03-24 | PMID:21511999 | ||
| SPBC30B4.09 | 2011-03-24 | PMID:21511999, | ||
| SPBC32H8.15 | 2011-03-24 | PMID:21511999 | ||
| SPBC336.16 | 2011-03-24 | PMID:21511999 | ||
| SPBP23A10.17 | 2011-03-24 | PMID:21511999 | ||
| SPCPB16A4.07 | 2011-03-24 | PMID:21511999, | ||
| SPCC794.16 | 2011-03-24 | |||
| SPCC663.18 | 2011-03-24 | PMID:21511999 | ||
| SPCC417.16 | 2011-03-24 | PMID:21511999 | ||
| SPCC188.14 | 2011-03-24 | PMID:21511999 | ||
| SPCC1259.16 | 2011-03-24 | PMID:21511999 | ||
| SPCC1235.18 | 2011-03-24 | PMID:21511999 | ||
| SPCC1235.17 | 2011-03-24 | PMID:21511999 | ||
| SPBPB21E7.11 | 2011-03-24 | PMID:21511999 | ||
| SPBP8B7.32 | 2011-03-24 | PMID:21511999 | ||
| SPBP35G2.17 | 2011-03-24 | PMID:21511999 | ||
| SPAC1093.07 | 2011-03-24 | PMID:21511999 | ||
| SPBC409.23 | tam7 | 2011-02-04 | PMID:21270388 | |
| SPBC1105.19 | tam12 | 2011-02-04 | PMID:21270388 | |
| SPBC3H7.18 | tam8 | 2011-02-04 | PMID:21270388 | |
| SPBC839.20 | new14 | 2011-02-04 | PMID:21270388 | |
| SPBC24C6.13 | new16 | 2011-02-04 | PMID:21270388 | |
| SPBC839.19 | new20 | 2011-02-04 | PMID:21270388 | |
| SPBC1711.18 | tam9 | 2011-02-04 | PMID:21270388 | |
| SPBC17D1.17 | tam11 | 2011-02-04 | PMID:21270388 | |
| SPBC14C8.19 | tam10 | 2011-02-04 | PMID:21270388 | |
| SPBC530.16 | ksh1 | 2011-02-04 | PMID:21270388 | |
| SPBC56F2.15 | tam13 | 2011-02-04 | PMID:21270388 | |
| SPBC30D10.21 | new18 | 2011-02-04 | PMID:21270388 | |
| SPBC32F12.16 | new17 | 2011-02-04 | PMID:21270388 | |
| SPAC1486.11 | fmc1 | 2011-02-04 | PMID:21270388 | |
| SPAC3H5.13 | new4 | 2011-02-04 | PMID:21270388 | |
| SPAC15A10.17 | coa2 | 2011-02-04 | PMID:21270388 | |
| SPAC3G9.17 | new8 | 2011-02-04 | PMID:21270388 | |
| SPAC6B12.19 | rsa3 | 2011-02-04 | PMID:21270388 | |
| SPAC4D7.14 | new13 | 2011-02-04 | PMID:21270388 | |
| SPBC887.22 | new19 | 2011-02-04 | PMID:21270388 | |
| SPAC4D7.15 | new12 | 2011-02-04 | PMID:21270388 | |
| SPAC23A1.20 | new11 | 2011-02-04 | PMID:21270388 | |
| SPAC222.19 | tam1 | 2011-02-04 | PMID:21270388 | |
| SPAC1F7.14c | tam6 | 2011-02-04 | PMID:21270388 | |
| SPAC1B3.21 | tam3 | 2011-02-04 | PMID:21270388 | |
| SPAC16E8.18c | tam5 | 2011-02-04 | PMID:21270388 | |
| SPAC19G12.17 | new10 | 2011-02-04 | PMID:21270388 | |
| SPBC8D2.23 | new15 | 2011-02-04 | PMID:21270388 | |
| SPAC4F10.22 | cmc4 | 2011-02-04 | PMID:21270388 | |
| SPAC17G8.15 | new1 | 2011-02-04 | PMID:21270388 | |
| SPCC330.20 | tam14 | 2011-02-04 | PMID:21270388 | |
| SPCC330.21 | new25 | 2011-02-04 | PMID:21270388 | |
| SPCC4B3.20 | cmc2 | 2011-02-04 | PMID:21270388 | |
| SPAC1805.18 | new2 | 2011-02-04 | PMID:21270388 | |
| SPCP20C8.04 | new22 | 2011-02-04 | PMID:21270388 | |
| SPAC926.10 | new9 | 2011-02-04 | PMID:21270388 | |
| SPCC18.19c | ost5 | 2010-05-20 | first 2 exons may be incorrect, | pers. comm. Val Wood |
| SPAC9G1.15c | mzt1 | 2010-05-20 | PMID:21270388 | |
| SPBC3E7.17 | 2010-01-29 | |||
| SPBP35G2.16c | ecl2 | 2009-05-01 | PMID:19352039 | |
| SPBC8E4.12c | ecl3 | 2009-05-01 | PMID:19352039 | |
| SPCC1235.16 | vma21 | 2009-05-01 | pers. comm. Juan Mata | |
| SPAC12G12.17 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC167.09 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAP4C9.02 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPBC1604.25 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAPB1E7.14 | iec5 | 2008-05-12 | Solexa prediction | PMID:18488015 |
| SPAC6F6.19 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC57A7.15c | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPBC29A10.17 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPBC26H8.16 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC688.16 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPCC1442.19 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPCC16C4.22 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPCC569.09 | 2008-05-12 | sequence orphan; longest reading frome in solexa transcript SPNG2623. Solexa prediction | PMID:18488015 | |
| SPCC70.12c | ecl1 | 2008-05-12 | extender of the chronological lifespan protein Ecl1. Solexa prediction | PMID:18422613, |
| SPCC757.15 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC20G4.09 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC4G9.22 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC27E2.14 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC25H1.10c | atp19 | 2008-05-12 | Solexa prediction | PMID:18488015 |
| SPAC23H4.21 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC212.12 | 2008-05-12 | PMID:21511999 | ||
| SPAC23D3.17 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC23D3.16 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC22F3.15 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC227.19c | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC222.18 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPAC222.17 | 2008-05-12 | Solexa prediction | PMID:18488015 | |
| SPBC16C6.14 | spo2 | 2008-04-18 | Solexa prediction | PMID:18367542, |
| SPCC1183.12 | spo13 | 2008-04-18 | previously SPNCRNA.546; splice site not spotted because it was outside the coordinate range of the feature. Solexa prediction | PMID:18367542, |
| SPBC12D12.09 | rev7 | 2008-01-23 | PMID:21511999 | |
| SPAC22F3.11c | snu23 | 2007-12-19 | PMID:16823372, | |
| SPAPB1A10.16 | 2007-12-19 | conserved fungal protein; created from the C-term exon of SPAPB1A10.03 | PMID:30566651 | |
| SPCC1393.14 | 2007-07-23 | ten1; nuclear telomere cap complex subunit | pers. comm. Paul Russell | |
| SPAC1250.07 | 2007-04-23 | dubious. TFIIIC subunit Tfc7 | PMID:17409385 | |
| SPAC9E9.02 | 2006-02-19 | PMID:21511999 | ||
| SPAC27E2.12 | 2006-02-19 | dubious | ||
| SPAC8E11.08c | 2006-02-19 | PMID:21511999 | ||
| SPAC23C4.04c | 2006-02-19 | PMID:18488015 | ||
| SPAC806.11 | 2006-02-19 | |||
| SPAC6B12.18 | 2006-02-19 | sequence orphan | PMID:21511999 | |
| SPBC1347.14c | 2006-02-19 | dubious | SPD:52/52E09 | |
| SPBCPT2R1.10 | 2006-02-19 | |||
| SPCC338.03c | 2006-02-19 | PMID:21511999 | ||
| SPCC417.15 | 2006-02-19 | dubious | PMID:21511999 | |
| SPCC16C4.21 | 2006-02-19 | |||
| SPAC57A10.14 | 2005-07-05 | SAGA complex subunit (predicted); identified in targeted search for S. cerevisiae SGF11 ortholog | PMID:21511999 | |
| SPAC8C9.19 | 2005-07-05 | conserved protein; similar to D. hansenii DEHA0C10780g | ||
| SPBC3D6.16 | 2005-07-05 | sequence orphan | ||
| SPBC3B9.22c | dad4 | 2005-07-05 | DASH complex subunit Dad4 (predicted) | pers. comm. Xiangwei He |
| SPCC1223.15c | spc19 | 2005-07-05 | DASH complex subunit Spc19 | pers. comm. Xiangwei He |
| SPAC19D5.10c | 2005-07-05 | sequence orphan | SPD:52/52C01 | |
| SPAC19D5.11c | 2005-07-05 | similar to S. cerevisiae CTF8 | pers. comm. Stuart MacNeil | |
| SPAC3A12.19 | 2005-07-05 | mitochondrial ribosomal protein; identified in targeted search for S. cerevisiae YBR282W ortholog | PMID:21511999 | |
| SPBC1685.16 | vma9 | 2004-09-15 | PMID:21511999 | |
| SPBC31A8.02 | 2004-09-15 | |||
| SPAC14C4.16 | 2004-09-15 | hypothetical protein; sequence orphan; identified in targeted search for S. cerevisiae DAD3 ortholog | PMID:30566651 | |
| SPAC959.10 | 2004-09-15 | tRNA splicing endonuclease; similar to S. cerevisiae YMR059W | PMID:21511999 | |
| SPAC6B12.06c | 2004-09-15 | PMID:21511999 | ||
| SPBC56F2.14 | mrpl44 | 2004-09-15 | ribosomal protein, | |
| SPBC6B1.12c | 2004-09-15 | SAGA histone acetylase complex (predicted); involved in nuclear export (predicted); similar to S. cerevisiae YBR111W-A; identified in targeted search for S. cerevisiae SUS1 ortholog | PMID:21511999 | |
| SPBCPT2R1.04c | 2004-09-15 | PMID:21511999 | ||
| SPBCPT2R1.06c | 2004-09-15 | |||
| SPBCPT2R1.05c | 2004-09-15 | |||
| SPBCPT2R1.03 | 2004-09-15 | |||
| SPBCPT2R1.08c | 2004-09-15 | PMID:21511999 | ||
| SPBCPT2R1.07c | 2004-09-15 | |||
| SPBCPT2R1.02 | 2004-09-15 | |||
| SPCC162.04c | wtf13 | 2003-08-14 | PMID:28631610, | |
| SPCC330.19c | 2003-08-14 | hypothetical protein; sequence orphan; confirmed by EST | PMID:21511999 | |
| SPBPB21E7.01c | 2003-08-14 | PMID:21511999 | ||
| SPBPB21E7.04c | 2003-08-14 | PMID:21511999 | ||
| SPAC2F3.12c | 2003-08-14 | PMID:21511999 | ||
| SPBPB21E7.05 | 2003-08-14 | |||
| SPBPB21E7.06 | 2003-08-14 | |||
| SPBC1348.05 | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.04 | 2003-08-14 | PMID:21511999 | ||
| SPBPB21E7.07 | 2003-08-14 | PMID:30566651 | ||
| SPBC1348.03 | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.02 | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.01 | 2003-08-14 | PMID:21511999 | ||
| SPBPB8B6.06c | 2003-08-14 | EMBL:AU013227 | ||
| SPCC576.16c | wtf22 | 2003-08-14 | PMID:28631610 | |
| SPBPB8B6.05c | 2003-08-14 | EMBL:AU009839 | ||
| SPBPB8B6.02c | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.14c | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.12 | 2003-08-14 | |||
| SPBC1348.11 | 2003-08-14 | |||
| SPBPB21E7.09 | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.10c | 2003-08-14 | |||
| SPBC1348.09 | 2003-08-14 | |||
| SPBC1348.08c | 2003-08-14 | PMID:21511999 | ||
| SPBPB21E7.08 | 2003-08-14 | PMID:30566651 | ||
| SPBC1348.07 | 2003-08-14 | PMID:21511999 | ||
| SPBC1348.06c | 2003-08-14 | |||
| SPBPB8B6.03 | 2003-08-14 | |||
| SPAC2F3.18c | 2002-09-05 | PMID:21511999 | ||
| SPBPB21E7.02c | 2002-09-05 | PMID:21511999 | ||
| SPBPB21E7.10 | 2002-09-05 | PMID:21511999 | ||
| SPAC2E12.02 | 2002-09-05 | EMBL:AU008781 | ||
| SPAPB15E9.02c | 2002-09-05 | PMID:21511999 | ||
| SPAPB18E9.05c | 2002-03-22 | |||
| SPAPB18E9.04c | 2002-03-22 | PMID:21511999 | ||
| SPAPB18E9.02c | ppk18 | 2002-03-22 | PMID:21511999 | |
| SPBPB8B6.04c | grt1 | 2002-03-22 | PMID:11058086 | |
| SPAPB18E9.01 | trm5 | 2002-03-22 | PMID:21511999 | |
| SPBP22H7.08 | 2002-03-22 | PMID:21511999 |
Fission yeast genes are classed as “unknown” if there is no information about the broad cellular role (biological process) in which it participates (corresponding to any of the high level GO biological process slim classes). For these, we have been unable to identify a broad biological role based on experimental data in S. pombe or any other organism. Note that, as all genes in S. pombe have been curated, these genes are documented as “unknown” (they are not “unannotated”).
In S. pombe the “unknown” inventory is
You can recreate this query, or variations of it, using the Advanced Search. See the relevant FAQ and the Advanced Search documentation for details. You can also send this list directly to the advanced search (For example to mine for phenotypes or locations of interest).
| Systematic id | Primary name | Date removed | Coordinates when removed | Comment | Reference |
|---|---|---|---|---|---|
| SPNCRNA.893 | 2023-03-01 | 3177931..3178309 | Merged into SPNCRNA.87 | PomBase curators | |
| SPNCRNA.263 | 2023-02-13 | 5317424..5317575 | PomBase curators | ||
| SPNCRNA.38 | prl38 | 2023-01-23 | complement(2186474.. | Merged into SPNCRNA.1493 | PomBase curators |
| SPNCRNA.386 | 2023-01-11 | 2051835..2051899 | PomBase curators | ||
| SPNCRNA.208 | 2022-12-21 | 2802514..2802681 | PomBase curators | ||
| SPNCRNA.272 | 2022-12-21 | 5442999..5443180 | PomBase curators | ||
| SPNCRNA.290 | 2022-12-21 | 102509..102673 | PomBase curators | ||
| SPNCRNA.75 | 2022-12-21 | complement(2810265.. | Merged into SPAC1B2.03c | PomBase curators | |
| SPNCRNA.310 | 2022-12-21 | 5543364..5543438 | PomBase curators | ||
| SPNCRNA.81 | 2022-12-21 | complement(1574846.. | PomBase curators | ||
| SPNCRNA.138 | 2022-12-21 | 79209..79317 | PomBase curators | ||
| SPNCRNA.490 | 2022-12-21 | 1354634..1354743 | PomBase curators | ||
| SPNCRNA.265 | 2022-12-21 | 5387957..5388056 | PomBase curators | ||
| SPNCRNA.106 | 2022-12-21 | 2704773..2704920 | Merged into SPAC1F8.03c, | PomBase curators | |
| SPNCRNA.1612 | 2022-12-21 | 3537068..3538112 | Merged into SPBC887.22 | PomBase curators | |
| SPNCRNA.20 | prl20 | 2022-12-20 | complement(3934357.. | Merged into SPNCRNA.1649 | PomBase curators |
| SPNCRNA.64 | 2022-12-20 | 827254..827546 | Merged into SPCC1393.13 | PomBase curators | |
| SPNCRNA.541 | 2022-12-20 | complement(3150467.. | Merged into SPNCRNA.1582 | PomBase curators | |
| SPNCRNA.1217 | 2022-12-20 | 1677222..1680771 | Merged into SPNCRNA.583 | PomBase curators | |
| SPNCRNA.543 | 2022-12-20 | complement(3751363.. | Merged into SPBC13G1.16 | PomBase curators | |
| SPNCRNA.523 | 2022-12-20 | complement(2381299.. | Merged into SPNCRNA.1293 | PomBase curators | |
| SPNCRNA.1707 | prl102 | 2022-12-20 | 2626082..2626661 | Merged into SPNCRNA.5748 | PomBase curators |
| SPNCRNA.574 | 2022-12-20 | 3510949..3512276 | Merged into SPNCRNA.1608 | PomBase curators | |
| SPNCRNA.578 | 2022-12-20 | complement(343079.. | Merged into SPNCRNA.1132 | PomBase curators | |
| SPNCRNA.113 | 2022-12-20 | 4129796..4130288 | Merged into SPNCRNA.1674 | PomBase curators | |
| SPNCRNA.582 | 2022-12-20 | complement(1587755.. | Merged into SPNCRNA.1208 | PomBase curators | |
| SPNCRNA.532 | 2022-12-20 | complement(4465475.. | Merged into SPNCRNA.1696 | PomBase curators | |
| SPNCRNA.504 | 2022-12-20 | 1839578..1840266 | Merged into SPNCRNA.1235 | PomBase curators | |
| SPNCRNA.539 | 2022-12-20 | complement(2601130.. | Merged into SPNCRNA.1533 | PomBase curators | |
| SPNCRNA.1163 | 2022-12-20 | 957698..959188 | Merged into SPNCRNA.478 | PomBase curators | |
| SPNCRNA.7117 | 2022-12-20 | complement(935976.. | Merged into SPNCRNA.1706 | PomBase curators | |
| SPNCRNA.419 | 2022-12-20 | 3408356..3410137 | Merged into SPNCRNA.1598 | PomBase curators | |
| SPNCRNA.458 | 2022-12-20 | 170771..173539 | Merged into SPNCRNA.1115 | PomBase curators | |
| SPNCRNA.424 | 2022-12-20 | 3584415..3584941 | Merged into SPNCRNA.1619 | PomBase curators | |
| SPNCRNA.426 | 2022-12-20 | 3620593..3622000 | Merged into SPNCRNA.1624 | PomBase curators | |
| SPNCRNA.436 | 2022-12-20 | 4033337..4035308 | Merged into SPNCRNA.1657 | PomBase curators | |
| SPNCRNA.444 | 2022-12-20 | 4435937..4436680 | Merged into SPNCRNA.1693 | PomBase curators | |
| SPNCRNA.210 | 2022-12-19 | 2959156..2959658 | Merged into SPNCRNA.865 | PomBase curators | |
| SPNCRNA.1436 | 2022-12-19 | complement(1467902.. | Merged into SPSNORNA.47 | PomBase curators | |
| SPNCRNA.1481 | 2022-12-19 | 1952767..1955702 | Merged into SPNCRNA.571 | PomBase curators | |
| SPNCRNA.911 | 2022-12-19 | complement(3477738.. | PomBase curators | ||
| SPNCRNA.197 | 2022-12-19 | 2519010..2521358 | Merged into SPNCRNA.831 | PomBase curators | |
| SPNCRNA.528 | 2022-12-19 | complement(2931805.. | PomBase curators | ||
| SPNCRNA.205 | 2022-12-19 | 2738681..2740459 | Merged into SPNCRNA.848 | PomBase curators | |
| SPNCRNA.4496 | 2022-12-19 | 5524126..5524769 | Merged into SPNCRNA.1703 | PomBase curators | |
| SPNCRNA.882 | 2022-12-19 | 3060538..3061276 | Merged into SPNCRNA.212 | PomBase curators | |
| SPNCRNA.277 | 2022-12-19 | 5478402..5479098 | PomBase curators | ||
| SPNCRNA.236 | 2022-12-19 | 3846893..3847670 | Merged into SPNCRNA.941 | PomBase curators | |
| SPNCRNA.329 | 2022-12-19 | 831524..832704 | Merged into SPNCRNA.1387 | PomBase curators | |
| SPNCRNA.860 | 2022-12-19 | complement(2931622.. | PomBase curators | ||
| SPNCRNA.321 | 2022-12-19 | 672953..673783 | Merged into SPNCRNA.1379 | PomBase curators | |
| SPNCRNA.246 | 2022-12-19 | 4400686..4401605 | Merged into SPNCRNA.985 | PomBase curators | |
| SPNCRNA.551 | 2022-12-19 | 485703..486330 | Merged into SPNCRNA.653 | PomBase curators | |
| SPNCRNA.248 | 2022-12-19 | 4531070..4531631 | Merged into SPNCRNA.996 | PomBase curators | |
| SPNCRNA.254 | 2022-12-19 | 4869147..4870212 | Merged into SPNCRNA.1032 | PomBase curators | |
| SPNCRNA.557 | 2022-12-19 | complement(1902620.. | Merged into SPNCRNA.772 | PomBase curators | |
| SPNCRNA.4499 | 2022-12-19 | complement(5552817.. | Merged into SPNCRNA.1704 | PomBase curators | |
| SPNCRNA.564 | 2022-12-19 | 4931204..4933354 | Merged into SPNCRNA.1037 | PomBase curators | |
| SPNCRNA.299 | 2022-12-19 | 274745..275832 | Merged into SPNCRNA.1333 | PomBase curators | |
| SPNCRNA.559 | 2022-12-19 | 2893868..2895019 | Merged into SPNCRNA.858 | PomBase curators | |
| SPNCRNA.3112 | 2022-12-12 | 2474190..2474389 | PomBase curators | ||
| SPNCRNA.1038 | 2022-12-12 | complement(4936907.. | Merged into SPSNORNA.42 | PomBase curators | |
| SPNCRNA.325 | 2022-12-12 | 720414..720516 | PomBase curators | ||
| SPNCRNA.143 | 2022-12-08 | 236819..236928 | Merged into SPNCRNA.625 | PomBase curators | |
| SPNCRNA.341 | 2022-12-08 | 4106634..4106726 | PomBase curators | ||
| SPNCRNA.507 | 2022-12-08 | complement(2265688.. | Merged into SPNCRNA.808 | PomBase curators | |
| SPNCRNA.508 | 2022-12-08 | 1938961..1939133 | PomBase curators | ||
| SPNCRNA.510 | 2022-12-08 | 3851006..3851107 | Merged into SPNCRNA.942 | PomBase curators | |
| SPNCRNA.514 | 2022-12-08 | complement(2145712.. | Merged into SPNCRNA.1490 | PomBase curators | |
| SPNCRNA.515 | 2022-12-08 | 3962690..3962794 | Merged into SPNCRNA.1651 | PomBase curators | |
| SPNCRNA.129 | 2022-12-08 | complement(115394.. | PomBase curators | ||
| SPNCRNA.114 | 2022-12-08 | 4262098..4262173 | PomBase curators | ||
| SPNCRNA.125 | 2022-12-08 | 895569..895690 | Merged into SPCC16A11.14 | PomBase curators | |
| SPNCRNA.906 | 2022-12-08 | 3394883..3395271 | Merged into SPSNORNA.20 | PomBase curators | |
| SPNCRNA.108 | 2022-12-08 | 1680947..1681089 | PomBase curators | ||
| SPNCRNA.91 | 2022-12-08 | 5058865..5059013 | PomBase curators | ||
| SPNCRNA.88 | 2022-12-08 | 3033837..3033955 | PomBase curators | ||
| SPNCRNA.119 | 2022-12-08 | 2097286..2097395 | PomBase curators | ||
| SPNCRNA.89 | 2022-12-08 | 3960007..3960165 | PomBase curators | ||
| SPNCRNA.99 | 2022-12-08 | complement(4434321.. | PomBase curators | ||
| SPNCRNA.126 | 2022-12-08 | complement(895866.. | PomBase curators | ||
| SPNCRNA.127 | 2022-12-08 | 895922..896000 | PomBase curators | ||
| SPNCRNA.10 | 2022-09-27 | complement(1837689.. | merged with SPNCRNA.1234 | PomBase curators | |
| SPNCRNA.101 | 2022-09-27 | 227377..227756 | Merged into SPNCRNA.62 | PomBase curators | |
| SPNCRNA.104 | 2022-09-27 | 547327..547670 | Merged into SPNCRNA.66 | PomBase curators | |
| SPNCRNA.193 | 2022-09-27 | 2404684..2405924 | Merged into SPNCRNA.823 | PomBase curators | |
| SPNCRNA.18 | 2022-09-27 | complement(3699381.. | merged with SPNCRNA.928 | PomBase curators | |
| SPNCRNA.1711 | adh1-antisense-2 | 2022-09-27 | complement(1590089.. | Merged into SPNCRNA.1710 | PomBase curators |
| SPNCRNA.489 | 2022-09-27 | 1342276..1342801 | merged with SPNCRNA.1187 | PomBase curators | |
| SPNCRNA.46 | 2022-09-27 | complement(4651351.. | SPNCRNA.46 changed to 5' UTR of SPAC144.19 (prl46) | PMID:32594847 | |
| SPNCRNA.1295 | 2022-09-27 | 2419027..2419845 | Merged into SPNCRNA.29 | PomBase curators | |
| SPNCRNA.884 | 2022-09-27 | complement(3084619.. | merged with SPNCRNA.214 | PomBase curators | |
| SPNCRNA.553 | SPAC13A11.06-antisense-2 | 2022-09-27 | complement(585266.. | Merged into SPNCRNA.662 | PomBase curators |
| SPNCRNA.1541 | 2022-09-27 | 2661608..2662564 | Merged into SPNCRNA.540 | PomBase curators | |
| SPNCRNA.951 | 2022-09-27 | 3951825..3952588 | Merged into SPNCRNA.239 | PomBase curators | |
| SPNCRNA.145 | 2022-09-27 | 239730..240571 | Merged into SPNCRNA.628 | PomBase curators | |
| SPNCRNA.1098 | 2022-09-27 | complement(42013.. | merged with SPNCRNA.07 | PomBase curators | |
| SPNCRNA.1274 | 2022-09-27 | complement(2215568.. | Merged into SPNCRNA.584 | PomBase curators | |
| SPNCRNA.1388 | 2022-09-27 | 835808..836248 | Merged into SPNCRNA.34 | PomBase curators | |
| SPNCRNA.729 | 2022-08-26 | 1236996..1238533 | Merged into SPNCRNA.432 | PomBase curators | |
| SPNCRNA.681 | 2022-08-26 | 776184..777243 | Merged into SPNCRNA.159 | PomBase curators | |
| SPNCRNA.727 | 2022-08-26 | 1234476..1235111 | deleted; ID added as synonym to SPNCRNA.82 and SPSNORNA.10 (covers both). Merged into SPNCRNA.82, | PomBase curators | |
| SPNCRNA.994 | 2022-08-26 | 4516018..4517065 | Merged into SPNCRNA.130 | PomBase curators | |
| SPNCRNA.289 | 2022-08-26 | 63695..64021 | Merged into SPNCRNA.1303 | PomBase curators | |
| SPNCRNA.77 | 2022-08-26 | 2362396..2362641 | Merged into SPNCRNA.817 | PomBase curators | |
| SPNCRNA.76 | 2022-08-26 | 79543..79628 | overlapped with correctly annotated NUMT (SPNUMT.9) | PomBase curators | |
| SPNCRNA.4538 | 2022-08-26 | complement(63188.. | PomBase curators | ||
| SPNCRNA.83 | 2022-08-26 | 72344..72414 | overlapped with correctly annotated NUMT (SPNUMT.8) | PomBase curators | |
| SPNCRNA.78 | 2022-08-26 | 2362643..2362753 | Merged into SPNCRNA.817 | PomBase curators | |
| SPNCRNA.962 | 2022-08-26 | 4136046..4137000 | Merged into SPNCRNA.306 | PomBase curators | |
| SPNCRNA.958 | 2022-08-26 | complement(4100222.. | merged with SPAC23A1.20 | PomBase curators | |
| SPNCRNA.59 | prl59 | 2022-08-26 | 2362411..2362747 | Merged into SPNCRNA.817 | PomBase curators |
| SPNCRNA.495 | 2022-08-26 | 1560068..1561109 | Merged into SPNCRNA.1205 | PomBase curators | |
| SPNCRNA.552 | pol4-antisense-1 | 2022-08-26 | 541795..543483 | Merged into SPNCRNA.660 | PomBase curators |
| SPNCRNA.1679 | 2022-08-26 | complement(4194886.. | Merged into SPNCRNA.438 | PomBase curators | |
| SPNCRNA.1341 | 2022-08-26 | complement(339484.. | Merged into SPNCRNA.103 | PomBase curators | |
| SPNCRNA.1256 | 2022-08-26 | 2045109..2046142 | PomBase curators | ||
| SPNCRNA.144 | 2022-08-26 | 238509..238898 | Merged into SPNCRNA.627 | PomBase curators | |
| SPNCRNA.538 | 2022-08-26 | 2301759..2303132 | Merged into SPNCRNA.1501 | PomBase curators | |
| SPNCRNA.503 | 2022-08-26 | 1787163..1787440 | PomBase curators | ||
| SPNCRNA.1531 | 2022-08-26 | 2584028..2586436 | Merged into SPNCRNA.402 | PomBase curators | |
| SPNCRNA.1084 | 2022-08-26 | 5459203..5460261 | Merged into SPNCRNA.274 | PomBase curators | |
| SPNCRNA.502 | 2022-08-26 | 1782127..1783070 | merged with SPNCRNA.1228 | PomBase curators | |
| SPNCRNA.1631 | 2022-08-26 | 3702520..3703093 | Merged into SPNCRNA.428 | PomBase curators | |
| SPNCRNA.411 | 2022-08-26 | 2901243..2902541 | Merged into SPNCRNA.1561 | PomBase curators | |
| SPNCRNA.410 | 2022-08-26 | 2886001..2886371 | Merged into SPNCRNA.1559 | PomBase curators | |
| SPNCRNA.227 | 2022-08-26 | 3610148..3611124 | Merged into SPNCRNA.921 | PomBase curators | |
| SPNCRNA.4675 | 2022-08-26 | complement(340287.. | Merged into SPNCRNA.103 | PomBase curators | |
| SPNCRNA.09 | prl9 | 2022-08-25 | complement(2485500.. | Merged into SPNCRNA.1519 | PomBase curators |
| SPNCRNA.5 | 2022-08-25 | 434104..434843 | PomBase curators | ||
| SPNCRNA.08 | prl8 | 2022-08-25 | complement(2485488.. | Merged into SPNCRNA.1519 | PomBase curators |
| SPNCRNA.74 | eta2-antisense-4 | 2022-08-25 | complement(3002976.. | Merged into SPNCRNA.872 | PomBase curators |
| SPNCRNA.73 | eta2-antisense-3 | 2022-08-25 | complement(3002834.. | Merged into SPNCRNA.872 | PomBase curators |
| SPNCRNA.06 | prl6 | 2022-08-25 | complement(968168.. | Merged into SPNCRNA.1166 | PomBase curators |
| SPNCRNA.01 | prl1 | 2022-08-25 | 3003816..3004916 | SPNCRNA.01/prl101 part of the UTR of eta2 | PomBase curators |
| SPNCRNA.72 | eta2-antisense-2 | 2022-08-25 | complement(3001825.. | Merged into SPNCRNA.872 | PomBase curators |
| SPNCRNA.2010 | 2022-08-25 | complement(14934.. | Merged into SPNCRNA.1701 | PomBase curators | |
| SPNCRNA.5498 | 2022-02-23 | 2113971..2114364 | Merged into SPNCRNA.1708 | PomBase curators | |
| SPNCRNA.379 | 2022-02-23 | 1892116..1892775 | Merged into SPNCRNA.1474 | PomBase curators | |
| SPNCRNA.1486 | 2022-02-23 | 2115592..2117088 | merged with SPNCRNA.388 | PomBase curators | |
| SPNCRNA.342 | 2022-02-23 | 1224483..1224560 | PomBase curators | ||
| SPNCRNA.334 | 2022-02-23 | 948994..949948 | Merged into SPNCRNA.1399 | PomBase curators | |
| SPRPTCENB.12 | cnt2.2 | 2021-01-21 | 1624515..1627609 | PomBase curators | |
| SPRPTC.8 | 2020-05-01 | complement(1738762.. | PomBase curators | ||
| SPRPTC.7 | 2020-05-01 | complement(1579527.. | PomBase curators | ||
| SPRPTC.2 | 2020-05-01 | 615327..616830 | PomBase curators | ||
| SPRPTC.5 | 2020-05-01 | 1401219..1403077 | PomBase curators | ||
| SPRPTB.6 | 2020-05-01 | complement(592650.. | PomBase curators | ||
| SPBC8E4.02c | prt2 | 2018-10-11 | 4442542..4445970 | SPBC8E4.02c replaced by SPNCRNA.9001 (prt2) | PMID:29414789 |
| SPRPTB.11 | 2016-03-23 | complement(4019659.. | PomBase curators | ||
| SPRPTB.12 | 2016-03-23 | complement(4019846.. | PomBase curators | ||
| SPNCRNA.1308 | 2014-11-06 | complement(103165.. | Merged into SPNCRNA.291 | PomBase curators | |
| SPNCRNA.1300 | 2014-11-06 | complement(21060.. | Merged into SPNCRNA.287 | PomBase curators | |
| SPNCRNA.1311 | 2014-11-06 | 120577..121643 | Merged into SPNCRNA.293 | PomBase curators | |
| SPNCRNA.1372 | 2014-11-06 | complement(591798.. | Merged into SPNCRNA.316 | PomBase curators | |
| SPRPTB.4 | 2014-06-10 | complement(54135.. | PomBase curators | ||
| SPRPTB.5 | 2014-06-10 | complement(56925.. | PomBase curators | ||
| SPRPTA.21 | 2014-06-09 | 5555691..5556879 | PomBase curators | ||
| SPRPTA.1 | 2014-06-09 | complement(6360.. | PomBase curators | ||
| SPRPTA.19 | 2014-06-09 | complement(5538601.. | PomBase curators | ||
| SPRPTA.2 | 2014-06-09 | 7548..12710 | PomBase curators | ||
| SPRPTB.3 | 2014-06-09 | 14527..29514 | PomBase curators | ||
| SPRPTB.2 | 2014-06-09 | 8062..12662 | PomBase curators | ||
| SPRPTA.22 | 2014-06-09 | 5559353..5560691 | PomBase curators | ||
| SPRPTA.23 | 2014-06-09 | 5559366..5570144 | PomBase curators | ||
| SPRPTB.16 | 2014-06-09 | 4535114..4535276 | PomBase curators | ||
| SPRPTA.24 | 2014-06-09 | 5562559..5567158 | PomBase curators | ||
| SPRPTA.25 | 2014-06-09 | complement(join(5564531.. | PomBase curators | ||
| SPRPTA.26 | 2014-06-09 | 5568686..5579133 | PomBase curators | ||
| SPRPTB.17 | 2014-06-09 | 4535426..4535519 | PomBase curators | ||
| SPRPTA.3 | 2014-06-09 | 15829..22113 | PomBase curators | ||
| SPRPTA.4 | 2014-06-09 | 20859..29663 | PomBase curators | ||
| SPRPTB.18 | 2014-06-09 | 4535640..4539804 | PomBase curators | ||
| SPRPTB.1 | 2014-06-09 | 1..6535 | PomBase curators | ||
| SPNCRNA.1380 | 2012-08-06 | 674049..676227 | Merged into SPNCRNA.322 | PomBase curators | |
| SPNCRNA.1347 | 2012-08-06 | complement(360439.. | Merged into SPNCRNA.304 | PomBase curators | |
| SPBTRNAASP.03 | 2012-01-03 | 1602188..1602260 | Merged into SPBTRNAARG.06, | PomBase curators | |
| SPNCRNA.1196 | 2011-08-29 | 1431135..1433068 | merged with SPNCRNA.67 | PomBase curators | |
| SPNCRNA.1254 | 2011-08-29 | 2011026..2012559 | merged with SPNCRNA.511 | PomBase curators | |
| SPNCRNA.1291 | 2011-08-29 | 2362179..2362725 | merged with SPNCRNA.519 | PomBase curators | |
| SPNCRNA.1652 | 2011-08-22 | complement(3978331.. | Merged into SPNCRNA.111 | PomBase curators | |
| SPNCRNA.548 | 2011-05-09 | complement(1641873.. | Merged into SPCC663.18 | PomBase curators | |
| SPNCRNA.531 | 2011-05-09 | 2291674..2292604 | Merged into SPAC4G9.22 | PomBase curators | |
| SPNCRNA.221 | 2011-04-18 | 3405117..3405938 | Merged into SPNCRNA.907 | PomBase curators | |
| SPNCRNA.41 | prl41 | 2011-03-24 | 1652051..1652489 | Merged into SPBC21B10.14 | PomBase curators |
| SPNCRNA.527 | 2011-03-24 | 2830376..2831519 | Merged into SPAC3F10.19 | PomBase curators | |
| SPNCRNA.44 | prl44 | 2011-03-24 | 955413..955760 | Merged into SPCPB16A4.07 | PomBase curators |
| SPNCRNA.476 | 2011-03-24 | 934572..935182 | Merged into SPCC24B10.19c | PomBase curators | |
| SPNCRNA.288 | 2011-03-24 | complement(61601.. | Merged into SPBPB21E7.11 | PomBase curators | |
| SPNCRNA.308 | 2011-03-24 | 501166..501471 | Merged into SPBC1685.16 | PomBase curators | |
| SPNCRNA.418 | 2011-03-24 | 3252028..3253686 | Merged into SPBC25H2.18 | PomBase curators | |
| SPNCRNA.314 | 2011-03-24 | 578127..578188 | Merged into SPBC354.12 | PomBase curators | |
| SPNCRNA.347 | 2011-03-24 | 1385519..1386025 | Merged into SPBC8D2.15 | PomBase curators | |
| SPNCRNA.353 | 2011-03-24 | 1546238..1546718 | Merged into SPBC29B5.01 | PomBase curators | |
| SPNCRNA.588 | 2011-03-24 | complement(join(3835571.. | Merged into SPAC4H3.16 | PomBase curators | |
| SPNCRNA.422 | 2011-03-24 | 3530807..3530914 | Merged into SPBC1105.14 | PomBase curators | |
| SPNCRNA.60 | prl60 | 2011-03-24 | complement(2005290.. | Merged into SPBP23A10.17 | PomBase curators |
| SPNCRNA.381 | 2011-03-24 | 3398737..3398938 | PomBase curators | ||
| SPNCRNA.65 | prl65 | 2011-03-24 | complement(join(2472399.. | Merged into SPAC19A8.16 | PomBase curators |
| SPNCRNA.537 | 2011-02-04 | 2273953..2274349 | Merged into SPBC16H5.12c | PomBase curators | |
| SPNCRNA.223 | 2011-02-04 | complement(3534486.. | Merged into SPAC16E8.18c | PomBase curators | |
| SPNCRNA.542 | 2011-02-04 | complement(3346551.. | Merged into SPBC17D1.17 | PomBase curators | |
| SPNCRNA.509 | 2010-06-10 | complement(1966483.. | dubious and partially overlapping with Ost5. Merged into SPCC18.19c | PomBase curators | |
| SPRRNA.25 | 2010-01-29 | complement(814799.. | small fragment of 25S rRNA | PomBase curators | |
| SPNCRNA.55 | prl55 | 2010-01-29 | 2416235..2416706 | Merged into SPAC6B12.18 | PomBase curators |
| SPNCRNA.63 | prl63 | 2009-10-23 | complement(4008184.. | Merged into SPNCRNA.53 | PomBase curators |
| SPRRNA.23 | 2009-09-04 | complement(16412.. | Merged into SPRRNA.44, | PomBase curators | |
| SPRRNA.08 | 2009-09-04 | 2439540..2447392 | Merged into SPRRNA.46, | PomBase curators | |
| SPRRNA.22 | 2009-09-04 | complement(5542.. | PomBase curators | ||
| SPRRNA.21 | 2009-09-04 | complement(1..2852) | Merged into SPRRNA.42, | PomBase curators | |
| SPRRNA.09 | 2009-09-04 | 2450422..2452883 | Merged into SPRRNA.45 | PomBase curators | |
| SPNCRNA.109 | 2008-08-27 | 2090329..2090574 | part of protein coding gene merge | PomBase curators | |
| SPNCRNA.430 | 2008-07-16 | 3892174..3892932 | Merged into SPBC1604.25 | PomBase curators | |
| SPNCRNA.470 | 2008-07-16 | 684621..685496 | Merged into SPCC16C4.22 | PomBase curators | |
| SPNCRNA.235 | 2008-07-16 | 3790667..3791710 | Merged into SPAP4C9.02 | PomBase curators | |
| SPNCRNA.162 | 2008-07-16 | 967652..968379 | Merged into SPAC222.17 | PomBase curators | |
| SPNCRNA.245 | 2008-07-16 | complement(4365732.. | Merged into SPAC23D3.17 | PomBase curators | |
| SPNCRNA.97 | 2008-01-23 | 4012418..4012891 | replaced by short protein coding gene SPAC27E2.14 | PomBase curators | |
| SPNCRNA.85 | 2008-01-23 | complement(500805.. | replaced by protein coding gene SPAC227.19c | PomBase curators | |
| SPNCRNA.533 | 2008-01-23 | complement(62375.. | PomBase curators | ||
| SPNCRNA.48 | prl48 | 2008-01-23 | complement(join(3942128.. | replaced by protein coding gene SPAC2F3.18 | PomBase curators |
| SPSNORNA.51 | snR99 | 2007-07-05 | 583416..583605 | Merged into SPSNORNA.32 | PomBase curators |
| SPNCRNA.49 | prl49 | 2006-09-05 | complement(4009084.. | Merged into SPNCRNA.53 | PomBase curators |
| SPNCRNA15 | 2004-09-15 | complement(1329946.. | PomBase curators | ||
| SPNCTRNA.25 | 2004-09-15 | 2569630..2570056 | PomBase curators |
| Systematic id | Primary name | Date removed | Coordinates when removed | Comment | Reference |
|---|---|---|---|---|---|
| SPMTR.04 | mat3-Mc | 2019-05-21 | 15856..16401 | PomBase curators | |
| SPMTR.03 | mat3-Mi | 2019-05-21 | complement(15593.. | PomBase curators | |
| SPAC110.05 | 2016-07-14 | complement(1905728.. | Merged into SPAC110.06 | PomBase curators | |
| SPBC713.13 | 2016-03-17 | complement(890220.. | deleted; ID added as synonym to SPBC713.14c | PMID:24929437 | |
| SPAPB1A11.05 | 2016-03-17 | 2975643..2975771 | Merged into SPAC31G5.01, | PomBase curators | |
| SPAC823.02 | 2016-03-17 | join(2583804.. | deleted; replaced by SPAC823.17 at same locus, | PMID:24929437 | |
| SPAC1D4.07c | 2015-12-11 | complement(649449.. | not protein-coding | PMID:24929437, | |
| SPAC4H3.12c | 2015-12-11 | complement(3851914.. | not protein-coding | PMID:24929437, | |
| SPAC27E2.13 | 2015-12-11 | 4008511..4008693 | not protein-coding | PMID:24929437, | |
| SPBC36.13 | 2015-12-11 | complement(845807.. | not protein-coding | PMID:24929437, | |
| SPCC1672.14 | 2015-12-11 | complement(563977.. | not protein-coding | PMID:24929437, | |
| SPCC188.05 | 2015-12-11 | 1482007..1482273 | not protein-coding | PMID:24929437, | |
| SPBC354.11c | 2015-12-11 | complement(575773.. | not protein-coding | PMID:24929437, | |
| SPBC32F12.17 | 2015-12-11 | complement(2805085.. | not protein-coding | PMID:24929437, | |
| SPCC417.04 | 2015-12-11 | 1673314..1673856 | not protein-coding | PMID:24929437, | |
| SPCC622.05 | 2015-12-11 | 1408164..1408511 | not protein-coding | PMID:24929437, | |
| SPBC1685.12c | 2015-12-11 | complement(523887.. | not protein-coding | PMID:24929437, | |
| SPAC1F8.09c | 2012-09-13 | complement(96091.. | annotated in error | PomBase curators | |
| SPAC1F12.03c | 2012-07-16 | complement(join(3810367.. | removed; replaced by a nuclear mitochondrial pseudogene (NUMT) feature | PomBase curators | |
| SPBC1348.13 | 2011-11-20 | 36892..37188 | Coordinates updated; now annotated as nuclear mitochondrial pseudogene (SO:0001044). Merged into SPNUMT.1 | PomBase curators | |
| SPCC18.19 | 2011-05-09 | 1982501..1982719 | Merged into SPCC18.20 | PomBase curators | |
| SPAC17A2.15 | 2011-03-24 | join(3569155.. | was on the reverse strand of the N-terminal extension of SPAC17A2.08 | PomBase curators | |
| SPAC13F5.08 | vts1 | 2011-03-24 | complement(join(2178651.. | Merged into SPAC13F5.04c | PomBase curators |
| SPBPB2B2.04 | 2010-09-28 | 4464941..4465474 | no coding region | PomBase curators | |
| SPBPB2B2.03c | 2010-09-28 | complement(4462609.. | no coding region | PomBase curators | |
| SPBCPT2R1.09c | 2010-09-28 | complement(4517649.. | no coding region | PomBase curators | |
| SPBC11C11.12 | 2010-05-20 | 3360974..3361072 | cob intron fragment currently annotated as pseudogene | PomBase curators | |
| SPBC14C8.08c | 2009-02-19 | complement(2219430.. | merged with SPBC14C8.09c; frameshifted | PMID:16823372 | |
| SPAC27D7.10c | 2008-09-22 | complement(4526425.. | Merged into SPAC27D7.09c | PomBase curators | |
| SPAC6F6.18c | mug169 | 2008-07-16 | complement(2764798.. | merged with SPAC6F6.16c | PMID:18535244 |
| SPAC1002.21 | 2008-01-23 | complement(1834875.. | was annotated as dubious but based on position in uracil regulatable operon, | PomBase curators | |
| SPAC12D12.09 | rev7 | 2008-01-23 | join(2313544.. | Merged into SPBC12D12.09 | PomBase curators |
| SPAC22E12.15 | 2008-01-23 | join(5049001.. | previously annotated as dubious but dubious splice prediction; unsupported by Solexa transcript data | PMID:18488015 | |
| SPAC8E11.09c | 2008-01-23 | join(3374696.. | previously annotated as dubious but no evidence for splicing, | PMID:18488015 | |
| SPAC8C9.20 | 2008-01-23 | join(3663780.. | non consensus branch sites, | PomBase curators | |
| SPBC18H10.21c | 2007-12-19 | complement(join(1811244.. | alias SPBC9B6.01c; dubious; unsupported by Solexa transcript data | PMID:18488015 | |
| SPAC4G8.15c | 2007-12-19 | complement(join(766607.. | dubious; unsupported by Solexa transcript data | PMID:18488015 | |
| SPCC2H8.03 | 2007-12-19 | join(830489.. | dubious; unsupported by Solexa transcript data | PMID:18488015 | |
| SPAC22E12.12 | 2007-12-19 | join(5043251.. | dubious; unsupported by Solexa transcript data. unsupported by Solexa transcript data and largely overlapping with 3' UTR of rpl24-3 | PMID:18488015 | |
| SPAPB18E9.03c | 2007-12-19 | complement(join(3981978.. | dubious; unsupported by Solexa transcript data | PMID:18488015 | |
| SPAC1250.04 | atl1 | 2006-11-20 | 5098013..5098339 | PomBase curators | |
| SPCC18B5.12 | 2004-09-15 | join(741745.. | Merged into SPCC14G10.01 | PomBase curators |
As part of a technology development project, the Broad Institute generated 200-fold sequence coverage of the genome of S. pombe strain 972 using Illumina (Solexa) technology. This deep coverage was used to identify discrepancies between the Illumina read data and the current reference assembly of 972, employing a polymorphism discovery algorithm written specifically for Illumina data, and tuned to have a very low false positive call rate. 190 sequence discrepancies were observed, all but two of which were either single base insertions, deletions or substitutions. These discrepancies could be due to sequence errors in the reference 972 assembly, sequence polymorphisms between the two isolates of 972 sequenced, or systematic errors in the Illumina data or analysis. Of the 190 discrepancies, 25 occur in homopolymer runs of at least 7 nucleotides, which are both more likely to produce sequencing errors and inter-strain polymorphisms, and 39 are clustered within 10 nucleotides of another discrepancy, which is more common in cases of mis-alignment of the Illumina reads. Excluding these sites, the discrepancy rate is about 1 in 100,000, which is close to the estimated error rate in published reference sequence.
The data listed here were updated in August 2008; the original coordinates were based on an older assembly and did not match the current assembly of the right arm of Chromosome I. One discrepancy is a known artifact. At nucleotide 1774235 of Chromosome III there is an insertion of GACT caused by an assembly glitch in the published reference, which will be corrected in future releases. In addition, there are several clusters of discrepancies which are suspicious. These discrepancies will be investigated and the discrepancy list updated as appropriate. Beyond that analysis, no validation of other discrepancies is currently planned. However, we welcome any validation efforts by members of the community. If you generate any data pertinent to these discrepancies, or if you have any comments about them, please contact Nick Rhind or Valerie Wood. These data can be cited as follows: “Data were generated at the Broad Institute. Chad Nusbaum, personal communication.”
The data can be downloaded as an Excel spreadsheet
| Chromosome | Location | Left | Sample | Reference | Right | Clustered? | Homopolymer | Confirmed in |
|---|---|---|---|---|---|---|---|---|
| I | 94353 | GTGACAATTGAATTTTTTTT | T | AAATGTTTCTATATTGTTAA | No | X | ||
| I | 101872 | GAGGACGGGCGTTGGCGGAG | G | CAACAGCCTTACCCCAGTCA | No | PMID:16823372 | ||
| I | 470379 | TGTGATAGACAAAAAAAGAC | C | GTTAAAAGAACCTAAACGAA | No | |||
| I | 470390 | AAAAAAGACCGTTAAAAGAA | C | CTAAACGAATTGTAATCAGA | No | |||
| I | 482738 | AGCTATTCGATCCACCGCAG | G | TTTGTCTGATTTGTTGCCCT | No | |||
| I | 523602 | ACAATGATACTTACTCCACA | A | G | CGATTCCATTTTCCAAAGAC | No | ||
| I | 523882 | GTTTCAGCCATTGAAAGATA | A | G | CGATCGTTCTCAGACAAAGA | No | ||
| I | 527155 | AATCATGGATTTAATACATA | A | C | CTTTTAGTTTGTATGTGATA | No | ||
| I | 554538 | GAAGATTTATTTTTTTTTTT | T | GGAATTTATTCTGCTCGGCC | No | X | ||
| I | 670033 | AGAGATTATTATTAAGATCA | A | CCTAAATATCGTAACGTACG | No | |||
| I | 682996 | ATAAAACTACTATACTTCCC | C | GCTGGAGCTTCGGTAGGCCG | No | PMID:16823372 | ||
| I | 759333 | TGTTCACAGTTTTTCCCAAA | T | G | TTGCTTTTTCTTTTGGCTTA | No | ||
| I | 862963 | ATTAAATTCTCGAAGTTGCT | TT | G | ATTTTCCAAATCAATTCATG | No | ||
| I | 1048646 | ACGGAAAAGAAAAAAAAAAA | A | TCCGCGTTCAGTAGAAGTCA | No | X | ||
| I | 1274804 | GTACTTGAAATTATTTTTTA | A | TAAAGTGAGAACGCCCAGTT | No | |||
| I | 1424708 | GTGCTTCATCAGTGACAACC | A | TTTAGAATGGATCTGTATGT | No | |||
| I | 1625094 | ATCAAATAGTCGATGCCTCC | C | AGCATCTCAATCTTCAATTC | No | |||
| I | 1783457 | ACTCTGGGTTCTTCTTATGT | T | C | TGGGACGGTCTTCGGCATAA | No | ||
| I | 1936298 | ACTCTTAAATTTTAGGAAAA | A | GACGCTCTTTTATAGTAAGG | No | |||
| I | 1952317 | TATATGTACGTACATATTTT | T | GCGCACCAGTTAGTTTGCGA | No | |||
| I | 1999191 | TTTACCGCTTGACTGTGACC | C | G | TACGACCTAACAATTTATTA | No | PMID:18088324 | |
| I | 2104090 | AAACTGTTGTAAAAAAATTA | T | G | ATTATCGGTGTATTTATTTA | No | ||
| I | 2104096 | TTGTAAAAAAATTAGATTAT | A | C | GGTGTATTTATTTATATTAG | Yes | - | 6 |
| I | 2154492 | AATTTGTTAAAAAAGGAGTA | A | GTTTACCTCTCGCTTTATGC | No | |||
| I | 2288241 | TCTTCATTGTTATTGTTACG | G | ATTCGTCACCCAGTGAAGAT | No | |||
| I | 2343704 | TGCAAACTCTTTGATCACGA | A | GTCTACATAATTCTTGAACC | No | |||
| I | 2421577 | AGCTAAATATAAGAAAAAAC | C | GAGAATTATAAGCAAACGTT | No | |||
| I | 2499159 | AAAACATCAATTTTTTTTTT | T | GACAGTAATTATACTAGAAT | No | X | PMID:16823372 | |
| I | 2506043 | AAATAGTGTCACATTGTTTT | A | T | ATATTAAGTATTTTTAATCG | No | ||
| I | 2507463 | TTAGGTGTTAAACATAAATA | A | CTTACGTTTTCATACGCGCA | No | |||
| I | 2588024 | AAAGAACAGCAAAAAACAAA | A | GATAATGACAGAAAAAATAT | No | |||
| I | 2588072 | CTGAGAAAGTTGACAAAAAA | A | TTTTTGGCGAAAGAAAGAAA | No | X | ||
| I | 2594264 | TAATTTTTAATGAATACTCT | T | AGGCTTCCTTAAATGTTTTT | No | |||
| I | 2594326 | TTAAAGCAGTGTCTTATTAA | A | CATTGTAAACATCAAAAAGC | No | |||
| I | 2594351 | TAAACATCAAAAAGCTTCAT | A | AACAGATGTAAGAAATTAAT | No | |||
| I | 2594393 | AATTAACTTGTGAAGACATT | T | CGATGTGATTAAAGTATGAA | No | |||
| I | 2605763 | TGTAAAAAGCATTTGAAATT | A | T | AAAAAGAAAAAACAAAAAAA | No | ||
| I | 2605862 | AACGTACTGAGGATATCGTT | T | ACCCCTTGCAGAAATATAGA | No | |||
| I | 2607673 | ATCCATGTCTGTAATATTTT | T | GGTTATTAATAAATTGAAAT | No | |||
| I | 2683903 | CAAATATCATCAGTGCGATC | C | AACAGCGGTATTTGTCTGAG | No | |||
| I | 2759872 | TATCTTCCCACCGTCGTTTC | C | TATCGGTAGCATATCCGATT | No | |||
| I | 3111507 | TGCGTTTTCTGTCTGTTGTG | G | A | ATGTCTCGCCTGGACTTCTT | No | ||
| I | 3115840 | ACAGATAAAGAGAGAAAAGT | A | C | CAAGCGTTTAAGCACCGAAG | No | ||
| I | 3119298 | AAAATCTTATTGATTGAAAT | A | G | CAATGCTTCGTAAACAATAC | No | ||
| I | 3125119 | TGCCAAACTCTTTTCTTCAT | T | ATGTTCTGTTGTGCCAAAGA | No | |||
| I | 3178496 | TAACTGGCAAATCGGCTCTT | T | CCCATAAGTAGACGATGATC | No | |||
| I | 3179237 | TGCTAAAATACAGTTAGTTA | C | G | TACTTGCTCACTTATATTTG | No | ||
| I | 3197530 | AATACTGCTGGAAATACAGG | G | TTTGGTTCGCAAGGTACTGG | No | DDJB:LC043101 | ||
| I | 3450130 | TTATTATTCCCAGGCACGGG | T | AAGTTCCAAAAATCGAATAT | No | |||
| I | 3460320 | TTTACAAAGTCGGACAATCC | C | TGGCGGCGGTGTTCTAAAAA | No | |||
| I | 3538415 | TAAAGTATCGGAATTACATT | T | CGTCAAACCAGCGTTTATGA | No | |||
| I | 3538428 | TTACATTCGTCAAACCAGCG | T | TTTATGATAAAAGATCATCC | No | |||
| I | 3538436 | GTCAAACCAGCGTTTATGAT | A | AAAAGATCATCCTATTCTAA | Yes | - | 8 | |
| I | 3538448 | TTTATGATAAAAGATCATCC | T | TATTCTAATTTTGCTATCGA | No | |||
| I | 3538450 | TATGATAAAAGATCATCCTA | T | TTCTAATTTTGCTATCGATA | Yes | - | 2 | |
| I | 3538454 | ATAAAAGATCATCCTATTCT | A | AATTTTGCTATCGATAGCCC | Yes | - | 4 | |
| I | 3538456 | AAAAGATCATCCTATTCTAA | T | TTTTGCTATCGATAGCCCTT | Yes | - | 2 | |
| I | 3583105 | TTATAAATTTATAAATGATA | A | G | AAATAAAGTGCAAGAAGAAT | No | ||
| I | 3665610 | CTAGATTTAACTTTGCAACG | C | TTTCGCAATCGGTGAACAGC | No | |||
| I | 3730377 | TGCAACAATTCATTTTTTTT | T | ACCTAATTTGTTTTCGACAA | No | X | ||
| I | 3855791 | GGCATTTTTCACGTACAGGT | T | AGTCGAAACATTATTAAATA | No | |||
| I | 4055068 | ATTTAAAAAAAAAAAAAAAA | A | TTATAAGACATACCCTTTCG | No | X | ||
| I | 4276903 | TAGAATGTTTTTTTTTTTTT | T | GAGAATATTATTCACACGCC | No | X | ||
| I | 4304172 | TCAAACCTATAAACAGGAAA | A | GATAAACGAAAATAGAATTA | No | |||
| I | 4374343 | AGGCTAAGTCTAGGTTGTAG | G | AAAAATCGTTTAGTCTGTAT | No | |||
| I | 4375420 | GTCTGAAGACTTTACCTTCT | T | A | TCTTTTGTGCTCCTATCAAA | No | ||
| I | 4407495 | TCTCGTATAAGTTCATCCTG | G | CGAAGCCGTTGTAGCCTATT | No | |||
| I | 4410193 | ATCGACACAGATCGCGGCGG | G | AAGAAAAAGCAACTGAAGAT | No | PMID:17035632 | ||
| I | 4431859 | ATCGAAACTACGTTGTGAAA | A | TAACTTAGCAAATATATGGT | No | |||
| I | 4431868 | ACGTTGTGAAATAACTTAGC | A | AAATATATGGTAAATAACAC | Yes | - | 9 | |
| I | 4442713 | TGGAAGCTGATTTTTTGTTA | A | G | TATGTCGTAAGTTACTGTGT | No | ||
| I | 4455162 | TAACTAGAAAAAAAAAAAAA | A | CCAAAGATAAAAAATGAAGT | No | X | ||
| I | 4721884 | AGTAGGAGTAGAAAAAAAAA | A | TTTTCAGCGCCTCGTCTCCT | No | X | ||
| I | 4764269 | TTTGAAAAAAAAAAAAAAAA | A | TTTCTACATTTCTTTCTTTA | No | X | ||
| I | 4919602 | GTTTTTTGGGTAAAGATCTA | G | A | AGGGTATATTGCTTTTTTAA | No | ||
| I | 5142628 | CTGAGGAAGACGTTCCGAAG | G | TAAAGTGGAAAACGTTAGAG | No | |||
| I | 5148423 | AATAAAACAGTAAAAAAAAA | A | GATAAAAAGCTGAACAGTAT | No | X | ||
| I | 5173097 | CACAGATAGCTTTTTTTTTT | T | AACAGGTACTTTATACATGG | No | X | ||
| I | 5368264 | AGTATAGTTGGTCTCCCTCC | C | ATATACGGTTTGGATAAGTT | No | |||
| I | 5368273 | GGTCTCCCTCCCATATACGG | T | TTTGGATAAGTTTCGCCTTG | Yes | - | 9 | |
| I | 5400079 | TACATTTTAGGATCAGCTCA | T | C | AAGTGTCCCTTTTTACAAGA | No | ||
| II | 37049 | ATTAATAATATATTTGCTCA | T | A | CCTAGATTTAAAGAATTTAG | No | ||
| II | 128007 | TCAGAGCAGTCAATAAAAAA | A | TAAAAAATCGAACAAAGGAA | No | X | ||
| II | 146086 | GCCCTCGCTTGTTCCCCCCC | C | TTATCTTACGAGTATATAGC | No | X | ||
| II | 266717 | ATTCATGAGATTCGTACACG | C | A | CCTTACCAAGTCTTGCCAGA | No | ||
| II | 266779 | TGTTAGGGGTGATATGGGTT | A | T | CGTTTTATCTGGGATCAAGG | No | ||
| II | 276538 | GACTTTAATTTATTCATGGA | T | A | CCTGAAGCTGCTCAAACTGC | No | ||
| II | 685727 | ATCTCGCTGCTCAAATGTCA | A | G | ATGCTGATTTTGGCTCCAAT | No | ||
| II | 699950 | TTTCTTTGAATTTTTTGTTT | G | T | GTATTTTAAATTTATTATCT | No | ||
| II | 699951 | TTCTTTGAATTTTTTGTTTT | T | G | TATTTTAAATTTATTATCTT | Yes | - | 1 |
| II | 699960 | TTTTTTGTTTTGTATTTTAA | T | A | TTTATTATCTTCCTGTCTTT | Yes | - | 9 |
| II | 700010 | CCTCTATTTTTACAGATTTA | A | CAAGTTTTCAACTTCGAAAC | No | |||
| II | 700018 | TTTACAGATTTAACAAGTTT | A | T | CAACTTCGAAACCCTAGAAA | Yes | - | 8 |
| II | 700019 | TTACAGATTTAACAAGTTTT | T | C | AACTTCGAAACCCTAGAAAT | Yes | - | 1 |
| II | 700020 | TACAGATTTAACAAGTTTTC | C | A | ACTTCGAAACCCTAGAAATT | Yes | - | 1 |
| II | 700023 | AGATTTAACAAGTTTTCAAC | A | T | TCGAAACCCTAGAAATTTTC | Yes | - | 3 |
| II | 700027 | TTAACAAGTTTTCAACTTCG | T | A | AACCCTAGAAATTTTCATAT | Yes | - | 4 |
| II | 700112 | CTTTATCAAAAGTTATCATT | T | A | AATTGCCCTGCAACCGATAT | No | ||
| II | 869805 | CTCTTCCAAGTCGGGTTCAT | C | G | ATGCACTAATGAATTGTAGA | No | ||
| II | 879032 | ACTAGAGAAAGAAAAAAAGT | A | T | ACAGTGGCTGATATTACAAT | No | ||
| II | 888600 | AAGAAAACTTTTGGTTATAC | C | GAAACTTTGTGTGAAATGTA | No | |||
| II | 903106 | AGCACAAACAATTCGAACTG | T | GTGCTAACATCTAATAAAGA | No | |||
| II | 923542 | TTTAAAAAAATGACAGACGA | A | C | TTAAACTATGTTTTGAAATT | No | ||
| II | 943553 | AGCAAAGAATGAAGCCCTTA | A | C | ATTTTTGGATAGTTTTAAGA | No | ||
| II | 953200 | GTCGTTTCGAAGTTTTAGAA | G | A | ATGAAAAAAATTGGGCGTCT | No | ||
| II | 967093 | GAATTTCCCTTGACTTTTGA | G | A | GGAAGCCATATCTTCGAGTT | No | ||
| II | 1155902 | CTTGCAAAAACAAAAATATA | A | T | ATCCTTTTTTCTGCTGTAAA | No | ||
| II | 1159677 | TGAGTTTATTCATGAATTGC | C | G | CGAAAATGAGGGTCCATCCG | No | ||
| II | 1159693 | TTGCGCGAAAATGAGGGTCC | T | A | TCCGTTCTCTACGATTCTGG | No | ||
| II | 1163155 | GTATATAAGTAAATAAAAAT | T | AGTATGCTTCTGGTCAACTA | No | |||
| II | 1308626 | GTTCGGCGAAGGTTTTTTTT | T | GCATTGATCAACAGGTGATG | No | X | ||
| II | 1672858 | GCTTCCGTTTATATACGCGT | T | C | GGACATATAACAATGAACTG | No | ||
| II | 1673001 | GATGCTCCACCACCTGAAAC | C | G | TTGATGCGTTCATTAGAGTT | No | ||
| II | 1678692 | TTTGCATTGGCAGCGACGTT | A | T | GTATTTGCCGGCAAGCCCAA | No | ||
| II | 1683323 | CATTATGGTTGGAAATGATG | G | T | AAACACCGTATACTTAGCTG | No | ||
| II | 1697123 | AGACTTGTTAATCATGTTAG | T | C | ACCTATGCTTTAATATAATT | No | ||
| II | 1716317 | TACCGAGAAAACTTTCGTCA | G | A | ATTTTATGGGCCTAATAATA | No | ||
| II | 1716319 | CCGAGAAAACTTTCGTCAAA | G | T | TTTATGGGCCTAATAATAAT | Yes | - | 2 |
| II | 1716325 | AAACTTTCGTCAAATTTTAT | T | G | GGCCTAATAATAATCTTATG | Yes | - | 6 |
| II | 1784825 | GGCCACATGTCATACATTGA | A | G | TACGACTGCAAAGTTGACCT | No | ||
| II | 1849776 | TGTCAGAATCATTGTCGAGG | A | G | TTTTGCATATCTCGTAAGCA | No | ||
| II | 1861420 | GAAAAGCATAAGAAGTTAAT | G | TACATAAAAGCACTTTAAAT | No | |||
| II | 1867805 | AAAGTACTTATTTTTTTTTT | T | ACGAATAAAATGTAAAAAAA | No | X | ||
| II | 1873781 | GTGGTTTGTAATATTCCTAA | A | CCACCCCATTTTTTTCTGGC | No | |||
| II | 1877305 | ACAGCCCGATTTTTTTTTTT | T | GTCTCAGTAATTCAAGAGAC | No | X | ||
| II | 1941966 | GATTCACATACCGAAGCGGA | T | GAAAATTAATAAATCAGAGT | No | |||
| II | 1941982 | CGGAGAAAATTAATAAATCA | T | GAGTTTTAACTCAAAGGAAG | No | |||
| II | 1948954 | CGGCGTTGAAGCGATCTTGA | A | GCGGCCTGGAGTGCGCGAGT | No | |||
| II | 1950052 | ATGTCGGCATTGCCAGAAGG | G | TTTTTGCTAGAGGCATAGCT | No | |||
| II | 1955509 | TTCCTTAAAAAAAAAAAAAA | A | GAAAGAAAATGAAAACTCAA | No | X | ||
| II | 1960392 | AATTAAATTGTCTAAACGTA | G | TTCGTTGCTCAAGCTTCCTT | No | |||
| II | 1962418 | TAAGAGAGAAAACTCGGTGT | A | T | TATTGGAAAAGTGGTACTAA | No | ||
| II | 1962438 | TTATTGGAAAAGTGGTACTA | G | A | CAAGTGTGGGAAGTATGTTT | No | ||
| II | 1962457 | AACAAGTGTGGGAAGTATGT | A | T | TGACAGATTCATTACATTAG | No | ||
| II | 1987097 | AGCTTCGCATAGACATATAC | A | C | AACGGAACGAATGACACCTG | No | ||
| II | 1987101 | TCGCATAGACATATACCAAC | G | GAACGAATGACACCTGGCAG | Yes | - | 4 | |
| II | 1987117 | CAACGGAACGAATGACACCT | G | GCAGTGAAAATTCCCTTTAT | No | |||
| II | 2044928 | AATTGACTTATCTATTAATT | T | A | ACTTGATTTTTGTTTGTTAG | No | ||
| II | 2049893 | GAAACTAGCTCATTATGATT | T | GAAGTTTGTGCCAGATAAAA | No | PMID:16823372 | ||
| II | 2053517 | AGTGATTTTCTCAAAAAGGC | C | TCTGCTACCCGTCATATTGT | No | PMID:16823372 | ||
| II | 2108180 | GTAAGATAATAAAGCATAAT | A | CCAATCTTCTTTGTTTGAAG | No | PMID:16823372 | ||
| II | 2187407 | CATTTTTCTTGGTGGGAAGG | A | CATCAAAAAAATCCCCCTGG | No | |||
| II | 2219929 | AATTGACTGTTTGGCTGTAT | T | GGTGATATGCTGAAAGCGAA | No | |||
| II | 2228774 | AAGACAAGATAAATAATAAG | G | T | TGGAAAAGTATATACCTCTG | No | ||
| II | 2228776 | GACAAGATAAATAATAAGTT | T | G | GAAAAGTATATACCTCTGTT | Yes | - | 2 |
| II | 2264919 | ATAATAAAAACATTTATTTA | C | A | GTTTTATTTTTGAACTTCTA | No | ||
| II | 2293304 | ATTTATCACAACGAAAAAAA | A | CTCGTATCACTATAATTTTT | No | X | ||
| II | 2436579 | ACCTTGCAGCCAACTACTTC | G | C | TCACCAATTACAACTTCTGC | No | ||
| II | 2444542 | GAATAATGCTTCCTACATTG | C | T | TACCGCCTATTTAATTACAA | No | ||
| II | 2592434 | CCTAAACATAAAAAAAAAAA | A | CTTACAATCAATGTATATGG | No | X | ||
| II | 2676335 | TTTTACCGGTTCTAAAATAT | T | C | CCAAAGACCTGAAACCCCCA | No | ||
| II | 2709415 | CGTAGCACAAGGCCGAGAGC | C | TCTTCTCATAGTGGCTCTTT | No | pers. | ||
| II | 2788933 | ATATTTTGCTGGATTAAAGC | G | AAATAACTTTTGCGTCAAAC | No | |||
| II | 2798041 | ACATTCATGGATGAAGACCT | T | GGGAACATGGGAAGGCCTAG | No | |||
| II | 2798514 | ATTCAGATGTCATGTTCAAA | G | AAAAAGATAGACTATCCTAT | No | |||
| II | 2811496 | CAGAAAGTACAAAGCAATCA | A | TACAAGAAGAAGAGAATATC | No | |||
| II | 2938969 | AGGCAACTTTTTTTTTTTTT | T | AAGGGTTGTAGTATTGTTTA | No | X | ||
| II | 3006136 | GTATTCTATACCTTGGGCAG | T | A | TTCTTCAAGCAATTTGGTCA | No | ||
| II | 3040333 | ACTCTAGATCTCCGTCTCCG | G | CTGCACGCCCTATTTCTCGC | No | PMID:16823372 | ||
| II | 3619004 | CAACCGAGAAGTCCCGGTAG | G | TTGCGTCTTTGTATATAAAG | No | |||
| II | 3838114 | AGACCTCAAAAAAAAAAAAA | A | GCGAAATGCTAACTTCAAAA | No | X | ||
| II | 4122325 | ATCGCTGTTAATGGTGCACA | C | T | ATCCACAACGTGATTGGAAC | No | ||
| II | 4254961 | TGGCCGGGTTATTCACAAGA | A | TACCTTTTATCCAGCTTGAC | No | |||
| II | 4400665 | CAAATTAAACAATCCAAACC | C | A | TAAATCGTCACCAGTACTAG | No | ||
| III | 227729 | TTTCGTGTTCACGAGGAAGA | T | A | CGTTGTTTTTGCACATAATG | No | ||
| III | 240810 | TGACCATACCATTGGGATGA | A | G | CCTTACTCTTGATTAGCTCG | No | ||
| III | 284656 | AGTATAACTAGCGCAGTAGG | A | C | AAAACAGAAGATTGTATGAG | No | ||
| III | 719956 | GTTTAATATATTTAATAAAC | C | TATTTTATTCTATGTCGAGA | No | |||
| III | 719970 | ATAAACCTATTTTATTCTAT | T | G | TCGAGAGAAGATTGAGATGA | No | ||
| III | 719973 | AACCTATTTTATTCTATGTC | G | AGAGAAGATTGAGATGATTA | Yes | - | 3 | |
| III | 719975 | CCTATTTTATTCTATGTCGA | A | G | AGAAGATTGAGATGATTAAT | Yes | - | 2 |
| III | 719977 | TATTTTATTCTATGTCGAGA | A | G | AAGATTGAGATGATTAATCA | Yes | - | 2 |
| III | 719978 | ATTTTATTCTATGTCGAGAG | T | A | AGATTGAGATGATTAATCAT | Yes | - | 1 |
| III | 719980 | TTTATTCTATGTCGAGAGAA | T | G | ATTGAGATGATTAATCATTC | Yes | - | 2 |
| III | 719984 | TTCTATGTCGAGAGAAGATT | T | G | AGATGATTAATCATTCCCTC | Yes | - | 4 |
| III | 719986 | CTATGTCGAGAGAAGATTGA | T | G | ATGATTAATCATTCCCTCTA | Yes | - | 2 |
| III | 719987 | TATGTCGAGAGAAGATTGAG | T | A | TGATTAATCATTCCCTCTAT | Yes | - | 1 |
| III | 719989 | TGTCGAGAGAAGATTGAGAT | T | G | ATTAATCATTCCCTCTATCT | Yes | - | 2 |
| III | 719990 | GTCGAGAGAAGATTGAGATG | T | A | TTAATCATTCCCTCTATCTA | Yes | - | 1 |
| III | 720000 | GATTGAGATGATTAATCATT | T | C | CCTCTATCTATTGATTGTTT | No | ||
| III | 720696 | TCCACAATTTTTTTTTTTTT | T | ACCATCTCCTTTAAATCAAA | No | X | ||
| III | 867874 | CTTTATTTTACTTTTTTTTT | T | ATATTTTTTAAAATATATTC | No | X | ||
| III | 1016312 | TAACAATGAAATAACGAAGC | C | TTCAGTATAATTAGTTCTAT | No | |||
| III | 1168327 | TCATAGCCTTTTATTACTAT | C | T | TGGGAAGTCAATTTTTAGTA | No | ||
| III | 1374937 | AGGTTGTTATGTTTCAGACT | T | A | TGATCATTACGGTGATACTG | No | ||
| III | 1685491 | GGCCACCACCAAGAAGAAAA | A | CCAAAGAAAAAGAACAGTCA | No | |||
| III | 1756401 | AAACCTTTGATGAAAGTTTA | A | TAAAGCTGCCAATGTATATA | No | |||
| III | 1765400 | TAAATTGCCGTATTATATTG | T | G | TACTATAACGAAATAATTGC | No | ||
| III | 1774235 | AACATCTTCCAAGTTCTCAT | GATC | CTTTAAAGATTCCTCAAGGT | No | PMID:16823372 | ||
| III | 2381978 | AATTTGATGTCTTAAATTTG | T | G | TGGTTTGCTTGAAGGCATAT | No |
Note: Many older S. pombe sequence submissions to the DNA databases (International Nucleotide Sequence Database Collaboration databases, i.e. ENA, GenBank, DDBJ) contain one or more errors, and we do not have the resources to maintain past sequences or flag every error in PomBase.
| Contig Name | Region | Size |
|---|---|---|
| unsequenced to chr1 left telomere | 10 ± 2 kb* | |
| c212 | sub-telomeric left arm | 29,663 bp |
| Gap | <5 kb* | |
| c977 | left arm and right arm | 5,549,370 bp |
| unsequenced to chr1 left telomere | 18 ± 3 kb* |
| Contig Name | Region | Size |
|---|---|---|
| AB325691 | chr2 left arm gap-filling contig | 20,000 bp** |
| Gap | 5 ± 5 kb | |
| c1348 | sub-telomeric left arm | 80,201 bp |
| Gap | 22 ± 5 kb* | |
| pB10D8 | left arm to centromeric gap | 1,536,269 bp |
| Gap | ~6 kb | |
| pJ5566 | right arm from centromeric gap to telomeric repeats | 2,923,134 bp |
| Contig Name | Region | Size |
|---|---|---|
| p20C8 | left arm from centromeric gap | 1,083,348 bp |
| Gap | 25.3 ± 6 kb*** | |
| c1676 | right arm from centromeric gap | 1,369,435 bp |
* pers comm. Randy Hyppa and Gerry Smith.
** Sasaki et al. (PMID:18727152)
*** pers comm. Chad Ellermeier and Gerry Smith.
We have a separate page discribing pending sequence updates.
PENDING 2008-08-29
The reference sequence appears to contain an extra ‘G’ at position 4410193 PMID:17035632, also confirmed by Broad sequence; Pers. comm. Aki Hayashi. Reported 2007-05-16
PENDING 2007-08-23
At 1999191 in Vps1 TGTGACC[C->G]TACGAC PMID:18088324, also confirmed by Broad sequence; Pers. comm. Isabelle Jourdain. Reported 2005-06-15
PENDING 2008-08-29
Map4 in the reference genome contains an array of 5 repeats. In PMID:168571979 repeats are reported. This number is the correct number of repeats and will be updated via an insertion into the contig sequence shortly. Pers. comm. Henar Valdivieso. Reported 2005-06-15
PENDING 2008-08-29
An apparent repeat region on chromosome 1 coordinates 4526059..4529095 (cosmid c27D7) is caused by a missassembly and will be removed from the genomic sequence shortly. The CDS feature SPAC27D7.10c within this region is an exact duplication of SPAC27D7.09c and will be merged with this CDS. Pers. comm. Klavs Hansen. Reported 2004-09-01
PENDING 2008-08-26
There are 4 bases missing from the sequence AACATCTTCCAAGTTCTCAT GATC CTTTAAAGATTCCTCAAGGT, which will change the C-terminal region slightly. This will be fixed in the next round of corrections.
PENDING 2008-08-26
Generated as part of a technology development project, using Illumina (Solexa) technology the Broad Institute generated >200-fold sequence coverage of the genome of S. pombe strain 972. These data identified 197 potential discrepancies. The discrepancy rate is about 1 in 100,000, which is close to the estimated error rate in published reference sequence. Further information and data here
Contigs merged into chromosomes: the 4 sequence gaps represented by 100 Ns
(Note: The chromosomes previously made available from the ftp site had 1000 Ns in the gaps)
Single base insertion at c21E11 from gagtgca to gagtgGca (in cyp8) base 4257404 in new chromsome file (note reverse strand sequence reported)
Single base transition A->C at c646 from aatggaccAtacccc to aatggaccCtacccc
(Note: This change does not affect sequence coordinates)
Single base deletion at c6B12 13981 from tgttctgcAtttttcc to tgttctgctttttcc
(Note: This change was not added to the spreadsheet on the ftp site until Jan. 18, 2006)
Added PCR product SPACPJ113 6900 with overlaps of 504 bp with c1856 and 147bp with p4C9
Joined contigs p4C9 and c977
| Genome Size (sequenced portion, excluding rDNA) | 12.57Mbp |
| Number of Chromosomes | 3 |
| Chromosome Size Range | 2.45Mbp - 5.58Mbp |
| Gene Count (protein coding genes on Chr I, II and III) | 5118 |
| Gene Count excluding dubious genes (protein coding genes on Chr I, II and III) | 5064 |
| Gene Density (genes per Mb) | 552.66 |
| Genome GC Content | 36.06% |
| Intergenic Length (mean for protein coding genes) | 227.37 |
| Intergenic GC Content (protein coding genes) | 28.94% |
| Mitochondrial Genome Size | 19.43kbp |
| Mitochondrial GC Content | 30.09% |
| Telomeric Located Contig Size | 20.00kbp |
| Telomeric Located Contig GC Content | 33.17% |
| Feature Type | Count | Gene Density | GC Content (%) | Mean Length (bp) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Exon | Intron | (genes per Mb) | Gene | Exon (All) | Exon (Coding) | Intron | 5' UTR | 3' UTR | Gene | Exon | Intron | 5' UTR | 3' UTR | |
| rRNA | 47 | 47 | 0 | 3.74 | 45.72 | 45.72 | 527.53 | 527.53 | |||||||
| snoRNA | 57 | 58 | 1 | 4.53 | 36.54 | 36.82 | 30.36 | 140.09 | 131.88 | 336.00 | |||||
| tRNA | 171 | 197 | 26 | 13.60 | 53.79 | 54.15 | 38.56 | 77.32 | 65.56 | 11.77 | |||||
| pseudogene | 28 | 50 | 22 | 2.23 | 38.95 | 39.25 | 30.90 | 1,047.39 | 565.70 | 47.36 | |||||
| mRNA (protein_coding) | 5118 | 10425 | 5307 | 407.10 | 37.08 | 37.39 | 39.63 | 29.72 | 33.24 | 32.27 | 2,147.68 | 1,011.98 | 83.27 | 290.05 | 428.79 |
| ncRNA | 1522 | 1527 | 5 | 121.06 | 35.82 | 35.82 | 27.94 | 1,248.46 | 1,244.21 | 49.40 | |||||
| snRNA | 5 | 6 | 1 | 0.40 | 40.03 | 40.47 | 34.00 | 147.40 | 114.50 | 50.00 | |||||
| Feature type | Count | GC content (%) | Mean length (bp) |
|---|---|---|---|
| rRNA | 2 | 31.97 | 2,122.00 |
| mRNA (protein_coding) | 11 | 29.39 | 1,393.00 |
| tRNA | 25 | 38.75 | 74.52 |
| Feature type | Count | GC content (%) | Mean length (bp) |
|---|---|---|---|
| mRNA (protein_coding) | 5 | 38.46 | 1,428.00 |
| Feature type | Count | GC content (%) | Mean length (bp) |
|---|---|---|---|
| mRNA (protein_coding) | 4 | 35.94 | 395.75 |
The fission yeast complete genome sequence currently stops short of the telomeric repeats. See the Sequencing Status page for the current assembly status.
The most proximal anchored cosmids to each telomere are (links to genome browser):
Details of all clones used for the assembly, and their order, length and overlap details is provided in a set of spreadsheets available from PomBase.
A contig extending the left arm of Chromosome II was sequenced by Sasaki et al. (PMID:18727152) and will be attached to the assembly in the next round of sequence changes. In the meantime, the contig can be viewed in the PomBase genome browser.
A set of small insert clones (FTP link; also see table) from a telomere plasmid library has been made available by Neal Sugawara. None can be assigned to a chromosome at present.
| Plasmid | Size of insert | Location of telomeric sequence | Comments | Vector | Laboratory | Funded by | Stage |
|---|---|---|---|---|---|---|---|
| pNSU28 | approx 1kb | Lies in pNSU21 | pUC19 | Hinxton | EC | finished | |
| pNSU31 | approx 1kb | Lies in pNSU21 | pUC19 | Hinxton | EC | finished | |
| pNSU68 | 423 bp | Internal | Contains 195 bp of telomeric DNA and 123 bp from the rDNA | pMLC28 | Hinxton | EC | finished |
| pNSU71 | 15 kb | Terminal | pMLC28 | Hinxton | EC | finished | |
| pNSU64* | 6.9 kb | Terminal | pMLC28 | Hinxton | EC | finished | |
| pNSU70 | 7.1 kb | pMLC28 | Hinxton | EC | finished | ||
| pNSU77* | 12 kb | Internal | Fusion between telomere sequences (7.1kb) and rDNA sequences (4.9kb) | pMLC28 | Hinxton | EC | finished |
| pNSU21 | 7.9 kb | Terminal | pNSU21 and pNSU65 were isolated from the first and second library respectively pMLC28 | Hinxton | EC | finished | |
| pNSU65 | 8.1 kb | Terminal | pNSU21 and pNSU65 were isolated from the first and second library respectively pMLC28 | Hinxton | EC | finished |
Table notes: “Terminal” refers to the position adjacent to the vector sequences of pMLC12 where the blunt end (SmaI end) ligated to the telomeric sequences. “Internal” means that an S. pombe sequence intervenes between the telomere and vector sequences.
PomBase accepts batch submissions of certain types of data that appear on PomBase gene pages.
To submit any of these data types, please prepare a file in the format indicated, and send it to the helpdesk:
List of gene names that have been used to refer to two (or more) different genes. Resolution of these conflicts is under consideration by the Gene Naming Committee. Upon conflict resolution, the name will become a secondary name for at least one of the genes for which it has been used (a database search will still retrieve all usages). Systematic IDs, and primary names where available, for the conflictingly-named genes are listed in columns 2 and 4.
| Conflict | Systematic ID | Detail | Systematic ID | Detail | Comments |
|---|---|---|---|---|---|
| abc1 | abc1/SPBC2D10.18 | N Bonnefoy, 28 Aug 96 | ybt1/SPAC9E9.12c | J Davey, 11 Nov 96 | |
| ade8 | ade8/SPBC14F5.09c | ade5/SPCC569.08c | mapped ade5 was misnamed as ade8 from its S. cerevisiae ortholog; ade8 is now designated obsolete for SPCC569.08 | ||
| car1 | bsu1/SPAC17A2.01 | Jia et al. 1993 | car1/SPBP26C9.02c | arginase, Van Huffel 1994 | sod1 is used for superoxide dismutase (SPAC821.10c) so is a synonym, not a primary name, for SPAC17A2.01 |
| dim1 | SPBC336.02 | 18S rRNA dimethylase, Housen 95 | dim1/SPCC16A11.05c | U4/U6.U5 snRNP, Berry & Gould 97 | |
| gpd1 | gpd1SPBC215.05 | glycerol-3-p DH, J. Armstrong Oct 90 | tdh1/SPBC32F12.11 | glyceraldehyde-3-p DH, M. Vai Mar 95 | implemented suggestion to make tdh1 primary and gpg1 secondary for SPBC32F12.11 |
| hcs | hcs1/SPAC4F8.14c | Katayama, Jul 95 | SPCC737.07c | Add “1” for consistency | |
| krp1 | krp1/SPAC22E12.09c | klp3/SPAC1834.07 | krp1 is a synonym for klp3 | ||
| mip1 | pog1/SPCC24B10.22 | DNA pol gamma, Copeland Jan 95 | mip1/SPAC57A7.11 | WD repeat, Yoshinori Sep 99 | |
| pab1 | pab1/SPAC227.07c | phosphatase, Kinoshita 95, (Yanagida lab) | SPAC57A7.04c | poly(A) binding, Burd 91 | |
| sod2 | sod2/SPAC977.10 | sodium antiporter, 92 | SPAC1486.01 | Jeong & Roe, Dec 99 | |
| ssp1 | ssp1/SPCC297.03 | p kinase, Matsusaka Oct 95 | ssc1/SPAC664.11 | chaperonin, Powell 90 | |
| ppa1 | ppa1/SPAC823.15 | minor serine/threonine protein phosphatase pp2a-1 catalytic subunit, Kinoshita et al. Oct 90 | SPAC23C11.05 | inorganic pyrophosphatase, Kawasaki et al. Oct 90 | ppa1 not published for SPAC23C11.05 so attached as obsolete gene name |
| ef1a-a, ef1a-b, ef1a-c | SPCC794.09c, SPAC23A1.10, SPBC839.15c | Elongation factor 1 alphas | All old, non-standard names obsoleted. These three kept temporarily to distinguish the three genomic copies. Current conventions need checking (Morimyo paper). (I haven’t been able to identify which is which from this as base differences in the sequenced clones or the genome sequence mean they cannot be mapped unambiguously. Needs investigating; our B and C are identical.) SPAC23A1.10 has standard name tef102. | ||
| skp1 | skp1/SPBC409.05 | gsk3/SPAC1687.15 | Agreed that skp1 can be used for SPBC409.05 | ||
| spp1 | spf1/SPCC594.05c | spp1/SPAC6B12.10c |
The Gene Naming Committee was initiated by Amar Klar, Paul Nurse and Mitsuhiro Yanagida to unify fission yeast gene names for newly defined genes, and resolve gene name conflicts.
The gene name registration form will return soon. To reserve a gene name in the meantime, please email the helpdesk and include:
How to choose and reserve a gene name; name conflict resolution
Historical note: Inventories of reserved gene names and gene name conflicts were maintained in the past, but have not been updated for several years.
| Member | Affiliation |
|---|---|
| Susan Forsburg | Molecular and Computational Biology Section, University of Southern California |
| Olaf Nielsen | Department of Biology, University of Copenhagen |
| Snezhana Oliferenko | The Francis Crick Institute & Kings College London |
| Takashi Toda | Hiroshima University |
| Nancy Walworth | Robert Wood Johnson Medical School, Rutgers University, NJ |
| Yoshinori Watanabe | Jiangnan University, China |
| Valerie Wood | PomBase, University of Cambridge |
| Paul Young | Queens University at Kingston, Ontario |
To avoid gene naming conflicts, the S. pombeGene Naming Committee accepts reservations for gene names that will be published imminently. This does not guarantee that no one else will use your reserved gene name, but the naming committee will actively discourage alternative usage. If we become aware of a nomenclature conflict, we will attempt to notify all parties.
Gene name conflicts in which multiple names have been used to describe one gene or, conversely, one name has been applied to multiple genes, will be resolved within 12 months. Whenever possible, all interested parties will be involved in the resolution of the conflict. We recognize that each case is unique, and we will choose the most appropriate solution using the following guidelines:
Gene naming guidelines and how to submit a new gene name
Data formats and instructions for submitting large sets of GO, phenotype, modification, or gene expression data.
Metadata format and instructions for submitting sequence-linked data to be displayed as a track in the genome browser.
To submit information on individual genes, use the Contact Curators link provided on the relevant PomBase gene page